Animals
Two hundred Sprague-Dawley (SD) rats (3 days old) were obtained from the Laboratory Animal Center of Hebei Medical University (Shijiazhuang, Hebei, China). The animal study was approved by the Ethics Committee of Hebei Medical University and conducted in accordance with an institutional policy of Hebei Medical University.
Cardiac fibroblast culture
CFs were isolated from 3-day-old SD rats. First, the tissue at the cardiac apex of the SD rat was isolated and infused in 10 ml of phosphate-buffered saline (PBS) (Sigma Aldrich, St. Louis, MO) containing 0.05% trypsin (Sigma Aldrich, St. Louis, MO) and collagenase II (BioFroxx,CN) mixture for 5 minutes in the incubator at 37°C. The process was repeated 6–8 times to obtain single cells. Isolated cells were pooled, the cells were then resuspended and filtered through a 75 µm cell strainer and then centrifuged at 1000 rpm for 5 minutes. The cell pellet was resuspended in growth medium containing Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, CN), 10% fetal bovine serum (CN), and 1% biantibody and incubated in a humidified atmosphere with 5% CO2 at 37°C for 2 h. This allowed the CFs to bind preferentially to the dish, the non-adherent cells were discarded, the medium was changed and placed in the incubator until they were completely confluent. Cells were passaged with 0.05% trypsin-EDTA (Sigma Aldrich, St. Louis, MO). Second or third passage cardiac fibroblasts were used for experiments.
Immunofluorescence staining
Immunofluorescence staining was used to identify fibroblasts. After digestion, CFs were added to DMEM medium and resuspended, and the density was adjusted to 5 × 105 cells/mL. CFs were then seeded in 6-well plates at 37°C in the incubator. When the cells were about 80% confluent. The bottom of the plate was washed three times with PBS for one minute and then fixed first with 4% paraformaldehyde at room temperature for 20 minutes and then with 0.1% Triton X-100 in PBS at room temperature for 15 minutes. CFs were finally blocked with 5% bovine serum albumin (BSA) solution and incubated with anti-vimentin antibody (1:200, TA600392, ORIGEE, US) at 4℃overnight in the dark. Subsequently, CFs were stained with 4`,6-diamidino- 2-phenylindole (DAPI) for 10 min and washed three times with PBS, and immunofluorescence analysis was performed using a confocal microscope (Zeiss, White Plains, NY, USA) under 400℃ performed × magnification.
EdU Staining
A EdU Cell Proliferation Kit with Alexa Fluro 488 was used for the cell proliferation assay. CFs are seeded in 6-well plates (5×10 4 cells/well) to evenly distribute the cell monolayer with 3 replicates per group of samples.Place in the cell culture incubator and incubate adherent for 24 h, then aspirate the old medium and add the working solution.After 24 hours of dosing treatment, 10 µM EdU is added to each well and incubated for 2 hours, followed by fixation and washing.The nuclei were stained with Hoechst33342 for 10 min.Finally, the field of view was randomly obtained under an inverted fluorescence microscope, and the positive rate of EdU staining was calculated.
Real-time quantitative PCR (RT-qPCR)
Total mRNA from treated CFs was extracted using the TransZol Up Plus RNA Kit (TransGen, CN). Reverse transcription was performed using Hiscript III RT SuperMix for qPCR (+ gDNA Wiper). Of the obtained cDNA, 20 ng was provided for RT-PCR using ChamQ Universal SYBR qPCR Master Mix according to the manufacturer's instructions (Vazyme). The relative mRNA levels of chemerin, CMKLR1, and PCNA were estimated and normalized with actin mRNA levels. The sequences of the PCR primers were as follows in Table 1. The reaction parameters were as follows: 95℃ for 30 seconds, followed by 40 cycles of 95℃ for 10 seconds, then 60℃ for 10 seconds. Relative expression levels were calculated using the 2-ΔΔCT method.
Table 1
Gene
|
Forward primer (5’-3’)
|
Reverse primer (5’-3’)
|
chemerin
|
CGGTGTGGACAGTGCTGATGAC
|
TCCGCTTCCTCCCATTTGGTTTG
|
CMKLR1
|
GCACCAGCCACGGGAAGATAAC
|
GATCAGGAAGCCACAGAGGAAGC
|
PCNA
|
CGGCGTGAACCTACAGAGCATG
|
GCAGCGGTATGTGTCGAAGCC
|
Western blot
CFs proteins were extracted using the Nuclear Protein and Cell Cytoplasmic Protein Extraction Kit (No. P0027) and the protein concentration was determined. First, the SDS-PAGE gel was prepared, then the protein sample was carefully added to the gel wells for electrophoresis and then onto the membrane transfer membrane. Membranes were incubated overnight in primary antibody and washed three times in 0.1% Tween-20. TBS and then incubated in secondary antibody (1:1000) for one hour at room temperature, followed by five washes. The immunoreactive proteins were detected using an enhanced chemiluminescence system. The antibodies are listed in Table 2.
Table 2
Antibodies for Western blot
|
Dilution
|
Product code
|
Brand
|
anti-Akt antibody
|
1: 1000
|
4685
|
Cst
|
Anti-phospho-Akt antibody
|
1: 1000
|
4060
|
Cst
|
anti-PI3k antibody
|
1: 1000
|
4257
|
Cst
|
Anti-phospho-PI3k antibody
|
1: 1000
|
130868
|
Absin
|
anti-NF-κB antibody
|
1: 1000
|
8242
|
Cst
|
Anti-phospho-NF-κB antibody
|
1: 1000
|
3033
|
Cst
|
anti-PCNA antibody
|
1: 1000
|
AF0239
|
Affinity
|
anti-Actin antibody
|
1: 10000
|
AB0035
|
Abways
|
Statistics
The SPSS 27.0 version for Windows was used for the statistical analyses. Data were displayed as mean ± standard error of the mean (SEM). Statistical analyzes were carried out using the Student t test. p < 0.05 was considered significant.