Clinical characteristics of patients with osteosarcoma
The clinical cohort from the bone tumor center of Peking University People’s Hospital included 70 patients with osteosarcoma and 9 patients with benign tumor. Patients were subjected to surgery between 2018 and 2019 at our tumor center. 22 healthy donors were included in the analysis. Fasting blood of 79 patients (70 osteosarcomas and 9 benign tumors) and 22 healthy donors was collected in plasma separator vacutainer tubes. All clinical samples were collected with written informed consent from patients and healthy donors, and the ethical approval was granted from the Committees for Ethical Review at our hospital. Clinical information included age, gender, side,location༌tumor grade, treatment with neoadjuvant chemotherapy, pulmonary metastasis.
Cell Lines Culture
The human HOS, KHOS, U2OS and 143B cell lines were preserved in our laboratory. The cells were repeatedly cultured in RPMI 1640 with 10% fetal bovine serum, 100 U/mL penicillin, and 100 µg/mL streptomycin in a humidified cell incubator with an atmosphere of 5% CO2 at 37 °C. Cells growing at an exponential rate were used for the experiments.
Generation Of Stable Rab27a And Pd-l1 Knockdown 143b Cells
Lentiviruses containing shRNA targeting human Rab27a or PD-L1 (Hanheng Biotechnology, Shanghai, China) were transfected into 143B cells to knock down endogenous Rab27a or PD-L1. Short hairpin RNAs (shRNAs) against human Rab27a (Top strand: GATCCGCCAAGCAATTGAGATGCTTCTGGATTCAAGAGATCC
AGAAGCATCTCAATTGCTTGGCTTTTTTG; Bottom strand: AATTCAAAAAAG
CCAAGCAATTGAGATGCTTCTGGATCTCTTGAATCCAGAAGCATCTCAATTGCTTGGCG) or human PD-L1 (Top strand: GATCCGCGAATTACTGTGAAAGTC
AATTTCAAGAGAATTGACTTTCACAGTAATTCGTTTTTTG; Bottom strand: AATTCAAAAAACGAATTACTGTGAAAGTCAATTCTCTTGAAATTGACTTTCACAGTAATTCGCG) was packaged into lentiviral particles using 293T cells co-transfected with the viral packaging plasmids. Lentiviral supernatants were harvested 48 h after transfection. 143B cells were infected with filtered lentivirus and selected by 1 µg/ml puromycin.
Exosome Isolation
Cells were subsequently cultured with FBS-free DMEM medium for 72 h. Conditioned culture media was collected. Exosomes were isolated from the conditioned culture media by four successive centrifugation steps as the following steps. Culture media samples were centrifuged at 300 g for 10 min at 4 °C to discard floating cells. Supernatants were centrifuged at 800 g for 30 min, and 10,000 g for 30 min to further purify the ascites. Then 10 ml ascites was diluted in 10 mL PBS and filtered by a 0.22 µm filter. After that, the samples were centrifuged at 150,000 g for 2 h at 4 °C. The supernatant was discarded, and the exosome pellet was re-suspended in PBS. The samples were centrifuged at 150,000 × g 4 °C for 2 h in a last step. The final pellets of exosomes were stored at -20 °C.
For iodixanol density gradient centrifugation, exosomes harvested by differential centrifugation were loaded on top of a discontinuous iodixanol gradient (5%, 10%, 20% and 40%, made by diluting 60% OptiPrep aqueous iodixanol with 0.25 M sucrose in 10 mM Tris) and centrifuged at 100,000 g for 18 h at 4 °C (Beckman Coulter). The exosomes distributed at the density range between 1.13 and 1.19 g/ml, as previously demonstrated. The exosomes were further pelleted by ultracentrifugation at 100,000 g for 2 h at 4 °C[23, 24].
Characterization Of Purified Exosomes
For transmission electron microscopy (TEM) analysis, the exosome pellet resuspending solution was loaded onto formvar/carbon-coated EM grids, fixed with 2% paraformaldehyde (PFA), and stained with 1% aqueous uranyl acetate, then dried at room temperature. The samples were examined using an device TEM. For nanoparticle tracking analysis (NTA), vesicle enriched suspension with concentrations between 1 × 107/mL and 1 × 109/mL was examined using the ZetaView PMX 110 (Particle Metrix, Meerbusch, Germany) equipped with a 405 nm laser to determine the size and quantity of particles isolated. A video of 60-sec duration was taken with a frame rate of 30 frames/sec, and particle movement was analyzed using NTA software.
Exosome Protein Quantification And Western Blot Analysis
The concentration of exosomal total protein was quantified by the bicinchoninic acid (BCA) assay (Thermo Fisher Inc.) using bovine serum albumin (BSA) as standard. The concentration of exosomal total protein in the serum was analyzed between six healthy donors and six patients with osteosarcoma. The pellets were also dissolved in 200 µL RIPA buffer for protein assay. The samples were individually homogenized in 5 mM Tris–HCI (4 mM EDTA, pH 7.4, containing 1 M pepstatin, 100 M leupeptin, 100 M phenylmethyl sulfonylfluoride, and 10 g/ml aprotinin) and cleared by centrifugation at 14,000 g for 10 min at 4 °C. Approximately 100 ug of protein were run on a discontinuous SDS-PAGE gel and transferred to a nitrocellulose membrane. The membranes were blocked with 5% skim milk in TBS containing 0.05% Tween 20 and were incubated with the following primary antibodies: (1) Mouse anti-CD9 (sc-13118, Santa Cruz, CA, USA), (2) Mouse anti-CD63 (sc-5275, Santa Cruz, CA, USA), (3) Mouse anti-TSG101 (sc-7964, Santa Cruz, CA, USA), (4) Mouse anti-Alix (sc-53540, Santa Cruz, CA, USA), (5) Mouse anti-calnexin (10427–2-AP, Promega, Madison, WI), (6) Mouse anti-PD-L1 (sc-293425, Santa Cruz, CA, USA) and Mouse anti-GAPDH (sc-47724, Santa Cruz, CA, USA). The optical density (OD) of the signals was quantified and expressed as the ratio of the tested proteins to GAPDH for analysis of protein in cells and to ALIX for analysis of protein in exosomes.
Comparision of RNA quantification in Sr-exosomes between patients with OS and healthy donors
Total RNA was isolated from serum exosomes of patients with osteosarcoma and healthy donors using TRIzol Reagent (Invitrogen) and the concentration of exosomal RNA in the serum was analyzed between six healthy donors and six patients with osteosarcoma.
Quantitative Pcr (qpcr)
Total RNA was isolated from 143B-WT and 143B-Rab27a-KD using TRIzol Reagent (Invitrogen), and reverse transcribed into first-strand complementary DNA (cDNA) with random primer with RevertAid First Strand cDNA Synthesis Kit (ThermoFisher Scientific). The samples were then analysed in an Applied Biosystems QuantStudio 3 Real-Time PCR system. GAPDH was used as an internal control.
Immunohistochemistry Analysis
Paraffin sections were incubated with the corresponding antibodies and stained with nonimmune serum in PBS instead of the primary antibody as the negative control. Based on the average percentage of positive cells calculated from at least 10 representative fields, positive staining was defined as a positive cell percentage ≥ 10%. Staining intensity was classified as follows: 0, no staining or staining in < 10% of tumor cells; 1+, weak to moderate staining in 10 to 20% of tumor cells; 2+, strong staining in 10 to 20% of tumor cells or weak staining in 20 to 50% of tumor cells; 3+, moderate to strong staining in 20 to 50% of tumor cells or staining in 50% of tumor cells. The immunostaining assessment was conducted by two independent pathologists without any previous knowledge of the clinical characteristics and outcomes[26]. The primary antibodies were as follows: (1) Mouse anti-PD-L1 (sc-293425, Santa Cruz, CA, USA), (2) Rabbit monoclonal anti-E-cadherin (ab194982), (3) Rabbit polyclonal anti-N-cadherin (ab18203), (4) Rabbit monoclonal anti-vimentin (ab92547).
Immunogold Labeling
Fixed specimens at an optimal concentration were placed onto a 400 mesh carbon/formvar coated grids and allowed to absorb to the formvar for a minimum of 1 minute. The grids were placed into a blocking buffer for a block/permeabilization step for 1 hour. Without rinsing, the grids were immediately placed into the primary antibody at the appropriate dilution overnight at 4 °C (Mouse anti-PD-L1, sc-293425, Santa Cruz, CA, USA). As controls, some of the grids were not exposed to the primary antibody. The following day, all the grids were rinsed with PBS then floated on drops of the appropriate secondary antibody attached with 10 nm gold particles (AURION, Hatfield, PA) for two hours at room temperature. Grids were rinsed with PBS and were placed in 2.5% Glutaraldehyde in 0.1M Phosphate buffer for 15 min. After rinsing in PBS and distilled water the grids were allowed to dry and stained for contrast using uranyl acetate. The samples were viewed with a Tecnai Bio Twin transmission electron microscope (FEI, Hillsboro, OR) and images were taken with an AMT CCD Camera (Advanced Microscopy Techniques, Danvers, MA).
Bioinformatics analysis of Sr-exosomes from 20 OS patients and 6 healthy donors
Exosomal RNA was extracted using RNeasy® Mini kit (Qiagen, cat. No. 217004) according to the manufacturer’s instructions. RNA quality was assessed by using UV 260/280. The pellets were also dissolved in 1 ml Trizol LS reagent (Invitrogen) for RNA isolation. Then, we used NGS to get sequencing data of mRNA in different Sr-exosomes from 20 patients with osteosarcoma and 6 healthy donors. These sequencing data were analyzed by bioinformatics method. Differentially expressed genes were identified based on RVM t test and false discovery rate (FDR) analysis. Differentially expressed genes with at least 1.2-fold change in either direction with P < 0.05 were considered to be up or downregulated. Based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, significantly changed pathways were identified. GO analysis was used to organize differentially expressed genes into hierarchical categories.
Microarray Analysis Of Exosomes Isolated From 143b And Uos
Exosomal RNA of 143B and U2OS was extracted using Affymetrix Pico Kit and purified with an RNeasy mini kit (Qiagen GmbH, Hilden, Germany). cDNA was synthesized with One-Cycle Target Labeling and Control Reagents, and cRNA was created using a GeneChip IVT Labeling kit (both from Affymetrix; Thermo Fisher Scientific, Inc.). cRNA was fragmented, and then hybridized to an Affymetrix Human Clariom D Array (Affymetrix; Thermo Fisher Scientific, Inc). GeneChips were washed and stained in the Affymetrix Fluidics Station 450. All arrays were scanned using the Affymetrix GeneChip Command Console, which was installed in the GeneChip Scanner 3000 7G. The data were analysed with the Robust Multichip Analysis (RMA) algorithm using the Affymetrix default analysis settings and global scaling as a normalization method. Values presented are log2 RMA signal intensities. Differentially expressed mRNA were identified using the Student's t-test for comparison of 143B (high metastatica ability) and U2OS (low metastatica ability)[18]. Genes were considered differentially regulated between the two groups when there was > 2-fold difference in expression with P < 0.05. Differentially expressed mRNA with at least a 2-fold change in either the positive or negative direction were respectively considered up- or downregulated.
Exosome labeling and osteosarcoma cell uptake in vitro
To examine whether Sr-exosomes derived from the patient with osteosarcoma can be taken up by osteosarcoma cell lines, 143B and U2OS, PKH26 (Sigma-Aldrich, PKH26GL) was used to label exosomes. The exosomes or PBS were stained with PKH26 dye in 400 µl of Diluent C for 4 min at room temperature. Then an equal volume of 1% BSA were used to stop the labeling reaction, after which they were washed with PBS and ultracentrifuged again. The labeled exosomes or PBS were respectively incubated with 143B and U2OS cells with complete medium for four hours at 37 °C in an atmosphere of 5% CO2. Then the cells were washed three times in PBS to eliminate the influence of serum exosomes. The cell nuclei was counterstained with DAPI for 8 min and cell membrane were counterstained with CFSE (Sigma-Aldrich) for 5 min. The uptake of the labeled exosomes by 143B and U2OS cells was assessed using an inverted confocal microscope.
Cell Counting Kit 8 Assay And Transwell Assay
For the assessment of serum exosomes of patients with OS on 143B and U2OS cell proliferation, cells were seeded at a density of 2000 cells per well in 96-well plates. The cells were treated with different exosome concentration of 10, 20, 30, 40 ug/ml for 24, 48 and 72 hours. Cell proliferation was analyzed using Cell Counting Kit 8 (Dojindo, Kumamoto, Japan) according to the manufacturer's protocol.
For the evaluation of serum exosomes of patients with OS and healthy donors on 143B and U2OS migration and invision, cells (6 × 104) were respectively seeded into the non-coated upper chamber of transwell plates (8 mm pore size; Corning) for a migration assay and into matrigel coated upper chamber (BD Bioscience, 354234) for an invasion assay with 50 ug/ml exosomes. For the evaluation of exosomes derived from osteosarcoma on 143B and U2OS migration and invision, the same procedure as above mentioned was performed with 10 ug/ml and 50 ug/ml. After culturing for 24 h, cells were fixed with methanol and stained with a 0.1% crystal violet solution. Migrated cell populations were evaluated in five fields per well under a microscope.
Wound-healing Assay
Confluent 143B cell monolayers were scratched with a sterile 100-µl pipette tip and treated with or without GW4869 at a dose of 1ug/ml. Cell migration was monitored for 24 and 48 hours under a microscope. The widths of the ‘wound’ (scratched areas) were measured and the proportion of wound healing was calculated by the following formula: 100%-(width after 24 h/width at the beginning) × 100%.
ELISA analysis of Sr-exosomal PD-L1 expression for patients with OS
For detection of PD-L1 on exosomes, the serum from patients was analyzed by ELISA. Exosomes were isolated as above mentioned and then resuspended in 100 ul PBS. 50 ul suspense was analyzed as the schematic diagram shown in Figure-4N. Equilibrate all materials and prepared reagents to room temperature prior to use. All standards, controls and samples were analyzed in duplicate. The protocol was followed as the instruction (ab214565, Human PD-L1 SimpleStep ELISA® Kit). Calculate the average absorbance value for the blank control (zero) standards. Subtract the average blank control standard absorbance value from all other absorbance values. Create a standard curve by plotting the average blank control subtracted absorbance value for each standard concentration (y-axis) against the target protein concentration (x-axis) of the standard. Use graphing software to draw the best smooth curve through these points to construct the standard curve. Determine the concentration of the target protein in the sample by interpolating the blank control subtracted absorbance values against the standard curve. Multiply the resulting value by the appropriate sample dilution factor, if used, to obtain the concentration of target protein in the sample. Highest standard should be further diluted and reanalyzed. Similarly, samples which measure at an absorbance values less than that of the lowest standard should be retested in a less dilute form.
Pulmonary Metastatic Model Study
All protocols were approved by the animal care committee of the Peking University Health Science Center. We have minimized the number of animals used and their suffering.
Experiment NO 1 in vivo, to evaluate the effect of 143B-derived exosomes and inhibitor of exosome secretion GW4869 on pulmonary metastasis, 143B cells were injected into tail vein of six-week-old female BALB/c nude mice (Vitalriver, Beijing, China) in a volume of 10 µL (50,000 cells) as the primary injection. Administration of PBS, GW4869 (at a dose of 2.5 mg/kg, from day 3 to day 21, once three days, eight times in total. Sigma-Aldrich, cat. D1692) and 143B-derived exosome (at a dose of 10ug per mouse, from day 3 to day 21 once three days, eight times in total) as secondary injection were performed after primary injection. Mice were euthanized at four weeks after the secondary injection. Experiment NO 2 in vivo, the model and treatment were followed as the flowchart indicated in Figure-6H. The mice were sacrificed at four weeks after secondary injection. The lung specimen were stored at -80℃ for experiments.
Haematoxylin And Eosin Staining
Mice were sacrificed at four weeks (Experiment NO 1 and 2 in vivo) after secondary injection and the lung tissue were dissected. Osteosarcoma specimen of patients were stored at -80℃ after resection. The tissue was fixed in 10% formalin at room temperature overnight and consequentially dehydrated in 70% ethanol. Samples were mounted in paraffin blocks and sectioned at 5 mm of thickness. Slides were baked at 60℃ for 15 minutes, then treated with Xylene Substitute (Citrisolv) (Fisher chemical cat. x3p-1GAL) then rehydrated and stained with Hematoxylin, followed with washes with running water. An incubation with Acid Alcohol (Sigma, cat. A3429) was performed, followed with washes with running water. The samples were then stained with eosin (Thermo Scientific) then dehydrated with ethanol followed by Xylene Substitute (Citrisolv). Samples were mounted with Permount (Fisher Scientific, cat. SP15-500). Slides were submitted for pathologic evaluation. Pathologist was blinded to the sample.
The mouse weight was recored for analysis and lungs were collected after H&E staining. Metastasis was measured by visually counting the number of metastatic nodules, maximum diameter per metastatic nodule and cross-section area per metastatic nodule in the entire mouse lung section for each mouse, using Nikon NIS-Elements software (Nikon Corporation Instruments, Tokyo, Japan).