Cell lines
HeLa (human cervical cancer cell line), HEK293T cell (human embryonic kidney T 293), Skov3 (human ovarian cancer cell line), Ovcar3 (human ovarian cancer cell line) and NALM-6 (pre-B cell leukemia cell line) cells were purchased from the Iranian Biological Resource Center (IBRC), Iran., Skov3, Ovcar3 cell lines were used as mesothelin-expressing cell lines and NALM-6 was used as a mesothelin negative control. Before the experiments, expression of mesothelin in these cells was analyzed by flow cytometry using PE-conjugated anti-human mesothelin antibody (R&D Systems, Minneapolis, MN, USA). HEK293T cells were used as the packaging cell line for the production of lentiviral particles. Mycoplasma contamination of all cell lines was routinely examined by polymerase chain reaction (PCR). KEK293T, and Skov3 cells were cultured in DMEM (Gibco Laboratories, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS) (Sigma Chemical Co., St. Louis, MO, USA) and 100 µg/ml penicillin-streptomycin (PAN Biotech, Aidenbach, Germany), and incubated at 37 °C in 5% CO2, 95% humidity atmosphere. Ovcar3 was cultured in RPMI-1640 (Gibco Laboratories, Grand Island, NY, USA) supplemented with 10% FBS and 100 µg/ml penicillin-streptomycin, and 2 Mm L-glutamine (Gibco Laboratories, Grand Island, NY, USA) incubated at 37 °C in 5% CO2, 95% humidity atmosphere.
Genetic Modification Of T Cells
To generate a fully human anti-MSLN CAR construct, a Kozak consensus ribosome-binding sequence, a human CD8a signal peptide (SP) and a fully human anti-MSLN scFv were linked to the CD8a hinge, 4-1BB transmembrane region (TM) and intracellular domains containing the 4-1BB and CD3ζ domains. Mesothelin-specific scFv fragment originated from P4-scFv (18). Other fragments of CAR construct have been described previously(3). The CAR expression cassette was under the control of CMV promoter. To knockdown Tim3 expression, three shRNA-encoding sequences against three different regions of Tim3 gene were designed and inserted after the CD3ξ domain sequence in MSLN-CAR constructs (hereafter referred to Tim3.sh1.MSLN-CAR, Tim3.sh2.MSLN-CAR and Tim3.sh3.MSLN-CAR). The expression of shRNA-encoding sequences was under the control of a CMV promoter. ShRNA sequences are shown in Table 1. MSLN-CAR gene cassettes and different shRNA-coding sequences containing 5′-Flank-Sense-Loop-Antisense-3′Flank segments were cloned into a pCDH-CMV-MCS-EF1α-cGFP-2A-Puro lentivector backbone for production of third-generation lentiviral particles.
Table 1
shRNA sequences against different regions of Tim3 transcript.
Name | Sense sequence | Anti-sense sequence | Target gene |
shRNA1 (sh1) | CCATAGAGAATGTGACTCTAGC | GCTAGAGTCACATTCTCTATGG | Tim3 (HAVCR2), NM_032782.5 |
shRNA2 (sh2) | TCGCTCAGAAGAAAACATCTAT | ATAGATGTTTTCTTCTGAGCGA |
shRNA3 (sh3) | GCACTGAACTTAAACAGGCAT | CATGCCTGTTTAAGTTCAGTGC |
Production Of Third-generation Lentiviral Particles
To generate three different Tim3-targeted MSLN-CAR T cells, HEK293T cells were transfected with plasmids encoding three different shRNAs against Tim3 (Tim3.sh1, sh2 and sh3.MSLN-CAR). Two other plasmids, including MSLN-CAR and empty vector (CAR null) were also used for production of MSLN-CAR T cells and Mock-T cells. Different MSLN-CAR plasmids and packaging plasmids (pMDLg/pRRE, pMD.G and pRSV-Rev) were co-transfected into HEK293T cells using a standard calcium phosphate precipitation method. Virus-containing media (VCM) was then harvested 24, 36 and 48 hours post-transfection and pooled. To discard cell debris, VCM was filtered through 0.45 µm pore size membrane filters and concentrated by ultracentrifugation at 26,000 rpm for 2 h at 4 °C (Optima LE-80 K Ultracentrifuge, Beckman Coulter, Indianapolis, IN). The viral particles were resuspended in complete DMEM media and stored at -80 °C in single‐use aliquots. Titers of concentrated VCMs were determined by a limiting dilution method using flow cytometry on primary human T cells activated with anti-CD3 and anti-CD28 antibodies.
Primary human T cell purification, activation and lentiviral gene transduction
Buffy coat from healthy donors was provided by the Iranian Blood Transfusion Organization (IBTO) (consented under Institutional Review Board approved research protocols at the Tehran University of Medical Sciences). Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Paque gradient centrifugation. T lymphocytes were then enriched and activated in vitro by culturing PBMCs at 1 × 106 cells/well in 6-well cell culture plates (Costar, Cambridge, MA, USA) coated with 1 µg/ml anti-CD3 mAb (Miltenyi Biotec, Bergisch Gladbach, Germany), 3 µg/ml anti-CD28 soluble mAb (Miltenyi Biotec, Bergisch Gladbach, Germany), and 100 IU/ml human recombinant IL-2 (Miltenyi Biotec, Bergisch Gladbach, Germany). After three days, more than 95% of the cells in the culture were CD3+ T lymphocytes, as confirmed by flow cytometry. Activated T cells were then transduced by concentrated lentiviral supernatants at multiplicity of infection (MOI) of 7 in the presence of polybrene (8 µg/ml, Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a 12-well cell culture plate. The plate was then spinoculated at 2100 rpm at 32 °C for 60 min, followed by incubation at 37 °C. Next 6–7 hours, 2 ml of fresh complete RPMI-1640 media supplemented with IL-2 (100 IU/ml) (Miltenyi Biotec, Bergisch Gladbach, Germany) was added to each well. After 4 days, cell surface expression of anti-MSLN CAR was measured by flow cytometry using biotinylated goat anti-human IgG F(ab’)2 (BioRad, Hercules, CA, USA) and APC-conjugated Streptavidin (BioRad, Hercules, CA, USA).
Tim-3 Knockdown Experiments
Percentage of Tim3 positive cells and mean fluorescence intensity (MFI) of Tim3 were evaluated by flow cytometry using human Tim3 (CD366) APC-conjugated antibody (BioLegend, San Diego, CA, USA) in T cells before activation, activated/un-transduced T cells (Un-T), and activated/transduced T cells (i.e. Mock-transduced and CAR T cells). Percentage of Tim3 positive Mock T cells (transduced with empty vector) and CAR T cells (with and without shRNA) was also determined following co-incubation with MSLN-positive target cells. To analyze efficacy of Tim3-knockdown, the MFI/percentage of Tim3 positive cells in MSLN-CAR T cells, Tim3.sh1, sh2, and sh3.MSLN-CAR T cells as well as Tim3.sh3.sh2.MSLNCAR T cells (i.e. T cells that co-transduced with two viruses carrying Tim3.sh2.MSLN.CAR and Tim3.sh3.MSLN.CAR) was assessed by flow cytometry. In addition, MFI/percentage of Tim-3 positive cells in Tim3.sh1.sh2.MSLNCAR T cells, Tim3.sh1.sh3.MSLNCAR T cells and Tim3.sh1.sh2.sh3.MSLN CAR T cells (i.e. T cells that co-transduced with three viruses carrying Tim3.sh1.MSLN.CAR, Tim3.sh2.MSLN.CAR and Tim3.sh3.MSLN.CAR) was also determined by flow cytometry.
In vitro Cytotoxicity assay
At first, target cells (Hela cell line) were labeled with lipophilic dye PKH-26 (Sigma Chemical Co., St. Louis, MO, USA) according to manufacturer’s instructions. 3 × 104 labeled-target cells were then co-cultured at 1:1, 1:5, 1:10, and 1:20 ratios with effector cells (CAR T, Un-T, and Mock T cells) in a 48-well culture plate, maintained for 18 hr at 37◦C in 5% CO2. Next, PKH-26-labeled target cells were stained with 7-AAD (Miltenyi Biotec, Bergisch Gladbach, Germany) as a viability dye. Flow cytometry analysis was done with the use of forward and side scatter gating to select viable cells, whereas PKH-26 and 7-AAD labeling was used to distinguish effector cells from dead target cells. Double positive (PKH26+ /7AAD+) target cells were considered as dead cells. To calculate the percentage of double-positive dead target cells, the percentage of target cells autolysis was subtracted from the percentage of target cells co-cultured with effector cells. FlowJo (v7.6.1) software was used to analyze the cytometric data.
Measurement of MSLN-dependent CAR T cell proliferation and cytokine production
Target cells were treated with 25 µg/ml of mitomycin C (Sigma Chemical Co., St. Louis, MO, USA) for 30 min at 37 °C followed by extensive washing with PBS. To track cell proliferation, CAR T, Un-T, and Mock T cells were labeled with lipophilic dye PKH26 (Sigma Chemical Co., St. Louis, MO, USA). The PHK26-labeled cells (2 × 105/well) were co-incubated at a 1:1 ratio with mitomycin C-treated cells or cultured without target cells as a control for spontaneous proliferation (in the absence of exogenous IL-2) in 48-well plates in a final volume of 800 µl/well for 72 hr. For cytokine (IFN-γ, TNF-α and IL-2) quantification, supernatant was harvested 24 hr. after plating and kept at -80 °C until subsequent measurement by the enzyme-linked immunosorbent assay (ELISA). After 72 hr., labeled cells were stained with anti-CD3-APC (BioLegend, San Diego, CA, USA) to differentiate T cells from target cells. PKH-26 dilution of CD3-gated lymphocytes was used as a measure of proliferation.
Flow Cytometric Analyses
Data acquisition was performed on a flow cytometer (BD FACSCalibur, BD Biosciences, San Jose, California). Analysis of all samples was done using FlowJo software (v7.6.1). All experiments were done in triplicate and repeated at least three times.
Statistical analysis
Analysis of variance (ANOVA) followed by Tukey’s post-hoc was used to reveal any significant differences among treatment groups. P values below 0.05 were considered significant. Statistical analyses were performed with Prism 8 software (GraphPad Software, Inc., San Diego, USA).