TPBC tissue and cell line
We retrospectively collected data and tissue specimens from 69 patients with TPBC who had undergone tumor surgical resection at the Second Hospital of Jilin University between January 2009 and January 2013. Patients administered preoperative neoadjuvant chemotherapy or hormonal treatment were excluded from this study. The 69 patients had been diagnosed with invasive carcinoma of no special type. The last follow-up was conducted in April 2018 (mean follow-up duration: 44.2 months, range: 1.67–72.10 months).
Clinicopathological data were retrieved from patient medical records. These parameters included patient age at initial diagnosis, histological subtype, tumor size, lymph node metastasis, and clinical outcome. The study protocol was approved by the Institutional Ethics Committee of the Second Hospital of Jilin University, Jilin, China (IRB approval number: 2020008). The need for written informed consent was waived because of the retrospective nature of the study.
Two-micrometer-thick sections were prepared from paraffin blocks of breast cancer tissues retrieved from the Pathology Department, Second Hospital of Jilin University, for immunohistochemistry and hematoxylin and eosin staining. The latter was used to confirm the diagnoses, and the results were reviewed by Min Yao and Yunhe Gao. Tumor histological grades were assessed using the Nottingham grading system [19].
A human breast carcinoma cell line, BT474, which is a TPBC cell line, was purchased from the American Type Culture Collection (Manassas, VA, USA). The cell line was maintained in RPMI-1640 supplemented with 10% fetal bovine serum at 37°C in a humidified atmosphere with 5% CO2.
Immunohistochemistry
Immunohistochemical staining was performed automatically using the PT Link Pre-Treatment system and Autostainer Link 48 system (both from DAKO, Carpinteria, CA, USA). Endogenous peroxidases were quenched with 3% H2O2 for 10 min. The sections were incubated with primary antibodies against TTK (Cat. #AF6028; NOVUS, St. Louis, MI, USA; 1:200 dilution in phosphate-buffered saline [PBS]) and AKT (Cat. #4691) and Ki-67 (Cat. #9449) from Cell Signaling Technology (Danvers, MA, USA) at 1:300 dilution in PBS for 30 min, followed by the secondary biotinylated antibody for 20 min. The slides were stained using 3, 3′-diaminobenzidine and counterstained with hematoxylin.
Review and scoring of immunostained tissue sections
The immunostained tissue sections were independently reviewed and scored by two investigators to determine the immunostaining percentage and staining intensity, as described previously [20]. A numerical final expression score (FS) was calculated for each tissue sample by multiplying the staining intensity (I) score (0, negative; 1, weak; 2, moderate; 3, strong staining) by the percentage (P) of positively stained cells (FS = P × I). Final expression score, therefore, ranged from 0 to 300. Thereafter, each case was scored as positive or negative using the median final expression score as the cutoff value for statistical analysis [21].
Cell proliferation and colony formation experiments
Cells were seeded into 96-well plates at a density of 5.0 × 103 cells per well and cultured for 24 h. The cells were then incubated with 10 µL of CCK-8 (Beyotime Biotechnology LLC, Shanghai, China) solution for 30–45 min at 37°C. Absorbance at 450 nm was detected with a microplate reader (Model 680; Bio-Rad, Hercules, CA, USA). The cell inhibitory index was calculated as [1–(A450sample–A450blank)/(A450control–A450blank)] ×100%. The transfected cells were seeded into a culture plate at 200 cells/well, and after 2 weeks of incubation, the cells were washed with PBS and stained with Giemsa solution. The number of colonies containing > 50 cells was counted under a microscope.
Western blot analysis
Cells were lysed using RIPA buffer (Beyotime Biotechnology), vortexed for 30 s, and centrifuged at 14000 ×g for 5 min. The supernatants were collected and stored at − 20°C. The whole-cell lysates were resolved by SDS-PAGE, and the proteins were blotted onto a nitrocellulose membrane. The expression of various proteins was detected using primary antibodies against the following: TTK (Cat. #AF6028; NOVUS; 1:500 dilution in PBS); AKT (Cat. #4691), CCND1 (Cat. #55506), CCND2 (Cat. #3741), CDK4 (Cat. #12790), CDK6 (Cat. #13331), p21 (Cat. #2947), E-cadherin (Cat. #14472), N-cadherin (Cat. #13116), vimentin (Cat. #5741), and Snail (Cat. #3879) from Cell Signaling Technology at 1:1000 dilution in PBS, and β-actin (Cat. #HC201-01; TransGen Biotechnology LLC, Beijing, China; 1:1000 dilution in PBS). The corresponding secondary antibodies were anti-mouse and anti-rabbit antibodies. Immunoreactive bands were visualized via enhanced chemiluminescence.
The 5-ethynyl-2′-deoxyuridine (EdU) proliferation assay
To demonstrate the effect of TTK on the proliferation of BT474 cells, an EdU proliferation assay was performed according to the manufacturer’s instructions. The cells were incubated with 50 µM EdU for 2 h and stained with Ado-Lo and 4′,6-diamidino-2-phenylindole (DAPI). The number of EdU-positive cells was detected via fluorescence microscopy. The display rate of EdU-positive cells was calculated as the ratio of the number of EdU-positive cells to the total number of DAPI-stained cells (blue cells).
Cell transfection
A TTK-targeting short hairpin RNA (shRNA) plasmid, pLVshRNA-EGFP(2A)Puro-TTK-shRNA1 (#P11886; MiaoLingBio, Changchun, China), which also expressed green fluorescent protein, was constructed and transfected into BT474cells. A functional, nontargeting shRNA, and an empty vector were used as controls.
Quantitative reverse transcription-PCR (qRT-PCR)
Total RNA was isolated from 5 × 106 cells by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Total RNA concentration and purity were analyzed in duplicate samples by using a NanoDropND-2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized from qualified RNA by using an RT-PCR reverse transcription kit (TransGen Biotechnology LLC), and 1 µg of total RNA was reverse-transcribed into cDNA under the following conditions: 25°C for 10 min, 42°C for 30 min, and 85°C for 5 s, as per the manufacturer’s recommendations. The cDNA was stored at − 20°C until use. PCR was performed using a PCR kit (TransGen Biotechnology LLC), and the PCR products were electrophoresed on 1.5% agarose gels. qPCR was conducted with either Taq-Man or SYBR Green PCR reagents on an ABI Prism 7300 detection system (all from Applied Biosystems, Foster City, CA, USA). The reaction program was as follows: 95°C for 3 min, followed by 40 cycles at 95°C for 30 s and 55°C for 20 s, and 72°C for 15 s. GAPDH served as an internal control, and relative mRNA levels were calculated using the 2−ΔΔCt method[22]. The following primers were synthesized by Sangon Biotech (Shanghai, China):
TTK, (qRT-PCR)-forward: TCCCCAGCGCAGCTTTCTGTAGA;
TTK, (qRT-PCR)-reverse: CCAGTCCTCTGGGTTGTTTGCCAT;
GAPDH, (qRT-PCR)-forward: GGAGCGAGATCCCTCCAAAAT;
GAPDH, (qRT-PCR) -reverse: GGCTGTTGTCATACTTCTCATGG.
Transwell invasion assay
The transfected cells were inoculated into the upper chamber of a Transwell chamber (Corning, Inc., Corning, NY, USA) at 1×105 cells/mL, and RPMI-1640 medium supplemented with 30% fetal bovine serum was added to the lower chamber. The cells were cultured in 5%CO2 and 100% humidity and at 37°C constant temperature for 24 h. The chamber was removed, and the cells were rinsed with PBS and fixed in absolute ethanol for 40 min. After crystal violet staining, the cells that did not pass through the upper chamber were wiped off using a cotton swab, and cells that had passed through the upper chamber were counted under an inverted microscope. Finally, invasive cells on the lower surface of the membrane were counted using a microscope. Five fields of view were randomly selected to detect changes in invasion ability. The experiment was repeated three times.
Animal studies
Fourteen female BALB/c nude mice (6 weeks old) were purchased from SPF Biotechnology (Beijing, China) and randomized into two groups. All animal experiments were conducted in accordance with the institutional guidelines and approved by the Experimental Animal Ethical Committee of Jilin University. Cells were injected subcutaneously into the right buttock of each mouse at 1 × 106 cells per 0.1 mL PBS. All mice were maintained in a standardized barrier system environment at the Animal Experiment Center of the Basic Medical College of Jilin. After 4 weeks of observation, the mice were euthanized. The xenograft tumors were removed and fixed in 10% formalin. The tumors were measured using a Vernier caliper, and the volume was calculated using the following formula: V = (width2 × length)/2[23]. The xenograft tumors were examined macroscopically and subjected to hematoxylin and eosin staining and immunohistochemistry.
Statistical analyses
All statistical analyses were performed using SPSS v. 21.0 (SPSS, Inc, Chicago, IL, USA). Continuous variables were evaluated using the Mann-Whitney U test, whereas categorical variables were analyzed with the chi-squared test. Furthermore, significant variables (P < 0.05) from the univariate analyses were included in multivariate analyses. A multivariate Cox proportional hazards model was used to obtain hazard ratios for survival and to identify factors affecting disease-free survival (DFS) and overall survival (OS). Kaplan–Meier survival curves and log-rank tests were used to evaluate DFS and OS. Experiments were repeated at least three times. P < 0.05 was considered to indicate statistically significant differences.