Study population and clinical examinations
The study population consisted of 29 patients with CAP and 19 patients who had undergone orthodontic removal of healthy tooth tissue at the periodontal ligament (controls) at the Dental Hospital of Dalian Medical University from January 2019 to December 2020. All tissue samples were collected with the approval of the Ethics Committee of Dalian Medical University (approval number: 202106) and the patient's informed consent. The clinical subjects were divided into three groups. The first group was used for immunohistochemistry; the second group was used to detect periapical periodontitis-associated gene expression using real-time qPCR; and the samples from the third group were used to detect periapical periodontitis-associated protein expression using western blotting.
The clinical cases were all diagnosed as asymptomatic apical periodontitis caused by caries-derived infection. The teeth didn't have spontaneous pain and the percussion was negative. The dental x-rays showed a periapical index (PAI) score≥3[31-33]. The CAP patients were in good health with no systemic or immune system diseases. Exclusion criteria were, as follows: the tooth was affected by periodontal disease or combined periodontal and pulpal disease; antibiotics or non-steroidal anti-inflammatory drugs had been taken in the 3 months before tooth extraction; allergies; refusal to participate in this study.
Establishment of an animal apical periodontitis model
The animal apical periodontitis model was constructed following our previous protocol[34]. A total of 20 wild-type C57BL/6J mice were supplied by Dalian Medical University and were housed in an animal control facility in a 12-h light/dark cycle with a mean illumination of 80 lx. The animals were maintained at 22±2 °C. Tap water and food pellets were available ad libitum. The animal experiments were approved by the Ethics Committee of Dalian Medical University (approval number: AEE23006). The mice were anesthetized with pentobarbital sodium (30 mg/kg), a 1/4 round bur (Wave Dental, Hong Kong, China) was used to open the pulp cavity of the bilateral mandibular first molars, and mice without pulp exposure were used as the control group. The mice were randomly divided into 5 groups with 4 mice in each group. At each time point (0, 1, 2, 3 and 4 weeks), the mandibular bones of 4 mice were stained by immunohistochemistry and hematoxylin and eosin (HE) to evaluate the morphological changes caused by the development of periapical lesions in the model.
Immunohistochemistry (IHC)
The protein expression levels in tissue were represented by integrated optical densities (IOD). Immunohistochemistry was carried out according to the instructions of a rabbit streptavidin-biotin detection system kit (zsbio, Beijing, China). In short, the frozen tissue slides were dried at 37 °C for 30 minutes, endogenous peroxidase blocker was added, and normal goat serum working solution was used for sealing. According to the size of the tissue, a proper amount of primary Nrf2 polyclonal antibody (1:400 dilution, ABclonal, Wuhan, China) was added and incubated at 4 °C overnight. The tissue slides were then incubated with biotin-labeled goat anti-rabbit IgG polymer followed by horseradish enzyme-labeled streptavidin working solution and then DAB chromogenic solution and hematoxylin staining solution.
Real-time qPCR
Tissue RNA was extracted according to the instructions of the column Total RNA extraction Kit (Sangon Biotech, Shanghai, China). Genomic DNA was removed from 1000 ng of total RNA by an Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate Biology, Hunan, China), reverse transcription was performed to construct cDNA, and SYBR® Green I chimeric fluorescence was used for qPCR. The primers are listed in Table 1 and Table 2. The relative expression levels of the target genes were calculated by the 2﹣△△Ct method.
Table 1. List of human related gene primers used in this study for real-time PCR.
Gene
|
Forward (5’-3’)
|
Reverse (5’-3’)
|
GAPDH
|
GCACCGTCAAGGCTGAGAAC
|
TGGTGAAGACGCCAGTGGA
|
Nrf2
|
TTCCTCTGCTGCCATTAGTCAGTC
|
GCTCTTCCATTTCCGAGTCACTG
|
TRAP
|
CCTACCCACTGCCTGGTCAA
|
ACGTAGCCCACGCCATTCTC
|
Table 2. List of mouse related gene primers used in this study for real-time PCR.
Gene
|
Forward (5’-3’)
|
Reverse (5’-3’)
|
GAPDH
|
AAATGGTGAAGGTCGGTGTG
|
TGAAGGGGTCGTTGATGG
|
Nrf2
|
TTCCTCTGCTGCCATTAGTCAGTC
|
GCTCTTCCATTTCCGAGTCACTG
|
TRAP
|
GGGTCACTGCCTACCTGTGT
|
TCATTTCTTTGGGGCTTATCTC
|
CTSK
|
CACCCAGTGGGAGCTATGGAA
|
GCCTCCAGGTTATGGGCAGA
|
ALP
|
TGAATCGGAACAACCTGACTGA
|
GAGCCTGCTTGGCCTTACC
|
Runx2
|
CCTCTGGCCTTCCTCTCTCA
|
TAGGTAAAGGTGGCTGGGTAGTG
|
Western blot
Total protein was extracted with protease inhibitor (Solarbio, Beijing, China) containing cleavage buffer. Protein concentration was determined using a BCA Protein Assay Kit (Beyotime Biotechnology, Shanghai, China). The protein (20 μg) was separated by 10% sodium dodecyl sulfate and sodium salt-polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to a nitrocellulose membrane.
The membrane was sealed with 5% skimmed milk at room temperature for 2.5 hours and then diluted with specific anti-Nrf2 antibody (1:800 dilution; ABclonal, Wuhan, China), TRAP (1:1500 dilution; ABclonal, Wuhan, China), CTSK (1:1000 dilution; ABclonal, Wuhan, China), ALP (1:1000 dilution; Abcam, Cambridge, UK), Runx2 (1:500 dilution; Abcam, Cambridge, UK), and GAPDH (1:5000 dilution; ABclonal, Wuhan, China). The membrane was washed three times with buffered saline and Tween 20 for 10 minutes each time, and the anti-rabbit immunoglobulin G antibody coupled with horseradish peroxidase was incubated for 2 hours. Protein bands were visualized using a gel imaging system (Bio–Rad, Hercules, CA). Image Lab (Bio–Rad) was used to analyze and output the collected images.
Cell culture
RAW264.7 (Procell Life Science & Technology Co., Ltd, CL-0190, Wuhan, China) and MC3T3-E1 (Sunncell Biotech, SNL-021, Wuhan, China) cells were cultured in high-sugar DMEM/α-MEM supplemented with 10% fetal bovine serum and antibiotics (1% penicillin/streptomycin) in a cell incubator at 37 °C with 5% carbon dioxide. When the fusion rate of adherent cells was more than 80%, the cells were passaged and were then digested with 0.25% trypsin (HyClone, Logan, Utah, USA). Third- or fourth-generation cells were used for in vitro experiments.
Cell induction and identification
RAW264.7 cells were induced with 0.05 μg/mL RANKL (Abcam, Cambridge, UK) induction solution for 5 days, and a tartrate-resistant acid phosphatase (TRAP) staining kit was used to test osteoclasts. Seven days later, MC3T3-E1 cells were induced with osteoblast induction solution (2 mmol/L Dex, 10 mmol/L β-sodium glycerophosphate, 2 mmol/L VC). Alkaline phosphatase (ALP) activity was detected using an alkaline phosphatase staining kit (Sigma–Aldrich, St. Louis, MO, USA). After 21 days of induction, the formation of calcified nodules in osteoblasts was observed by alizarin red (Sigma–Aldrich, St Louis, MO, USA) staining.
Cell transfection
RAW264.7 and MC3T3-E1 cells were treated with LPS and seeded in 6-well plates. For knockout experiments, siRNA targeting the Nrf2 gene (Nrf2-siRNA; 100 pmol/well) and negative control siRNA were purchased from GenePharma (Suzhou, China). Cells were transfected with Nrf2-siRNA using Xfect RNA transfection reagent (TaKaRa, Kyoto, Japan) when the cells were 70%-80% confluent. The transfection efficiency was determined by real-time PCR and Western blot.
Cell Counting Kit-8 (CCK-8)
RAW264.7 cells and MC3T3-E1 cells were seeded in 96-well plates at 100 μL per well (n = 503 cells) and cultured for 24 hours before 10 μL of CCK-8 solution was added to each well. The plates were then incubated for 1 hour, after which the absorbance (OD) at 450 nm was measured.
Statistical analysis
All the above data were analyzed as the mean ± standard deviation (SD). Differences between groups were calculated by one-way analysis of variance (ANOVA). Statistical analysis was conducted using SPSS 17.0 software. The differences were significant when P values < 0.05.