Biosafety statement and ethics statements
All experiments related to FMDV were carried out at a biosafety laboratory-3 level (BSL-3) at the Lanzhou Veterinary Research Institute (LVRI), Chinese Academy of Agricultural Sciences (CAAS), accredited by the China National Accreditation Service for Conformity Assessment (CNAS) and approved by the Ministry of Agriculture and Rural Affairs. In the laboratory, to reduce any potential risk, the protocols were strictly followed, and all activities were monitored by professional staff at LVRI and randomly inspected by local and central governmental authorities without advance notice.
Cells, viruses, and proteins
BHK-21 cells were cultured in medium supplemented with 10% foetal bovine serum (FBS) at 37°C in a 5% CO2 incubator. A virus stock derived from the FMDV isolate O/Mya98/BY/2010 by three passages in BHK-21 cells, which maintained the consensus sequences at the capsid protein region, was used to perform virus neutralization assays and guinea pig challenge experiments. The purified FMDV-VP1 protein was prepared in our laboratory.
Plasmid construction
We postulated that a neutralizing epitope of FMDV can be displayed on the surface of FNPs by rational design of chimeric proteins. To test this hypothesis, we constructed three chimeric protein structural models (Fig. 1A): plasmid pET28a-1, containing the coding sequence of ferritin (Helicobacter pylori J99, GenBank accession code: NP_223316) designated Hpf; plasmid pET28a-2, the coding sequence of the neutralizing epitope peptide GGSSLPNVRGDLQVLAQKAARPGGS, inserted at the loop between Hpf helices αA and αB (the construct is designated Hpf-T34E); plasmid pET28a-3, the coding sequence of the neutralizing epitope peptide SLPNVRGDLQVLAQKAARPGGS, inserted at the N-terminus of Hpf (designated Hpf-NE); and plasmid pET28a-4, the coding sequence of the neutralizing epitope peptide inserted both at the loop between helices αA and αB and the N-terminus of Hpf (designated Hpf-E2). All recombinant plasmids were sent to a company (BGI, Beijing, China) for synthesis and proofreading. The predicted position and presentation of neutralizing epitopes on the surface of FNPs were obtained by using the I-TASSER suite 5.2 (https://zhanggroup.org/I-TASSER/)[45] (Fig. 1b and c).
Expression and purification of recombinant proteins
The recombinant expression plasmids were transformed into E. coli BL21 (DE3) cells, and expression was induced by 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at 16°C for 12 h. The cells were harvested by centrifugation at 4200 rpm for 10 min and lysed on ice by an ultrasonic crushing apparatus. The precipitate and supernatant were collected by centrifugation at 18000 rpm for 1 h. Then, the expression of recombinant proteins of Hpf, Hpf-NE, Hpf-T34E and Hpf-E2 was analysed by sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE).
The recombinant proteins of Hpf, Hpf-NE and Hpf-T34E were purified by size exclusion chromatography (SEC) (GE, USA) after heat precipitation for 30 min at 65°C. The purified protein was analysed by SDS–PAGE and Western blotting.
Transmission electron microscopy
The purified FNPs were diluted in TM buffer (50 mM Tris HCl, pH 7.4, and 10 mM MgCl2). For visualization, the FNPs were absorbed on carbon-coated grids, followed by negative staining with 2% aqueous uranyl acetate. The particles were observed at 80 kV under a Hitachi microscope (HT7700, Japan).
Dynamic light scattering (DLS) analysis of FNPs
Dynamic light scattering experiments were performed on a Malvern Zetasizer Nano ZEN3700 in disposable polystyrene micro-cuvettes (VWRs) using 10 mL of freshly prepared sample solution (0.5 mg/mL, pH = 7.4). After equilibration to 25°C, three measurements were performed with the instrument optimizing the number of runs for each measurement. The refractive index (RI) of the dispersant (preset: water) was set to 1.330, and the viscosity (cP) was set to 0.8882. The RI of the particle was set to 1.45. The absorption of the protein was set to 0.001, and both the attenuator and measurement position were controlled by the instrument.
Western blotting
The purified Hpf, Hpf-NE and Hpf-T34E proteins were separated by 12% SDS‒PAGE and then transferred to a nitrocellulose membrane (ISEQ00010, Merck Millipore), which was blocked in 5% skim milk at room temperature for 1 h. After the membrane was washed with PBST three times, it was incubated with mouse anti-FMDV VP1 antibodies at 4°C overnight on a shaker. After washing, the membrane was incubated with an HRP-conjugated goat anti-mouse IgG antibody for 1 h at room temperature. Finally, after three more washes, the membranes were treated with a chemiluminescence (ECL) reagent solution kit (Thermo Scientific, USA), and the antibody-antigen complexes were exposed and detected with an imaging system (GelDocXR, Bio-Rad, USA).
Mouse immunization and sample collection
Twenty-four mice (BALB/c, six weeks old, female) were divided into 4 groups with six mice in each group: the Hpf, Hpf-T34E, Hpf-NE and PBS groups. The mice were subcutaneously immunized on the back with 50 µg of antigen emulsified in ISA 206 adjuvant (Seppic, Paris, France) on day 0, and the immunization was boosted on day 14. In the control group, the mice were immunized with an equal volume of sterilized phosphate buffered saline (PBS) solution and adjuvant after emulsification. Blood samples were collected through the tail vein at 0, 7, 14, 21, 28, 35 and 42 days post vaccination (dpv). The mice were sacrificed on day 42 to isolate splenocytes (Fig. 3a).
Immunization, challenge and sample collection in guinea pigs
The immune response and protection conferred by the Hpf-T34E protein were assessed in guinea pigs weighing 200–250 g. Fifteen guinea pigs were randomly divided into three groups with five guinea pigs in each group: the Hpf-T34E, IV and PBS groups. The Hpf-T34E group was immunized with 100 µg of Hpf-T34E protein emulsified in ISA 206 adjuvant (Seppic, Paris, France). The IV group was immunized with a commercial inactivated FMD vaccine (IV) (China Agricultural Vet. Bio. Science and Technology Co., Ltd, China) as a positive control group. The PBS group was immunized with PBS mixed with ISA 206 adjuvant as a negative control group. The guinea pigs were immunized intramuscularly in the leg on day 0, and the immunization was boosted on day 21. Blood samples were collected at 0, 21, 35 and 42 days post vaccination (dpv).
Guinea pigs were housed in separate units of the high-containment facility, and were subcutaneously and intradermally challenged with 0.2 ml 100 ID50 of FMDV serotype O virus on the left sole of the back at the third week after boost vaccination. All the guinea pigs were kept in isolated hutches and examined for 7 days. The guinea pigs were sacrificed at 49 dpv to isolate the heart and spleen. Lesions on the left back soles were considered indicators of partial infection, and those on both back soles were considered indicators of whole-body infection.
Detection of specific antibodies by ELISA
The detection of serum antibodies against FMDV was performed by enzyme-linked immunosorbent assay (ELISA). The inactivated FMDV was coated with coating buffer (Solarbio Life Science, Beijing, China) and incubated overnight at 4°C. After being blocked with 5% skim milk for 1 h at 37°C, the plate was washed three times with PBS–0.1% Tween 20 (PBST) and incubated with serial twofold dilutions of each serum sample prepared in PBS, for 1 h at 37°C. After six washes with PBST, the plates were incubated at 37°C for 45 min with HRP-conjugated goat anti-mouse IgG (ImmunoWay, USA) for mouse sera, and HRP-conjugated rabbit anti-guinea pig IgG (ImmunoWay, USA) for guinea pig sera, both at a 1:5000 dilution in PBST. After another wash, 100 µL of 3, 39, 5, 59-tetramethylbenzidine was added to each well as a chromogenic substrate solution. The reaction was stopped with 50 µL of 0.5 M H2SO4 after incubation at room temperature for 30 min. The optical density at 450 nm (OD value) of each well was measured using an ELISA reader.
Virus neutralization test (VNT)
Briefly, each serum sample was used in a monolayer of BHK-21 cells to perform the neutralization test. One hundred microlitres of the serum treated at 56°C for 30 min was serially diluted twofold from 1:4 − 1:1024. Then, the diluted serum was mixed with an equal volume of 100 TCID50 of FMDV and incubated for 1 h at 37°C. Subsequently, 100 µL of the mixture was transferred to BHK-21 cells in a 96-well plate and incubated for 1 h at 37°C. The cell supernatant was discarded, and after three washes, DMEM containing 2% FBS was added. Each serum sample was analysed in triplicate. After incubation for 48–72 h, the endpoint titres were calculated as the reciprocal of the last serum dilution to neutralize 100 TCID50 of homologous FMDV in 50% of the wells.
T-Lymphocyte proliferation assay
A T-lymphocyte proliferation assay was performed with a CCK-8 (Cell Counting Kit-8) assay. The spleens were removed in a sterile manner and ground through a sterile cuprous 200-mesh. The mixture of splenocytes was immersed in RPMI 1640 medium supplemented with 10% FBS, homogenized and centrifuged at 400 × g for 10 min. The pellets were discarded, and the buoyant cells were washed three times in RPMI 1640 medium supplemented with 10% FBS. After red blood cell lysis, 3 × 105 splenocytes were distributed in triplicate wells of 96-well flat-bottomed plates. Cells were stimulated with either purified FMDV-VP1 protein (10 µg/well) or purified Hpf (10 µg/well). Triplicate wells with 3 × 105 cells without protein were used to estimate nonspecific activation. As a positive control, triplicate wells with 3 × 105 cells were stimulated with 50 µL of ConA (2.5 µg/well). The plate was incubated at 37°C, and 5% CO2 for 72 h, followed by incubation with CCK-8 for 4 h, and the absorbance was determined at 450 nm. The stimulation indices (SIs) were calculated using the following formula: SI = (OD sample well – OD blank well) / (OD negative well – OD blank well) at OD450 nm with three technical repeats.
In vitro cytokine release assay
The lymphocytes prepared in the previous step were seeded into 24-well plates at 1 × 106 cells/well. Cytokine secretion was stimulated with 10 µg/mL purified FMDV VP1 protein. After the plate was incubated at 37°C and 5% CO2 for 72 h, the concentrations of IFN-γ, IL-2, IL-4 and TNF-α in the supernatants were determined using a commercial ELISA kit (DAKEWE, China). The data calculations were performed according to the manufacturers’ instructions.
Quantitative real-time PCR (qPCR)
RNA was extracted from the samples using TRIzol reagent (Invitrogen, USA). Quantitative real-time PCR was performed using a One Step PrimeScript RT‒PCR kit (Takara, China), according to the manufacturer’s protocol. qPCR amplification was were performed using a CFX96 Touch RT‒PCR Detection System (Bio-Rad, USA). The reaction mixtures contained RNA (10–100 ng), a TaqMan probe (FAM-TCCTTTGCACGCCGTGGGAC-TAMRA) (Sangon Biotech, China), sense primers (ACTGGGTTTTACAAACCTGTGA) and reverse primers (GCGAGTCCTGCCACGGA) (20 µmol/L) (Sangon Biotech), and RNase-free water to a total volume of 20 µl. The PCR cycling conditions were as follows: 42°C for 5 min; 95°C for 10 s; and 40 cycles of 5 s at 95°C, 20 s at 60°C and 30 s at 72°C. The data represent the results from one representative triplicate experiment.
Statistical analysis
The statistical analysis was performed using column analysis t tests and two-way analysis in GraphPad Prism 8.0 (GraphPad Software, Inc., USA). All the data are presented as the means ± standard deviations (SDs). Various degrees of significance were designated as follows: * p < 0.05, ** p < 0.01, *** p < 0.001 and ns indicates no significant difference.