Animal model selection
C57BL/6mice(purchased from Chongqing Tengxin Experimental Animal
Sales Co., Ltd., address: 11-2, Building B, Baike Building, No. 160 Luzhou
Road, Jiulongpo District,Chongqing,website: www.cqtx123.com.cn)were selected
as our animal model.
Preparation of the experimental animal diet
The AIN93G standard diet (catalogue No: LAD 3001G) and a high-
cholesterol diet (catalogue No: TP06105) were manufactured by Trophic Animal Feed High-Tech Co., Ltd., China (address: Hainan Chengnan Development
Zone, Jiangsu Province National High-tech Development Zone,website: www.
trophic.cn).The high-cholesterol diet was prepared by adding 1.25% cholesterol and 0.5% sodium cholate to AIN-93G according to the manufacturer.
Bacterial culture
The standard HP strain NCTC11637 (a gift from the Third Military
Medical University)was removed from the -80 degree freezer (Southwest
Medical University Central Laboratory) and resuspended in liquid medium. The liquid medium containing the hp strain was placed in a carbon dioxide incubator (5% O2, 10% CO2, 85% air) (Manufacturer: Shenzhen Hongwumei
Diagnostic Technology Co., Ltd., model: HM-310, website: www.hongmed-infagen.com). An N2 incubator was used for recovery and growth of the bacteria.
After 2 days, a small amount of the bacterial suspension was placed in a
rapid urease reagent to identify the cultured bacteria as HP (fast red colour
development in the presence of urease), and then it was subcultured. After 2
passages, the identified HP bacteria were added to BHI containing 10% FBS
for culture.The solution was adjusted to an OD= 0.1 in liquid using a
visible spectrophotometer (manufacturer: Shanghai Aucy Scientific Instrument Co., Ltd., device number: 7221772003, website: www.aucybest.cn) and shaken for 20 hours in a carbon dioxide incubator.
Preparation of the VD3 stock solution:
A total of 2.4 mg of vitamin D3 (manufacturer: Macklin, item No.: C804669, website: www.macklin.cn) was added to 4 mL of olive oil (manufacturer:
Macklin, item No: 0815210, website: www.macklin.cn) to obtain a 600 µg/mL vitamin D3 stock solution. The solution was diluted to a concentration of 2.4 µg/ml (250:1) in olive oil.
Animal experiment
Animal studies were approved by the Animal Ethics Committee of the
Southwest Medical University (20181212-1), and animal experiments were conducted in accordance with the guidelines of Southwest Medical University. Taking into
account the welfare factors of all animals, we provide a comfortable, clean and quiet
animal living environment, namely the Experimental Animal Center of Southwest Medical University. The animal center maintains a room temperature of 21±2.0°C and a humidity of 50±5%. In order to avoid animal stimulation, the environment is
kept quiet and there is a fixed opening time tomorrow. In order to keep the environment clean, the animal center has a special cleaning staff. The feed used is provided by the professional feed processing company Nantong Trophy Animal Feed Production Co., Ltd. The quality of the feedis guaranteed to not only meet our experimental requirements, but also providesufficient energy for the experimental animals to reduce the occurrence of experiental animal diseases. Rate, animal drinking water is sterilized distilled water, and the experimenter regularly changes water and feed to the animal center every day to ensure adequate and healthy feed and drinking water. In addition,
every day, the experimenter also needs to regularly observe the living state of the animal at the animal center, mainly to monitor the health status of the experimental
animals by observing whether the mice are dead, the activity of the mice, the eating state, and whether there is a fight between the animals.
Establishment of the high-fat diet and hp infection models
C57BL/6 mice were housed in individual cages in the Southwestern Medical
University Animal Housing Facility under a controlled 12:12 hour light:dark
cycle. The room temperature was maintained at 21 ± 2.0 °C with 50 ± 5%
humidity. The mice were fed a purified AIN-93G diet with free access to the
diet and water. After one week of adaptation, the mice were randomly divided into four groups. Group A (blank control group) was given the purified AIN-93G diet at a dose of 6 g per mouse and intragastrically administered saline at
a dose of 5 ml/kg. Group B (HP-infected group) was given the purified
standard diet and intragastrically treated with a HP bacterial solution (OD=1) at a dose of 5 ml/kg. The mice were fasted for 12 hours before each gavage
treatment. Each mouse was given 2.6 mg of metronidazole (manufacturer:
Hunan Hansen Pharmaceutical Co., Ltd., website: www.hansenzy.com), 5 mg of amoxicillin (manufacturer: North China Pharmaceutical Co., Ltd., website: www
.ncpc.com.cn) and 1.2 mg of Lizhu Dele (manufacturer: Livzon Pharmaceutical
Co., Ltd., website:www.Livzon.com) 8 hours before the gavage, which
removed bacteria from the stomach. One hour before the gavage, 2% sodium
bicarbonate (manufacturer: Huiyin Bizhong Jiangxi East Asia Pharmaceutical
Co., Ltd., product batch number: 2018071824, website: www.mhuiyinbi.cn) was administered orally. Group C (HP infection group + high cholesterol group)
was fed the naturally increased high-cholesterol TP06105 diet at a dose of 6 g per mouse. The same method was used to inject the HP bacterial solution. In the high cholesterol group (D), the naturally increased high-cholesterol TP06105 diet was provided at a dose of 6 g/kg per mouse, and the liquid medium
was administered in a volume of 0.2 ml per mouse.
Evaluation of successful test model construction
After 4 weeks, 2 mice from groups A, B, C, and D were fasted for 24
hours .Then We use a 1% sodium pentobarbital solution (manufacturer: Shanghai Biaozhuo Biotechnology Co., Ltd., website: www.app17.com/c68009, 30 mg/kg body weight, intraperitoneal injection)to inject the target mouse intraperitoneally at a dose of 150 mg/kg. After the treatment is completed, it is necessary to check
whether the heart of the mouse is beating, ensuring that the mouse is quiet and
without fear or anxiety. Die without pain. Blood samples collected from the
four groups of mice were centrifuged (2000 x g for 5 min) to obtain
sera, which was evaluated using an antibody against cholesterol. The results
were compared among the 4 groups. The results obtained from the mouse
sera determined the successful establishment of a high-cholesterol model. The
stomach tissue was removed using a sterile surgical instrument. The stomach
residue was rinsed with phosphate buffered saline (PBS) (manufacturer:
Solarbio, item No.: P1020, Website: www.solarbio.com). Then, the stomach gland
was cut, and one piece wasplaced in the rapid urease reagent. The colour changes
from yellow to red.
Fig2
Vitamin D3 intervention
Group A (blank control group) did not receive any treatment. The remaining
mice in each group were randomly divided into two groups to create groups B1, B2, C1, C2, D1, and D2, and groups B1, C1, and D1,which were sacrificed for analysis. The vitamin D3 stock solution in olive oil was administered orally by mouth. The
amount of gastric juice was 5 ml/kg once daily for 4 weeks. Groups B2, C2 and D2 were orally administered olive oil alone. The amount of gastric juice was 5 ml/kg
once daily by gavage for 4 weeks.
Preparationofsera and tissue
After 4 weeks of vitamin D3 ad ministration, all mice were fasted for 24 hours.Then We use a 1% sodium pentobarbital solution (manufacturer: Shanghai Biaozhuo Biotechnology Co., Ltd., website: www.app17.com/c68009, 30 mg/kg body weight, intraperitoneal injection)to inject the target mouse intraperitoneally at a dose of 150 mg/kg. After the treatment is completed, it is necessary to check whether the heart
of the mouse is beating, ensuring that the mouse is quiet and without fear or anxiety. Die without pain. Blood was collected from the mice by heart puncture and then
centrifuged at 2000 x g for 10 min with a high-speed centrifuge (manufacturer:
Shanghai Anting Scientific Instrument Factory, website: www.sh-anting17.com).
The sera were stored in a -80 degree freezer for the cholesterol and IL-8 measurements. Figure 2A shows the liver of non-high cholesterol mice, figure 2B is the
liver of high cholesterol mice.The stomach tissue was removed using a sterile
surgical instrument, and the gastric residue was washed with PBS. The gastric
gland was cut and divided. The colour of the rapid urease reagent changed from
yellow to red(figure2C). Additionally, one part was fixed with paraformaldehyde
and paraffin sectioned for HE staining, and the degree of gastritis was observed
under an inverted microscope. An additional piece was collected in a freezer tube
and stored in a -80 °C freezer for western blotting to examine the STAT3, JAK, IKBa and cox 2 contents in the gastric mucosa.A final piece was collected in a freezer
tube and stored in a -80 °C freezer to examine gastrin gene expression by RT-PCR. The liver tissue from the mice was collected and stored in a -80 °C freezer.
Insig-2 and VDR gene expression was examined by RT-PCR
Experimental detection methods
Real-time PCR analysis
PCR was performed using the Life Technology StepOneTM Real-Time PCR instrument as described above. Each sample was comprised of 3 replicate
wells. The liver tissue and blood samples were tested using the QuFast
SYBR Green PCR Master Mix kit (ELK Biotechnology, EQ001) toev aluate
VDR, insig-2, and gastrin gene expression. The following nucleotide primers
were used: gastrin NM_010257.4 (Forward ACCAATGAGGACCTGGAACAG, Reverse AAGTCCATCCATCCGTAGGC), mouse liver tissue insig-2 NM_001271531.1 (Forward CAGTTTTCCCTCACACTGGCT, Reverse GGCAACCAAGAACGGACATAG), mouse liver tissue VDR NM_009504.4 (Forward CAGGACCGCCTATCCAACAC, Reverse GCCGAACACCTCTAGCACAAG), and GAPDH
NM_008084.3 (Forward TGAAGGGTGGAGCCAAAAG, Reverse AGTCTTCTGGGTGGCAGTGAT). The samples were pre-denatured at 95 °C for 1 minute
and cycled 40 times for 10 seconds at 95 °C and 1 minute at 60 °C.
Western blotting analysis
Protein extraction: Total protein extraction from gastric tissue: Tissue block 2 was rinsed with pre-cooled PBS (brand:ASPEN, product number: AS1025, website: www.aspenpharma.com). The homogenate was transferred to a centrifuge tube and shaken. After incubating in an ice bath for 30 minutes and centrifuging at 12,000 rpm for 5 minutes at 4 °C, the
supernatant was collected as a total protein solution. 2) Quantification of the
protein concentration: The protein concentration of the samples was determined using a BCA protein concentration assay kit (brand: ASPEN, product number: AS1086, website: www.aspenpharma.com). 3) SDS-PAGE electrophoresis: The total of 40 µg of total protein was loaded for each sample, and an appropriateamount of protein loading buffer was added (30.3 g of Tris,18.77 g of glycine, and 1.0 g of SDS) (brand: ASPEN, product code: AS1011, website:www.aspenpharma.com). Double-distilled water was added to obtain a volume of 1000 ml,and the mixture was incubated in a 95-100 °C boiling water bath for 5minutes.To prepare the separating gel (seeTable1), the gel mixtures were shaken
immediately after adding TEMED (tetramethylethylenediamine). After approximately 45 minutes, the water covering the upper layer was poured out, and the
remaining water was blotted with absorbent paper. The concentrating gel was
prepared (seeTable2) by filling and replenishing the remaining space in the
gel and inserting the comb into the concentrating gel. The comb was removed,and the electrophoresis rack was placed in the electrophoresis tank(manufacturer: Beijing Liuyi Instrument Factory, model: DYCZ-24DN, website: www.liuyi17.com). Then, the tank was filled with electrophoresis buffer, and samples were added to the sample wells. Constant pressure electrophoresis was applied at 80V for the concentrating gel and 120 Vfor the separating gel until bromophenol blue reached the lower edge of the rubber sheet. 4) Transfer to film: The
membrane filter paper and PVDF film were prepared (brand:Millipore, product number: IPVH00010, website: www.sns17.com).From the positive to the negative electrode, the transfer film sponge, three-layer filter paper, PVDF film, gel,
three-layer filter paper, and transfer film sponge were sequentially stacked.
Bubbles were removed from between the layers. The membrane transfer time was adjusted depending on the molecular weight of the target protein.5)
Incubation with antibodies: The transferred membrane was added to blocking
solution and blocked at room temperature for 1 hour. The blocking solution
was removed, and the diluted primary antibody (brand: ASPEN,product number: AS1061, website: www.aspenpharma.com) was added, and the membrane was incubated at 4 °C overnight. The diluted primary antibody was recovered, and the membrane was washed with TBST. The secondary antibody diluted with
the secondary antibody diluent (brand: ASPEN, product number: AS1058, www.aspenpharma.com) was added, and the membrane was incubated for 30 minutes at room temperature and then washed four times with TBST on a shaker at
room temperature (manufacturer: Beijing Liuyi, instrument factory model:
WD-9405A, website: www.liuyi17.com) for 5 minutes per wash. 6)Chemiluminescence detection: Newly prepared ECL solution (A: B = 1:1) (solution A: 200 ml (2.422 g of Tris and 150 ml of H2O) was adjusted to pH 8.6, and the
volume was adjusted to 200 ml. The solution was mixed(0.08858g of luminol and 0.0131328 g of pcAcid) overnight in the dark. The protein side of the membrane was exposed in the darkroom. The exposure conditions were adjusted
according to the different light intensities, and the films were developed and
fixed.
Table1、Table2
ELISA detection method
The standards were diluted, and the blank sample and sample wells were
prepared for a total of 7 wells. The liquid was removed from each well, but
the wells were not washed. Then, 100 μL of IL-6 antibody (brand: ELK Biotechnology, item No: ELK1157, website: www.elkbioch.com) or IL-8 antibody
(brand: ELK Biotechnology, item No: ELK8323, website: www.elkbioch.com)
was added to each well. The plate was covered with a plate sealant,incubated at 37 °C for 1 hour, and then washed with a solution. Next, 350 μL of 1×
solution was added to each well, and the plate was allowed to stand for 1-2 minutes. The plate was washed completely 3 times. During the last wash, any remaining wash buffer was removed by aspiration or decantation or by adsorbing it on absorbent paper. Then, 100 μL of streptavidin-HRP working
solution was added to each well, and the plate was covered with a plate
sealant and incubated for 30 minutes at 37 °C. The aspiration/washing process was repeated a total of 5 times as described in step 4. Next, 90 μL of LTMB substrate solution was added to each well. The plate was covered with a new plate sealant and incubated at 37 °C for 10-20 minutes. The liquid turned
blue after the addition of a TMB substrate solution. Finally, 50 μL of stop
reagent was added to each well. After the addition, the liquid turned yellow,
and the reaction was stopped by mixing the liquid via tapping the side of the plate. Any water droplets and fingerprints were removed from the bottom of
the plate, and the liquid surface was checked for air bubbles. The plate was
read on a microplate reader immediately at 450 nm.
HE staining
Dewaxing of the paraffin sections in water: The sections were incubated
successively in xylene I for 20 min, xylene II for 20 min, anhydrous ethanol I for 10 min, anhydrous ethanol II for 10 min, 95% alcohol for 5 min, 90%
alcohol for 5 min, 80% alcohol for 5 min, and 70% ethanol for 5 min. Then, the sections were washed with distilled water. The sections were incubated in Harris haematoxylin staining solution (manufacturer: ASPEN, item, NOAS1055A, website: www.aspenpharma.com) for 3-8 minutes, rinsed with tap water,
separated with 1% hydrochloric acid alcohol for a few seconds, rinsed with
tap water, returned to 0.6% ammonia and rinsed with tap water. The sections were stained with Yihong dye solution (manufacturer: ASPEN, item number: AS1094, website: www.aspenpharma.com) for 1-3 minutes. Then, the sections were placed in 95% ethanol for 5 minutes, 95% ethanol for 5 minutes, absolute ethanol I for 1 minute,absolute ethanol II for 5 minutes,xylene I for 5 minutes and xylene II for dehydration and to make them transparent for 5 minutes;
the sections were finally sealed with xylene from neutral chewing gum(manufacturer: Shanghai Yiheng Scientific Instrument Co., Ltd., model: DHG-9123A, website: www.yihenyiqi.com)
Statistical analysis
The statistical analysis was performed using the SPSS 19.0 software (SPSS Inc., Chicago,IL,USA, http://www.presidion.com),and p < 0.05 was considered statistically significant. Data from the animal studies were analysed using a
t-test or one-way ANOVA, followed by Tukey’s test. The results are expressed as the mean ± SD.