METTL14 attenuates cancer stemness by suppressing ATF5/WDR74/β-catenin axis in gastric cancer

doi:10.21203/rs.3.rs-4168583/v1

Download PDF

Research Article

METTL14 attenuates cancer stemness by suppressing ATF5/WDR74/β-catenin axis in gastric cancer

https://doi.org/10.21203/rs.3.rs-4168583/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose

Methods

Expression of METTL14 in GC was assessed by public datasets and clinical specimens. The roles of METTL14 in proliferation, metastasis and stemness were examined by using both in vitro and in vivo experiments. The m6A RNA immunoprecipitation (MeRIP) and luciferase reporter assays were performed to verify the target of METTL14. Rescue assays were used to explore the impaired stemness by METTL14 overexpression. The downstream mechanisms of ATF5 and upstream modification of METTL14 were studied by Chromatin immunoprecipitation (ChIP) and westernblot.

Results

Decreased expression of METTL14 was correlated with poor survival in GC. Functionally, METTL14 knockdown promoted GC cell stemness. Mechanically, METTL14 mediated m6A modification and facilitated ATF5 mRNA degradation. Furthermore, the deleterious effects subdued by the overexpression of METTL14 were restored following ATF5 overexpression, which facilitated the transcription of WDR74, thereby enhancing β-catenin translocation from the cytoplasm to the nucleus. Moreover, lactylation modification that occurred on the histone H3 (Lys18) of METTL14 could promote the expression of METTL14.

Conclusions

Our results demonstrate that METTL14 knockdown-mediated m6A modification of ATF5 mRNA promotes GC stemness by activating the WDR74/β-catenin axis.

Gastric cancer

Stemness

N6-methyladenosine (m6A)

METTL14

ATF5

Gastric cancer represents the third cause of cancer-related death worldwide(1). Recent decades witness advancements in the treatment of gastric cancer, including targeted therapy and immunotherapy(2, 3). However, due to the high heterogeneity and distant metastasis, the survival of patients with advanced cancer is still unsatisfied(4, 5). Stemness traits or cancer stem cells are defined as the source of gastric cancer metastasis, recurrence, and chemoresistance(6-8). It’s generally recognized that targeting cancers stem cells or cells with stemness characteristics might be an effective strategy for GC patients(9, 10).

N⁶-methyladenosine (m⁶A) modification, which refers to the methylation of the N6 position on adenosine, is the most abundant modification in mRNA, that is involved in precursor mRNA maturation, translation, and stability(11, 12). m6A modification is controlled by a dynamic interplay between “writers”, “erasers” and “readers”. METTL14, as a m6A writer, plays dual roles in carcinogenesis, which could attribute to both tumor-promoting and tumor-suppressive roles(13). Li et al. documented the oncogenic role of METTL14, which expedited the progression and metastasis of osteosarcoma(14). Zhang et al. disclosed the tumor-suppressive role of METTL14 in cholangiocarcinoma(15). Liu et al. elucidated how METTL14-mediated miR-99a-5p m6A modification and its upregulated expression inhibited the properties of esophageal squamous cell carcinoma CSC(16). However, there are no reports concerning the roles of METTL14 in regulating gastric cancer cell stemness traits.

ATF5, as a member of the activating transcription factor (ATF)/cAMP response-element binding protein (CREB) family, is a widely expressed basic leucine zipper protein that involves in the development of various cancers(17-19). Angelastro et al. revealed significant ATF5 immunostaining in tumor cells from glioblastomas(20). He et al. demonstrated that ATF5 interacted with the HIF1 pathway to promote esophageal carcinoma angiogenesis(21). Sheng et al. reported that ATF5 suppressed autophagy in BCR-ABL-transformed cells by transcriptional stimulation of mTOR(22). ISHIHARA et al. indicated that ATF5 enhanced radioresistance in lung adenocarcinoma cells(23). However, there is a lack of experimental evidences to clarify the underlying regulation of ATF5 in GC.

In this paper, METTL14 was found to be under-expressed in tumor lesions, and suppressing METTL14 could promote the proliferation, metastasis, and stemness of gastric cancer. Mechanistically, METTL14, as a methyltransferase, promoted its degradation by mediating the m6A modification of the target gene ATF5 mRNA. As a transcription factor, ATF5 could bind to the promoter region of WDR74 to promote its transcription, and in turn causing the accumulation of β-catenin in the nucleus. Here, we found that lactylation modification that occurred on the histone H3 (Lys18) of METTL14 could promote the expression of METTL14. The findings of the present study indicated that METTL14 played a crucial role in GC through m6A modification of ATF5.

Low METTL14 expression is correlated with poor survival in gastric cancer

Publicly available scRNA-Seq datasets were collected and analyzed to elucidate the expression of METTL14 in gastric cancer. Firstly, the transcriptomes of 369 680 single cells from 6 integrated GC datasets were performed unsupervised clustering and the uniform manifold approximation and projection (UMAP) plot analysis. Cluster identities were determined according to the expression of established markers (Fig. 1A, B). The analysis of METTL14 expression found that Epithelial/Cancer cells were significantly down-regulated in the tumor group (Fig. 1C). To validate the results, we also evaluated the expression levels of METTL14 in gastric cancer using the GEO RNA-seq database, including GSE54129, GSE66229, GSE15460, GSE27342 datasets and TCGA-STAD database. Consistently, the result from these datasets showed significantly down-regulated METTL14 expression in GC tissues (Fig. 1D, E, and Supplemental Fig. 1A). Real-time quantitative PCR and western blotting indicated that METTL14 was remarkably down-regulated in GC cell lines (BGC823 and HGC27) compare to normal gastric epithelial cell line GES1 (Fig. 1F, G). Immunohistochemistry (IHC) revealed decreased METTL14 protein levels in gastric cancer samples compared to adjacent normal tissues (Fig. 1H). Fig. 1I shows decreased METTL14 IHC scores in gastric cancer tumor tissues (N=30) than those in normal tissues (N=14) (P < 0.0001). According to the Kaplan-Meier plotter, high expression of METTL14 was significantly correlated with better Overall Survival (OS) and Progression Free Survival (PFS) (Supplemental Figure 1B). With the above evidence, we concluded that METTL14 was frequently down-regulated in human GC and associated with poor prognosis.

METTL14 downregulation facilitates GC cell proliferation and tumorigenesis

Given the fact that METTL14 is down-regulated in tumor tissues, we speculated that METTL14 may act as a tumor suppressor in GC. To define the functional roles of METTL14 in GC, stable METTL14-overexpressed cell lines were established by transfecting plasmids, while METTL14 knockdown cell lines were established using shRNAs. The infection efficiencies were assessed by western blotting (Fig. 2A). Cell proliferation abilities were determined by CCK-8 assay, colony formation, and Edu assays. Consistently, overexpression of METTL14 inhibited GC cell proliferation, while knockdown of METTL14 enhanced cell viability and proliferation, reflected by expedited growth rate and increase of colony numbers (Fig. 2B-F). Then, we performed tumor xenograft studies to verify the roles of METTl14 in GC growth in vivo. As expected, METTL14 deficiency remarkably promoted tumor growth, as indicated by larger tumor size and heavier tumor weight (Fig. 2G-I). Likewise, METTL14 overexpression significantly diminished tumor size and tumor growth in vivo (Fig. 2J-L). These results suggested that METTL14 could repress gastric cancer cell proliferation and tumor growth.

METTL14 knockdown promotes GC cell migration, invasion, and metastasis

To determine the roles of METTL14 in metastasis, we investigated the roles of METTL14 in gastric cancer migration and invasion by in vitro experiments, and distant metastasis by in vivo experiments. Would healing assays showed that knockdown of METTL14 could promote the migration of GC cells, while overexpression of METTL14 repressed cell migration (Fig. 3A, B). In addition, Transwell assays revealed that knockdown of METTL14 significantly facilitated cell migration and invasion. Whereas, METTL14 overexpression remarkably inhibited these effects (Fig. 3C, D). To study the effect of METTL14 on metastasis in vivo, we performed tail vein injection experiments by injecting nude mice with METTL14 overexpression cells. Four weeks after injection, the lungs were collected and the lung metastases were captured (Fig. 3E-F). The lung metastasis index was calculated by metastatic tumor/lung area. As shown in Fig. 3G, the lung metastatic loci were diminished smaller in the METTL14 overexpression group (Fig. 3F). Furthermore, we found that the expression of METTL14 was much lower in metastatic gastric cancer by analyzing GSE158631 dataset (Fig. 3H). Meanwhile, we applied IHC to detect differential METTL14 expression between gastric cancer specimens with or without distant metastasis. Similarly, the expression of METTL14 was remarkably down-regulated in patients with distant metastasis (Fig. 3I). Taken together, these results suggested that METTL14 represses metastasis of GC in vitro and in vivo.

METTL14 knockdown strengthens the stemness traits of GC cells

We further explored whether METTL14 could regulate GC cell stemness phenotypes. Firstly, various stemness scores were compared between high and low METTL14 expression groups using the public database, which indicated that low METTL14 expression demonstrated a higher stemness index except for mRNAsi and DMPsi (Fig. 4A). Gastric cancer cells were cultured in serum-free culture medium to generate spherical cells that demonstrate stemness properties. Western blot was used to detect the expression of METTL14 between adherent monolayer cells and spherical tumor cells. METTL14 expression was remarkably decreased in spherical cells than in adherent tumor cells at protein levels (Fig. 4B). Sphere formation assay showed that METTL14 knockdown significantly enhanced the size and number of spheres, while METTL14 overexpression remarkably decreased the size and number of spheres (Fig. 4C). Flow cytometric analysis showed that genetic knockdown of METTL14 in GC cells elevated the percentage of the ALDH+ population, while overexpression of METTL14 reduced the enrichment of ALDH+ cells (Fig. 4D, E). Since OCT4, NANOG, and SOX2 are important stemness related genes, we further measured their mRNA expression levels in METTL14 knockdown or overexpression cells. As shown in Fig. 4F, METTL14 knockdown dramatically upregulated the expression of OCT4, NANOG, and SOX2, while METTL14 overexpression repressed the expression levels of these stemness genes (Fig. 4F). To further investigate the resistance to chemotherapy, METTL14 overexpression cells were treated with 5-FU and Oxaliplatin at different concentrations. METTL14 overexpression promoted the sensitivity of GC cells to these chemotherapeutic drugs (Fig. 4G). Taken together, these data strongly indicated that decreased METTL14 could promote CSC phenotype and characteristics of GC cells.

METTL14 stabilizes ATF5 mRNA by decreasing m6A methylation

ATF5 has been reported to be correlated with cancer development, and the m6A modification has been reported to be crucial for elevated ATF5 expression(24, 25). Therefore, we hypothesized that there might be an interaction between METTL14 and ATF5 during the progression of gastric cancer. Firstly, we measured the global level of m6A through m6A dot blot methods. As anticipated, m6A levels markedly decreased in gastric cancer (GC) cell lines devoid of METTL14, whereas the upregulation of METTL14 led to an increase in cellular m6A abundance (Fig. 5A). Furthermore, the MeRIP-qPCR assay was conducted to determine the enrichment of m6A in ATF5. Compared with IgG control, the knockdown of METTL14 significantly reduced ATF5 m6A levels, while overexpression of METTL14 increased the m6A levels of ATF5 (Fig. 5B). It was observed that weakening METTL14 significantly elevated the ATF5 mRNA and protein levels, while the opposite phenomenon was observed in the METTl14 overexpression group (Fig. 5C, D). Meanwhile, correlation analysis showed that METTL14 was negatively correlated with ATF5 in the TCGA-STAD dataset and GSE66229 dataset (Fig. 5E).

M6A modification regulates mRNA transcript stability (26, 27). Then we explored whether METTL14 could regulate ATF5 expression by modulating its mRNA stability through the application of actinomycin D (Act D). The results indicated that the knockdown of METTL14 contributed to an increase in the half-life of ATF5 transcripts after treatment with actinomycin D (Fig. 5F). The m6A peaks around the CDS region of its mRNA were detected through an online website (Fig. 5G). To substantiate the requirement of m6A modification for ATF5, luciferase reporter assays were conducted with wild-type (WT) and mutant (Mut) plasmids. Firstly, we constructed the luciferase reporter plasmids based on the sequence of ATF5 m6A modification site predicted by the public database (Fig. 5H). Luciferase reporter assay showed that the transcriptional level of wild-type ATF5, but not the mutation, was significantly increased in the absence of METTL14 (Fig. 5I). Reciprocally, METTL14 overexpression inhibited the expression of wild-type ATF5-fused reporter (Fig. 5I). These results revealed that METTL14 can regulate ATF5 expression through m6A modification.

Dysregulation of the METTL14-ATF5 axis accelerates the malignant progression in GC

Rescue experiments were conducted to determine the function of the METTL14-ATF5 axis in GC. Firstly, the lentiviral vector-carried oe-METTL14 was transfected into METTL14 overexpression GC cells and transfection efficiency was verified at the protein level (Fig. 6A). Firstly, colony formation and CCK-8 assays showed that the proliferation ability was suppressed by overexpressing METTL14 but restored by over-expressed ATF5 (Fig. 6B-D). Likewise, Transwell assays verified that overexpression of ATF5 could abrogate the repressed migration and invasion of METTL14 overexpression (Fig. 6E, F). Furthermore, both Sphere Formation Assay and Extreme Limiting Dilution Analysis (ELDA) demonstrated that ATF5 overexpression counteracted the inhibitory effect of METTL14 on the maintenance of stemness properties (Fig. 6G, H). Moreover, ATF5 decreased the drug sensitivity of GC cells with METTL14 overexpression (Fig. 6I). Notably, the online database (http://cistrome.org/db/) predicted that WDR74 which has been reported to promote the accumulation of β-catenin in the nucleus might be a target gene through transcriptional regulation by ATF5 (Fig. 6J). To further verify whether ATF5 took part in the transcriptional regulation of WDR74, we used the ChIP-qPCR analysis and found that ATF5 could bind to the promoter region of WDR74(Fig. 6K, L). The protein level of WDR74 was increased in METTL14 knockdown cells, while the expression level was reduced in oe-METTL14 GC cells (Fig. 6M). What’s more, the nucleocytoplasmic separation assay showed that METTL14 promoted the transfer of β-catenin from the nucleus to the cytoplasm (Fig. 6N). And overexpression of ATF5 restored the repressed protein level of WDR74, β-catenin, and its downstream genes in METTL14 overexpression cells (Fig. 6O, P). These results confirmed that malignant behavior repressed by METTL14 overexpression was rescued after overexpressing ATF5, which up-regulates the transcription of WDR74 to promote β-catenin transfer from cytoplasm to the nucleus.

Histone lactylation activates the transcription of METTL14 in GC cells.

Recently, lactate-derived histone lactylation was reported as a new epigenetic marker linking glucose metabolism to gene expression(28). Thus, we wondered whether METTL14 expression was associated with histone lactylation. Interestingly, METTL14 mRNA and protein expression levels were down-regulated after the treatment of 2-Deoxy-D-glucose (2-DG) and up-regulated after adding Lactate (Lact) or glucose (Glu) (Fig. 7A, B). Furthermore, ChIP-qPCR analysis revealed that H3K18la was enriched in the promoter region of METTL14. (Fig. 7C, D). Altogether, these data demonstrated that H3K18la could activate METTL14 expression.

Gastric cancer stemness is the main cause of metastasis and drug resistance(29). Identification of the molecular mechanisms implicated in stemness is significant for the development of novel therapeutic strategies. m6A modification, as the most abundant modification of mRNAs and a reversible and dynamic RNA modification, has been shown to play critical roles in malignant tumors(30, 31). However, the mechanisms of m6A writer METTL14 are not clear in gastric cancer. In the present study, we found that METTL14 was downregulated in GC tissues and that decreased METTL14 level predicted poor survival in GC. These results were consistent with other studies on gastric cancer(32, 33). A previous study showed METTL14 repressed GC cell proliferation, migration, and invasion(32, 34). In our preliminary research, METTL14 also maintains the trend of inhibiting GC cell proliferation and metastasis in vitro and in vivo.

However, the roles of METTL14 in modulating GC cell stemness are still unclear. Few studies reported the roles of METTL14 in regulating stemness. Huang et al. found that knockdown of METTL14 led to increased stemness properties of mouse embryonic stem cells(35). Zhang et al. found that activated transcript factor FOXO3a upregulated METTL14 expression to repress the expression of epithelial-mesenchymal transition (EMT) factor Vimentin(36). Gu et al. indicated that METTL14 repressed the self-renewal of bladder tumor-initiating cells(37). Weng et al. reported that METTL14 inhibits the initiation and maintenance of acute myeloid leukemia (AML) stem cells(38). Study in glioblastoma also demonstrated that knockdown of METTL14 promoted glioblastoma stem cell growth, self-renewal and tumorigenesis (39). In this study, we found METTL14 expression was lower in spherical tumor cells than that in adherent tumor cells. Moreover, overexpression of METTL14 led to impaired stemness properties of gastric tumor cells, while knockdown of METTL14 promoted malignant cellular behaviors and stemness traits of GC cells, including self-renewal and chemoresistance. These results revealed a novel role of METTL14 as a suppressor in the stemness characteristics of gastric cancer.

The mechanisms of METTL14 in regulating GC stemness were still unclear. Mechanically, METTL14 can participate in tumor stemness by m⁶A-dependent modification of mRNAs. Zhang et al. reported that m⁶A methylation regulated CBX8 by maintaining its mRNA stability, which contributed to increased cancer stemness and decreased chemosensitivity in colon cancer(40). Lin et al. found that m6A modification of CENPK mRNA promoted cervical cancer cells stemness(41). Herein, knockdown of METTL14 inhibited the global m6A modification levels in GC cells. Moreover, we identified ATF5 as a target mRNA of METTL14. Knockdown of METTL14 decreased significant m6A enrichment of ATF5. While, overexpression of METTL14 induced m6A enrichment of ATF5. METTL14 was negatively correlated with the expression of ATF5. RNA stability assay showed that downregulation of METTL14 repressed the degradation of ATF5 mRNA. Luciferase reporter assay showed that METTL14 interacted with ATF5 in the m6A modification site. These results suggested that METTL14 might regulate ATF5 expression by a m⁶A-dependent modification. Rescue experiments were conducted to determine that the impaired malignant behavior and stemness traits by METTL14 overexpression could be restored by ATF5 overexpression. Zhou et al. reported that ATF5, as a transcription factor, could directly bind to and stimulate the promoter of DVL1 gene in bladder cancer(42). Moreover, we found that ATF5 could increase the transcription of WDR74 to activate β-catenin transportation to the nucleus in GC. Li et al. showed that the Sijunzi Decoction inhibited gastric cancer stem cells by reducing the nuclear accumulation of β-catenin(43). In addition, we preliminarily explored the upstream regulatory mechanism of METTL14. The result showed that H3K18la (histone lactylation maker) could increase METTL14 expression. Thus, the concrete mechanisms are worth of exploring. In conclusion, our study firstly provided substantial evidence that the low expression of METTL14 maintained and enhanced stemness in GC, through reducing m6A modification of ATF5 to increase the transcription of WDR74 and nuclear activity of β-catenin (Fig. 7E). The understanding of m6A modification of METTL14 in the stemness characteristics might lay a theoretical foundation for seeking novel approaches for GC treatment.

Stemness is one of the leading causes of treatment failure in gastric cancer (GC). Methyltransferase-like 14 (METTL14) participates in several malignancies. But the precise mechanisms of METTL14 in regulating GC stemness are still unclear. Here, we demonstrate that decreased expression of METTL14 was correlated with poor survival and promoted stemness in GC. Mechanically, METTL14 mediated m6A modification and facilitated ATF5 mRNA degradation. Furthermore, the deleterious effects subdued by the overexpression of METTL14 were restored following ATF5 overexpression, which facilitated the transcription of WDR74, thereby enhancing β-catenin translocation from the cytoplasm to the nucleus. Moreover, lactylation modification that occurred on the histone H3 (Lys18) of METTL14 could promote the expression of METTL14. Collectively, our results demonstrate that METTL14 knockdown-mediated m6A modification of ATF5 mRNA promotes GC stemness by activating the WDR74/β-catenin axis.

Human samples and ethical approval

Tissues from 30 GC patients were collected for immunohistochemistry in our study. Patients diagnosed with gastric cancer after surgical resection and with complete follow-up data were included. The ethics committee of the Second Affiliated Hospital of the South China University of Technology approved the study. Informed consent was obtained from patients at the time of sample collection.

Data acquisition and analysis

Six scRNA-Seq datasets with both gastric malignant and normal cells data were accessed through the GEO database (GSE134520, GSE158631, GSE163558, GSE167297, GSE183904 and GSE206785). Those data were integrated using the anchors method in the R with “Seurat” and “Harmony” packages. Data were then log-normalized by normalization and scaled for downstream analysis. Further cell subpopulation classification, differentially expressed gene (DEG) analysis of each cluster, and marker gene screening were performed. We used the R package “Limma” to analyze RNA-seq datasets. TCGA-STAD data were downloaded from the TCGA database (https://portal.gdc.com). Overall survival (OS) and free-progression survival (FP) of METTL14 in GC patients were analyzed by using the Kaplan-Meier Plotter online website (https://kmplot.com/). The expression profiles of METTL14 and ATF5 in GC patients were retrieved from the cBioPortal database (https://www.cbioportal.org/) and additionally from GSE66229 data. Subsequently, we employed the Spearman method to scrutinize the correlation between them. Based on the median METTL14 expression, we divided GC patients in the TCGA-STAD cohort into the high METTL14 group and low METTL14 group and further compared the differential expression of the stemness index between the two groups, which was derived from the OCLR algorithm, as constructed by Malta et al.

Cell Lines

Human embryonic kidney cell line 293T, gastric cancer carcinoma cell lines (AGS, BGC823, MKN45, HGC27), and human gastric mucosal cell line GES-1 were obtained from the Global Bioresource Center (ATCC, USA). The cells were grown in a DMEM medium containing 10% fetal bovine serum under 37°C with 5% CO2. All cells were subjected to STR identification and were excluded from mycoplasma contamination.

Plasmid construction and cell transfection

The lentiviral small hairpin RNA plasmid targeting METTL14 was ordered from Guangzhou IGE Biotechnology Ltd. The targeting sequence was GGATGAACTAGAAATGCAA or GCTGGACTTGGGATGATATAT. METTL14 and ATF5 overexpression lentivirus were ordered from Guangzhou IGE Biotechnology Co. The METTL14 plasmid was selected to carry the Flag tag. The lentiviral plasmids were transfected into 293T cells for 48 h using a PEI reagent to produce lentivirus. For the construction of stable cell lines, GC cell lines were infected with lentivirus for 48 h, followed by puromycin treatment (2 μg/ml). Cell transfection efficiency was detected by qRT-PCR and western blot.

Quantitative real-time RT-PCR (qRT-PCR)

Total RNA was extracted from the cell lines using TRIzol reagent according to the manufacturer’s description. After detecting the RNA quality and concentration, 1000 ng total RNA was used for reverse transcription by the HiScript II 1^st Strand cDNA Synthesis Kit. The target genes were amplified using ChamQ Universal SYBR qPCR Master Mix on the LightCycler® 96 Instrument. The relative levels of target gene expression were normalized to GAPDH and calculated using the 2-ΔΔCt formula. The primers used are listed in Supplementary Table S1.

Western blot

GC cells were lysed by RIPA reagent and then quantified using the BSA method. Denatured proteins were migrated in 10% SDS-PAGE gels and transferred to nitrocellulose membranes. After closing with 5% BSA, the membranes were incubated with primary antibodiesovernight at 4°C, washed, and conjugated with HRP-conjugated secondary antibodies. The details pertaining to all employed antibodies and their respective working concentrations were provided in Supplementary Table S2. Finally, proteins were detected using an enhanced chemiluminescence kit.

Cell proliferation assays

CCK8 assay was used to detect cell proliferation viability. Cells were prepared at a density of 2000 cells/well. 10% CCK8 solution was added to the cells and was allowed to incubate at 37°C for 2 hours. Cell viability was detected at 0, 24, 48, 72, and 96 hours. The absorbance of the cells was measured at 450 nm by a Biotek Cytation5 instrument. All experiments were performed in triplicate.

For colony formation assay, cells were prepared in 6-well plates (AGS: 250cells/well, BGC823: 500cells/well) and were replaced with fresh DMEM medium every 3 days. When the cells appeared as obvious colonies, they were fixed with methanol at room temperature for 15 minutes, and stained with 0.1% crystal violet at room temperature for 20 minutes. The number of colonies containing more than 50 cells was counted.

For the EdU staining assay, 2000 cells per well were seeded in a 24-well plate and incubated overnight at 37°C. The EdU staining solution was diluted with DEME to a final working concentration of 10 uM and then added to the cells. After setting at 37°C for 2 h, cells were fixed with formaldehyde for 15 min and permeabilized with PBS containing 0.3% Triton X-100 for 10 min. Click reaction solution was configured according to the instructions and incubated for 30 min at room temperature, protected from light. Proliferating cells were labeled with EdU, while nuclei were stained with Hoechst 33342. PBS was used to remove excess reagents between each operation. Photographs were taken using a fluorescent microscope and analyzed using Image J software.

Wound-healing assays

Briefly, monolayers of cells were scratched with a 10ul tip when they reached 90% fusion. Unattached cells were washed away with PBS and added to a serum-free DMEM medium. After photoing under the microscope, the cells continued to be cultured for 24 hours at 37℃. The wound closure was captured after 24 hours and analyzed by Image J software.

Transwell migration and invasion assays

Transwell assays were performed using a 24-well Transwell chamber system. For migration assays, 200 ul of serum-free medium containing 5×10⁴ cells was added to the upper chamber, and 600 ul of regular medium with 10% FBS was added to the lower chamber. After incubating at 37°C for 24 h, cells were fixed with 4% paraformaldehyde for 15 min, stained with 0.1% crystal violet at room temperature for 20 min, with the non-migrating cells removed with a cotton swab. For the invasion assay, 50 ul matrigel with a dilution of 1:8 was first pre-coated on the chambers’ upper surface and solidified at 37°C for 1 h. Then 200 ul of GC cells (1×10⁵ AGS; 2×10⁵ BGC823) were seeded into the upper chamber, followed by 600 μl of complete medium placed in the lower chamber. After incubation at 37°C for 24 h-48 h, the invading cells in the lower chamber were fixed and stained. Migrated or invaded cells were captured by microscopy, and the number of these cells was counted by Image J software.

In vivo assays for tumor growth and metastasis

5-week-old female Balb/c nude mice were purchased from Hunan SJA Laboratory Animal Co., Ltd. For tumor growth assay, 2×10⁶ GC cells were injected subcutaneously into the nude mice with 5 mice in each group. Tumor volume was measured every 3 days using the following formula: tumor volume = (length × width²)/2. At the end of the experiment, mice were euthanized to take off the tumor, followed by being pictured and weighed. For the in vivo metastasis assay, 1×10⁶ GC cells were injected into nude mice through the tail vein. 4 weeks later, the mice were sacrificed, and the metastatic lung tumors were analyzed. All animal experiments were performed under the approval of the Laboratory Animal Ethics Committee, School of Medicine, South China University of Technology.

Immunohistochemistry

GC tissue and xenograft tumors were paraffin-embedded and sectioned. After dewaxing, hydration, and antigen repair, goat serum was used to block the non-specific antigen for 30 min. Diluted primary antibodies were added to the tissue overnight at 4°C, and the secondary antibody was subsequently labeled. The primary antibodies used in this study and their working concentration were listed in Supplementary Table S2. Proteins were stained with DAB buffer, while nuclei were stained with hematoxylin. The integrated score was defined as the value of multiplying intensity and area. The intensity score was set as follows: brown or dark yellow: 3 scores; yellow: 2 scores; light yellow: 1 score; gray: 0. The staining area was scored as follows: exceeding 50%: 3 scores; 25%-50%: 2 scores; 10%-25%: 1 score; <10%: 0. “Scores <3” was classified as the METTL14 low group, while “scores ≥3” was classed as high expression of METTL14.

Sphere formation assays and ELDA assays

GC cells were seeded at 1000 cells/well in 24-well ultra-low attachment plates for sphere formation assays. Cells were resuspended in DMEM/F12 medium supplemented with 1X B27, 20ng/ml bFGF, 20ng/ml EGF and 4ug/ml insulin. At 14 days, spheres larger than ~20 μm in diameter were photographed, and their diameters were measured for analysis.

For extreme limiting dilution analysis, cells were seeded at decreasing densities (20, 10, 5 cells/well into 96-well ultra-low attachment plates) in DMEM/F12 medium supplemented with various growth factors, with 10 replicates per group. At 14 days, any well containing one or more spheres was counted and analyzed on the ELDA website (http://bioinf.wehi.edu.au/software/elda/) for further analysis.

Drug resistance assays

The effect of 5-FU and Oxaliplatin on GC cells was estimated by cell viability. Briefly, GC cells were seeded into 96-well plates and cultured at 37°C until fusion reached approximately 80%. Different concentrations of DDP were added and then incubated for 24 h. Cell viability was subsequently assessed using the CCK8 assay.

Dot blot

Total RNA was extracted by using TRIzol reagent according to the manufacturer’s description mRNA was isolated and purified using the Dynabeads mRNA Purification Kit. After denaturation at 95°C for 3 min, 2ul of mRNA was added to Nitrocellulose membranes and placed at 37°C for 30 minutes allowing mRNA to cross-link with the membranes. The membranes were incubated with m6A antibody at 4°C overnight. After incubation with secondary antibodies, the membrane was visualized by ECL chemiluminescence.

Methylated RIP-qPCR (MeRIP-qPCR)

Total RNA from GC cells was extracted with TRIzol reagent and fragmented to approximately 300 nt. 10% of the fragmented RNA samples were used as the Input group according to the manufacturer’s instructions. 4ug of m6A antibody or IgG antibody was incubated with fragmented RNA overnight at 4°C, and then protein A/G magnetic beads were added to continue incubation at 4°C for 6 hours. The m6A-enriched RNA was extracted as previously described, and the m6A-mRNA enrichment was analyzed by reverse transcription qPCR. Specific primers were designed for MeRIP-qPCR analysis according to the information from a motif-dependent m6A site predictor SRAMP (http://www.cuilab.cn/sramp).

Dual-luciferase reporter assay

We designed the wild-type (WT) ATF5 sequence and the mutant (Mut) ATF5 sequence with a putative m6A site mutation. These sequences were separately cloned into the pGL3-Basic vector to generate the luciferase reporter clone. The Renilla luciferase plasmid was used as an internal control. The luciferase reporter plasmid and the control plasmid were co-transfected into GC cells. Firefly and Renilla luciferase activities were assayed 24 h later using a dual luciferase reporter system. A dual luciferase reporter assay was conducted with three biological repetitions each time.

Actinomycin D treatment

The stability of ATF5 mRNA was analyzed with Actinomycin D, a transcriptional inhibitor under a finial working concentration of 5 ug/mL. Cells were lysed with TRIzol reagent, and RT-qPCR was applied to detect RNA levels.

Chromatin immunoprecipitation-qPCR (ChIP-qPCR)

ChIP assay was performed using BersinBio ChIP Kit (Catalog Bes5001) according to the manufacturer’s protocol. Briefly, approximately 2 × 10⁷ cells were fixed in 1% formaldehyde for 10 min at room temperature. After 1 ml ChIP lysis buffer treatment, we collected the nuclear pellet to conducting ultrasonic pyrolysis. Immunoprecipitation was carried out overnight with purified anti- H3K18la antibody (PTM-1427RM), anti-ATF5 antibody (sc-377168 X), or IgG antibody as a negative control. Protein A/G beads were used to pull down the antigen-antibody compounds and then washed with washing buffers. The DNA-protein crosslinks were reversed with 5 M NaCl at 65 °C for 6 h, and DNA from each sample was purified. qPCR was performed using 2 μL DNA samples with the following primers:

METTL14: forward 5′- GATAGCCGCTTGCAGGAGAT -3′, reverse 5′-GCATTCTCGATCCCTCCCAC -3′.

WDR74: forward 5′- CGGCCTTATCCTTCCCATCTT -3′, reverse 5′- AGGGCTGTTTCCAAAATATAGCCA -3′.

Statistical analysis

Statistical analyses were performed with GraphPad Prism 8.3 and R 4.0 software. Experiments were repeated independently at least thrice. Groups were classified based on the median METTL14 expressed. Two-tailed Student’s t-test was used to compare data between two groups, and ANOVA analysis was employed to compare among three or more groups. Overall survival and free-progression survival were analyzed using the Kaplan-Meier method. In addition, correlation analysis of gene expression was performed by Spearman’s method. P<0.05 was considered statistically significant (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

METTL14: Methyltransferase-like 14; GC: gastric cancer; MeRIP: m6A RNA immunoprecipitation; ChIP: Chromatin immunoprecipitation; m6A: N6-methyladenosine; DEG: differentially expressed gene; OS: Overall survival; FP: free-progression survival; qRT-PCR: Quantitative real-time RT-PCR; WT: wild-type; Mut: mutant; UMAP: uniform manifold approximation and projection; IHC: Immunohistochemistry; ELDA: Extreme Limiting Dilution Analysis; 2-DG: 2-Deoxy-D-glucose; Lact: Lactate; Glu: glucose; EMT: epithelial-mesenchymal transition; AML: acute myeloid leukemia.

Competing interests

The authors declare no competing interests.

Ethics approval and consent to participate

The acquisition of human tissue specimens in this study has been approved by the Ethics Committee of Guangzhou First People's Hospital (Approval No: S-2023-129-01) and informed consent has been obtained from the donors. The title of this study is "METTL14 mediates the role and mechanism of ATF5 methylation in regulating stemness in gastric cancer cells ". The approval date for this research protocol is June 19, 2023. All animal experiments were conducted under the approval of the Laboratory Animal Ethics Committee, School of Medicine, South China University of Technology. The title of approval is "METTL14 mediates the role and mechanism of ATF5 methylation in regulating stemness in gastric cancer cells ".The approval date for this research protocol is June 20, 2023.

Consent for publication

Not applicable.

Availability of data and materials

Six scRNA-Seq datasets with both gastric malignant and normal cells data are available at GEO under the accession number GSE134520, GSE158631, GSE163558, GSE167297, GSE183904 and GSE206785. The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Funding

This study was supported by the Natural Science Foundation of Guangdong Province (2021A1515011113) and Guangzhou Science and Technology Program (2023A03J0966). We appreciate the technical support from the South China University of Technology.

Authors' contributions

Lin Lu and Guolong Liu developed the original idea and designed the study. Peiling Zhang and Hong Xiang performed most of the experiments, analysed data, and wrote the manuscript. Qian Peng and Chengyin Weng performed the in vivo experiments. Lujuan Ma integrated the data. All authors read and approved the final manuscript.

Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin. 2018;68(1):7-30.
Joshi SS, Badgwell BD. Current treatment and recent progress in gastric cancer. CA Cancer J Clin. 2021;71(3):264-79.
Alsina M, Arrazubi V, Diez M, Tabernero J. Current developments in gastric cancer: from molecular profiling to treatment strategy. Nat Rev Gastroenterol Hepatol. 2023;20(3):155-70.
Qian Y, Zhai E, Chen S, Liu Y, Ma Y, Chen J, et al. Single-cell RNA-seq dissecting heterogeneity of tumor cells and comprehensive dynamics in tumor microenvironment during lymph nodes metastasis in gastric cancer. Int J Cancer. 2022;151(8):1367-81.
Zeng Y, Jin RU. Molecular pathogenesis, targeted therapies, and future perspectives for gastric cancer. Semin Cancer Biol. 2022;86(Pt 3):566-82.
Rao X, Zhang C, Luo H, Zhang J, Zhuang Z, Liang Z, et al. Targeting Gastric Cancer Stem Cells to Enhance Treatment Response. Cells. 2022;11(18).
Gómez-Gallegos AA, Ramírez-Vidal L, Becerril-Rico J, Pérez-Islas E, Hernandez-Peralta ZJ, Toledo-Guzmán ME, et al. CD24+CD44+CD54+EpCAM+ gastric cancer stem cells predict tumor progression and metastasis: clinical and experimental evidence. Stem Cell Res Ther. 2023;14(1):16.
Zhang Y, Lin W, Jiang W, Wang Z. MicroRNA-18 facilitates the stemness of gastric cancer by downregulating HMGB3 though targeting Meis2. Bioengineered. 2022;13(4):9959-72.
Walcher L, Kistenmacher AK, Suo H, Kitte R, Dluczek S, Strauß A, et al. Cancer Stem Cells-Origins and Biomarkers: Perspectives for Targeted Personalized Therapies. Front Immunol. 2020;11:1280.
Norollahi SE, Mansour-Ghanaei F, Joukar F, Ghadarjani S, Mojtahedi K, Gharaei Nejad K, et al. Therapeutic approach of Cancer stem cells (CSCs) in gastric adenocarcinoma; DNA methyltransferases enzymes in cancer targeted therapy. Biomed Pharmacother. 2019;115:108958.
Lan Q, Liu PY, Haase J, Bell JL, Hüttelmaier S, Liu T. The Critical Role of RNA m(6)A Methylation in Cancer. Cancer Res. 2019;79(7):1285-92.
Meyer KD, Jaffrey SR. The dynamic epitranscriptome: N6-methyladenosine and gene expression control. Nat Rev Mol Cell Biol. 2014;15(5):313-26.
Deng X, Su R, Weng H, Huang H, Li Z, Chen J. RNA N(6)-methyladenosine modification in cancers: current status and perspectives. Cell Res. 2018;28(5):507-17.
Li HB, Huang G, Tu J, Lv DM, Jin QL, Chen JK, et al. METTL14-mediated epitranscriptome modification of MN1 mRNA promote tumorigenicity and all-trans-retinoic acid resistance in osteosarcoma. EBioMedicine. 2022;82:104142.
Zhang Y, Ma Z, Li C, Wang C, Jiang W, Chang J, et al. The genomic landscape of cholangiocarcinoma reveals the disruption of post-transcriptional modifiers. Nature communications. 2022;13(1):3061.
Liu Z, Wu K, Gu S, Wang W, Xie S, Lu T, et al. A methyltransferase-like 14/miR-99a-5p/tribble 2 positive feedback circuit promotes cancer stem cell persistence and radioresistance via histone deacetylase 2-mediated epigenetic modulation in esophageal squamous cell carcinoma. Clinical and translational medicine. 2021;11(9):e545.
Hai T, Hartman MG. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene. 2001;273(1):1-11.
Vinson C, Myakishev M, Acharya A, Mir AA, Moll JR, Bonovich M. Classification of human B-ZIP proteins based on dimerization properties. Mol Cell Biol. 2002;22(18):6321-35.
Sears TK, Angelastro JM. The transcription factor ATF5: role in cellular differentiation, stress responses, and cancer. Oncotarget. 2017;8(48):84595-609.
Angelastro JM, Canoll PD, Kuo J, Weicker M, Costa A, Bruce JN, et al. Selective destruction of glioblastoma cells by interference with the activity or expression of ATF5. Oncogene. 2006;25(6):907-16.
He F, Xiao H, Cai Y, Zhang N. ATF5 and HIF1α cooperatively activate HIF1 signaling pathway in esophageal cancer. Cell Commun Signal. 2021;19(1):53.
Sheng Z, Ma L, Sun JE, Zhu LJ, Green MR. BCR-ABL suppresses autophagy through ATF5-mediated regulation of mTOR transcription. Blood. 2011;118(10):2840-8.
Ishihara S, Yasuda M, Ishizu A, Ishikawa M, Shirato H, Haga H. Activating transcription factor 5 enhances radioresistance and malignancy in cancer cells. Oncotarget. 2015;6(7):4602-14.
Sun H, Li K, Zhang X, Liu J, Zhang M, Meng H, et al. m(6)Am-seq reveals the dynamic m(6)Am methylation in the human transcriptome. Nat Commun. 2021;12(1):4778.
Chen M, Liu Y, Yang Y, Qiu Y, Wang Z, Li X, et al. Emerging roles of activating transcription factor (ATF) family members in tumourigenesis and immunity: Implications in cancer immunotherapy. Genes Dis. 2022;9(4):981-99.
An Y, Duan H. The role of m6A RNA methylation in cancer metabolism. Mol Cancer. 2022;21(1):14.
Wang X, Zhao BS, Roundtree IA, Lu Z, Han D, Ma H, et al. N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell. 2015;161(6):1388-99.
Zhang D, Tang Z, Huang H, Zhou G, Cui C, Weng Y, et al. Metabolic regulation of gene expression by histone lactylation. Nature. 2019;574(7779):575-80.
Lytle NK, Barber AG, Reya T. Stem cell fate in cancer growth, progression and therapy resistance. Nat Rev Cancer. 2018;18(11):669-80.
Deng LJ, Deng WQ, Fan SR, Chen MF, Qi M, Lyu WY, et al. m6A modification: recent advances, anticancer targeted drug discovery and beyond. Mol Cancer. 2022;21(1):52.
Zhang B, Wu Q, Li B, Wang D, Wang L, Zhou YL. m(6)A regulator-mediated methylation modification patterns and tumor microenvironment infiltration characterization in gastric cancer. Mol Cancer. 2020;19(1):53.
Fan H, Chen Z, Chen X, Chen M, Yi Y, Zhu J, et al. METTL14-mediated mA modification of circORC5 suppresses gastric cancer progression by regulating miR-30c-2-3p/AKT1S1 axis. Molecular cancer. 2022;21(1):51.
Shimura T, Kandimalla R, Okugawa Y, Ohi M, Toiyama Y, He C, et al. Novel evidence for mA methylation regulators as prognostic biomarkers and FTO as a potential therapeutic target in gastric cancer. British journal of cancer. 2022;126(2):228-37.
Liu X, Xiao M, Zhang L, Li L, Zhu G, Shen E, et al. The m6A methyltransferase METTL14 inhibits the proliferation, migration, and invasion of gastric cancer by regulating the PI3K/AKT/mTOR signaling pathway. Journal of clinical laboratory analysis. 2021;35(3):e23655.
Huang H, Weng H, Zhou K, Wu T, Zhao B, Sun M, et al. Histone H3 trimethylation at lysine 36 guides mA RNA modification co-transcriptionally. Nature. 2019;567(7748):414-9.
Zhang N, Hua X, Tu H, Li J, Zhang Z, Max C. Isorhapontigenin (ISO) inhibits EMT through FOXO3A/METTL14/VIMENTIN pathway in bladder cancer cells. Cancer letters. 2021;520:400-8.
Gu C, Wang Z, Zhou N, Li G, Kou Y, Luo Y, et al. Mettl14 inhibits bladder TIC self-renewal and bladder tumorigenesis through N-methyladenosine of Notch1. Molecular cancer. 2019;18(1):168.
Weng H, Huang H, Wu H, Qin X, Zhao BS, Dong L, et al. METTL14 Inhibits Hematopoietic Stem/Progenitor Differentiation and Promotes Leukemogenesis via mRNA m(6)A Modification. Cell Stem Cell. 2018;22(2):191-205.e9.
Cui Q, Shi H, Ye P, Li L, Qu Q, Sun G, et al. m(6)A RNA Methylation Regulates the Self-Renewal and Tumorigenesis of Glioblastoma Stem Cells. Cell Rep. 2017;18(11):2622-34.
Zhang Y, Kang M, Zhang B, Meng F, Song J, Kaneko H, et al. m(6)A modification-mediated CBX8 induction regulates stemness and chemosensitivity of colon cancer via upregulation of LGR5. Mol Cancer. 2019;18(1):185.
Lin X, Wang F, Chen J, Liu J, Lin YB, Li L, et al. N(6)-methyladenosine modification of CENPK mRNA by ZC3H13 promotes cervical cancer stemness and chemoresistance. Mil Med Res. 2022;9(1):19.
Zhou J, Tian H, Zhi X, Xiao Z, Chen T, Yuan H, et al. Activating transcription factor 5 (ATF5) promotes tumorigenic capability and activates the Wnt/b-catenin pathway in bladder cancer. Cancer Cell Int. 2021;21(1):660.
Li YJ, Liao LL, Liu P, Tang P, Wang H, Peng QH. Sijunzi Decoction Inhibits Stemness by Suppressing β-Catenin Transcriptional Activity in Gastric Cancer Cells. Chin J Integr Med. 2022;28(8):702-10.

Supplementary Tables and Supplementary Figure are not available with this version.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

METTL14 attenuates cancer stemness by suppressing ATF5/WDR74/β-catenin axis in gastric cancer

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Conclusions

Materials and methods

List of abbreviations

Declarations

References

Supplementary Information

Additional Declarations

Status:

Version 1