Infiltrating Peripheral Monocyte TREM-1 Mediates Dopaminergic Neuron Injury in Substantia Nigra of Parkinson's Disease Model Mice

doi:10.21203/rs.3.rs-4169068/v1

Download PDF

Article

Infiltrating Peripheral Monocyte TREM-1 Mediates Dopaminergic Neuron Injury in Substantia Nigra of Parkinson's Disease Model Mice

https://doi.org/10.21203/rs.3.rs-4169068/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Neuroinflammation is a crucial factor in the pathogenesis of Parkinson's disease (PD). Activated microglia in the central nervous system (CNS) and peripherally infiltrating immune cells contribute to the degeneration of dopaminergic neurons. However, how the peripheral immune system leads to neuron loss and whether blocking this response slows disease progression remain largely unknown. Triggering receptor expressed on myeloid cells-1 (TREM-1), a key regulator of inflammation, plays a significant role in the pathogenesis of infection and noninfection-related inflammation. However, the specific role of TREM-1 in PD has not yet been determined. Therefore, the aim of this study was to determine the immune regulation mechanism of monocyte TREM-1 on dopaminergic neurons and motor function in PD.

Methods

First, we evaluated TREM-1 expression and monocyte infiltration in the substantia nigra pars compacta (SNpc) in a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine hydrochloride (MPTP)-related neurotoxic model of PD by western blot, qRT-PCR, and flow cytometry. Second, we determined the level of TREM-1 and the extent of dopaminergic neuronal injury in the SNpc after the depletion of peripheral monocytes. Motor function was assessed by the open field test, pole test, and rotarod test. Third, to determine the actual role of TREM-1 in the PD, we analyzed the effects of TREM-1 inhibition on monocytes infiltration. Assays examining dopaminergic neuron degeneration and neuroinflammation include immunofluorescence, western blot, and qRT-PCR. To corroborate the dopaminergic terminal loss in the striatum we quantified the concentration of dopamine in the striatum using High-performance liquid chromatography (HPLC). Additionally, we conducted an adoptive transfer of TREM-1-producing monocytes from PD model mice to investigate whether monocytes induce dopaminergic neuron injury and motor dysfunction in a TREM-1-dependent manner.

Results

MPTP administration successfully induced subacute PD model and increased peripheral blood inflammatory monocyte levels. Deletion of peripheral monocytes protected against MPTP neurotoxicity in the SNpc. TREM-1 inhibition genetically or pharmacologically dampens the peripheral innate response, reduces the accumulation of infiltrating monocytes, and efficiently prevents dopaminergic neuron injury in the SNpc. Adoptive transfer of TREM-1-producing monocytes from PD model mice was sufficient to induce dopaminergic neurons and motor deficits in naive mice.

Conclusion

These results indicate the critical role of peripheral monocytes in the pathogenesis of PD and suggest that inhibiting monocyte TREM-1 expression is a promising therapeutic approach for the degeneration of dopaminergic neurons in the SNpc in PD patients.

Biological sciences/Immunology/Innate immune cells/Monocytes and macrophages

Biological sciences/Neuroscience/Neuroimmunology

Parkinson's disease

SNpc

Monocyte/macrophage

Peripheral inflammation

Parkinson's disease (PD) is the second most common neurodegenerative disorder. The pathological hallmark of PD is the progressive loss of dopaminergic neurons in the substantia nigra pars compacta (SNpc)[1], which results in extrapyramidal system dyskinesia accompanied by manifestations of resting tremor, rigidity, and postural bradykinesia. Although the pathogenesis of PD is poorly understood, mounting evidence indicates that inflammation plays a crucial role in the development of PD[2, 3]. The central nervous system (CNS) was previously considered an immune-privileged system, but in recent years, it has become increasingly evident that the CNS communicates extensively with the peripheral immune system[4]. Numerous studies support a deleterious role of peripheral inflammation in PD, such as elevated levels of inflammatory cytokines in body fluids [5–7] and aberrant functions and proportions of lymphocytes[8, 9] and monocytes[10–12]. Myeloid cells, including monocytes, are the pivotal regulatory cells of the immune system[13]. Considering the various phenotypes of monocytes at different states, the exact role of monocytes during PD may differ. Under physiologically normal conditions, the CNS is isolated from the periphery by the blood-brain barrier (BBB), and monocytes may also gain access to the brain parenchyma under certain disease conditions[14]. Immediately after the BBB is compromised, monocytes migrate into the brain parenchyma and differentiate into macrophages to mediate pro and anti-inflammatory responses[15–17].

Triggering receptor expressed on myeloid cells-1 (TREM-1), which is prominently expressed on the surface of neutrophils, subsets of monocytes, and macrophages, functions as an inflammation amplifier and plays a vital role in innate and adaptive immunity[18]. Under diverse inflammatory conditions, the expression of TREM-1 is upregulated[19–21]. This TREM-1-mediated enhancement of the proinflammatory immune response has been demonstrated in several models of infection, inflammatory bowel disease[20, 22, 23], septic shock[24], and sepsis syndrome[25], it is also critical in some sterile inflammatory conditions, including atherosclerosis[26], postischemic myocardial remodeling[27], abdominal aortic aneurysm[28], and rheumatoid arthritis[29]. Previous studies have shown that therapeutic inhibition of TREM-1 can blunt excessive inflammatory cell infiltration, resulting in a decreased severity of liver injury[30] and abdominal aortic aneurysm[28].

In the present study, we explored the new role of TREM-1 in a mouse model of PD. We presented novel findings regarding the impact of TREM-1 gene deletion and pharmacological blockade on the recruitment of Ly6C^hi classical inflammatory monocytes into the SNpc and the subsequent attenuation of dopaminergic neuron loss. Thus, our study underscores the contribution of peripheral inflammation to the degeneration of dopaminergic neurons in PD model mice and identifies monocyte TREM-1 as a new factor in the pathophysiology of PD, which may constitute a novel systemic therapy for PD patients.

Animals

Male TREM-1 knockout (B6/JGpt-Trem1^em1Cd60266026/Gpt) mice (weighing 25–30 g, 8 weeks old) on a C57BL/6J genetic background were generated by Gempharmatech Corporation (Nanjing, China). Male wild-type (WT) C57BL/6J mice were purchased from Changzhou Cavens Laboratory Animal Corporation (Changzhou, China). All mice were housed in a temperature-controlled room (at 22 ± 1°C and 40–60% relative humidity), with a 12/12-h light/dark cycle, and permitted free access to food and water. All animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The protocol was preapproved by the Institutional Animal Care and Use Committee of Xuzhou Medical University.

Drugs and treatments

For MPTP intoxication, C57BL/6J mice received intraperitoneal injections of MPTP (30 mg/kg) (MedChemExpress, Shanghai, China) dissolved in 0.9% saline on 5 consecutive days. The control mice were injected with an equivalent volume of saline only; For pharmacological blockade of TREM-1, as previously described[31], the TREM-1 blocking peptide LQVTDSGLYRCVIYHPP (LP17) was chemically synthesized by GenScript (Nanjing, China). Starting on Day 0 (at the beginning of MPTP injection), the mice were treated with either an LP17 peptide or a sequence-scrambled control peptide TDSRCVIGLYHPPLQVY. Given the short half-life of peptides in vivo, mice were treated once daily with 1 mg/kg peptide and administered intranasally in 200 µl of saline[32]. For the monocyte depletion experiments, the mice were treated as follows. Monocytes were depleted by tail vein injection of 200 µl of clodronate liposome (CLP) or PBS liposomes into each mouse every 2 days. These mice were sacrificed at 7 days after the first MPTP injection (Fig. 2f).

Antibodies and chemicals

All primary and secondary antibodies used in the present study are listed in Table 1 and Table 2. BCA protein assay kits were from Beyotime (P0012, China). 1-methyl-4-phenylpyridinium (MPP) ion MPP⁺ (36913-39-0) and dopamine hydrochloride (62-31-7) standards (with purities higher than 95% according to HPLC) were purchased from Weikeqi Biotech (China). LP17 (887255-16-5) standards (with purities higher than 95% according to HPLC) were purchased from Macklin Biochemical (China).

Table 1
Primary antibodies
Name of Antibody	Host	Fluorochrome	Manufacturer, Catalog Number	Application	Working dilutions or concentrations
CD45	Mouse	APC	BioLegend, 103112	Flow Cytometry	1:200
CD11b	Mouse	FITC	Biolegend, 101206	Flow Cytometry	1:500
Ly6G	Mouse	PE	Biolegend, 127608	Flow Cytometry	1:200
Ly6G	Mouse	Percp-cy5.5	Biolegend, 127616	Flow Cytometry	1:200
Ly6C	Mouse	Percp-cy5.5	Biolegend, 128012	Flow Cytometry	1:200
Ly6C	Mouse	BV605	Biolegend, 128035	Flow Cytometry	1:200
CX3CR1	Mouse	PE-cy7	Biolegend, 149016	Flow Cytometry	1:200
TREM-1	Mouse	PE	Invitrogen, MA5-28221	Flow Cytometry	1:400
Iba1	Mouse	-	Wako, 019-19741	IF	1:500
Hexb	Rabbit	-	AbD Serotec, MCA1957GA	IF	1:200
TH	Mouse	-	Abcam, ab217161	IF	1:400
TH	Mouse	-	Abcam, ab217161	WB	1:2000
TNF-α	Rabbit	-	Proteintech, 1590-1-AP	WB	1:1000
TREM-1	Mouse	-	Novusbio	WB	1:500
IL-1β	Rabbit	-	Proteintech, 26048-1-AP	WB	1:1000
IL-6	Rabbit	-	Proteintech, 260489-1-AP	WB	1:1000
β-actin	Rabbit	-	Proteintech, 66009-1-Ig	WB	1:2000
Tubulin	Rabbit	-	Affinity, DF7967	WB	1:3000

Table 2
Secondary antibodies
Antibody	Host	Manufacturer	Catalog Number	Application	Working dilutions or concentrations
Anti-rabbit IgG, HRP	Goat	Proteintech	SA00001-2	WB	1:2000
Anti-mouse IgG, HRP	Goat	Proteintech	SA00001-1	WB	1:2000
Anti-rabbit IgG, Alexa 594	Donkey	Invitrogen	A21207	IF	1:600
Anti-mouse IgG, Alexa 488	Donkey	Invitrogen	A21202	IF	1:400

Behavior tests

Open field test (OFT)

Motor behavior was analyzed in an open field test 5 days after intraperitoneal injection of MPTP. The open field device consisted of a square area with a surrounding wall. Approximately 1 h before the experiment, the mice were transferred to the laboratory for adaptation. Mice were then placed into the center of an open field device with evenly distributed light for 5 minutes. During the test, the total distance traveled was automatically recorded by ANY-Maze software over a 5-min period.

Rotarod test

Mouse motor coordination was assessed by the rotarod test as previously described[33]. The training was carried out for 3 consecutive days before the administration of MPTP until no fall was detected within 300 s. Mice were gently returned to the rod during training if they slipped off. During the experiment, all the mice walked on the rod steadily from 5 rpm to 40 rpm in 300 s. The latency to fall off the rod was recorded up to a maximum of 300 s.

Pole test

To evaluate the severity of bradykinesia, the pole test was performed according to previous methods[34]. The mice were trained three times to correctly descend from the top to the bottom of the pole (75 cm in length and 1 cm in diameter) before the establishment of the model. The time needed to reach the bottom of the pole was recorded during the test. The mice were subjected to three trials at 30-minute intervals. The results from three trials were averaged.

Immunofluorescence (IF)

After the behavioral tests, whole-brain tissues were collected, perfused with 4% paraformaldehyde for 24 h, and subsequently dehydrated with 30% sucrose solution for 48 h. Thirty-micron-thick coronal sections containing the SNpc were collected with a freezing microtome (CM1800, Leica, Germany) for immunofluorescence staining. The cryosections were washed with 0.1% Triton X-100 in PBS for 10 min and blocked with 10% goat serum for 1 h at room temperature (RT). The sections were then incubated with primary antibodies against tyrosine hydroxylase (TH), Iba-1, and hexosaminidase subunit beta (Hexb) overnight at 4°C. The sections were then incubated with the appropriate secondary antibodies. DAPI (Beyotime, China) was used to stain the cell nuclei. Images were taken with a fluorescence microscope (Olympus, Tokyo, Japan). Immunofluorescence revealed that dopaminergic neurons in the SNpc were visible in different groups. Density analysis was performed using previously reported methods[35]. Briefly, we counted the mean number of TH-positive neurons in three consecutive SNpc sections per mouse via light microscopy. Using ImageJ software, the total area of the SNpc was obtained, and the density of dopaminergic neurons in the SNpc was subsequently calculated as the number of TH-positive neurons per area (mm²), quantified using ImageJ for each field and each section. Two blinded observers assessed each section manually and then the results were used for statistical analyses.

Western blot (WB)

Whole SNpc tissues extracted from brains were homogenized in RIPA lysis buffer supplemented with protease inhibitors. After 15 minutes of centrifugation at 12,000 rpm at 4°C, the supernatant (namely, the total protein) was collected. A BCA protein assay kit (Beyotime, China) was used to determine the protein concentrations. Equal amounts of precipitated protein samples were loaded, separated by SDS–PAGE, transferred onto the same PVDF membrane, and blocked for 1 h at RT with 5% milk in Tris-buffered saline with 0.1% Tween-20 (TBST). Then, the membranes were incubated with different primary antibodies against TH, TREM-1, interleukin-6 (IL-6), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α) overnight at 4 ℃. After washing, the membranes were incubated with HRP-conjugated secondary antibodies at RT for 1 h. The target protein signal was detected and digitized using an enhanced chemiluminescence system (Bio-Rad, USA). Densitometric quantification of the bands was performed with ImageJ software (NIH, USA).

Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Fresh mouse SNpc was extracted and placed in a nuclease-free Eppendorf (EP) tube containing an appropriate amount of lysate. The homogenate was thoroughly sonicated on ice, and total RNA was extracted from the nigra according to the instructions of the RNA purification kit (Sangon Biotech, China). The nucleic acid concentration of the RNA was measured using the HiScript Q RT SuperMix for qPCR (+ gDNA wiper) kit (Vazyme, China) to prepare a reverse transcription reaction solution and using a reverse transcription instrument to reverse record the RNA preparation into cDNA. Using cDNA products as templates, real-time PCR amplification of cDNA was performed using specific primers and ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) reagent on a Thermo Fly QuantStudio 7 Flex.

The reaction conditions were as follows: 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 60 seconds, and 60°C for 60 seconds for 40 cycles. Melting curve analysis was performed to determine the specificity of the amplified products. All the reactions contained the same amount of cDNA. The CT method (2^−△△Ct) was used to measure the relative expression of IL-6, IL-1β, and TNF-α, which was normalized to the expression of the β-actin and Gapdh genes.

TREM-1; Forward primer (5'->3'): CCCTGGTGGTCACACAGAG, Reverse prime (5'->3'): GCCTCACTAGGGTCATGTTTC

IL-6; Forward primer (5'->3'): ACAGAAGGAGTGGCTAAGGA; Reverse prime (5'->3'): AGGCATAACGCACTAGGTTT

IL-1β; Forward primer (5'->3'): TGGTGTGTGACGTTCCC; Reverse prime (5'->3'): TGTCCATTGAGGTGGAGAG

TNF-α; Forward primer (5'->3'): GCAAAGGGAGAGTGGTCA; Reverse prime (5'->3'): CTGGCTCTGTGAGGAAGG

β-actin; Forward primer (5'->3'): GGGAAATCGTGCGTGAC; Reverse prime (5'->3'): AGGCTGGAAAAGAGCCT

Gapdh; Forward primer (5'->3'): AAGAAGGTGGTGAAGCAGG; Reverse prime (5'->3'): GAAGGTGGAAGAGTGGGAGT;

Flow Cytometry and Cell Sorting

Whole SNpc tissues extracted from the brain were prepared as single-cell suspensions with some modifications. In brief, SNpc tissues were digested at 37°C with DNAse I (VIC115, Vicmed) and collagenase type II (VIC080, Vicmed) in RPMI 1640 under agitation (200 rpm) for 60 min. The cells were filtered through a 100-µm cell strainer and then suspended in PBS containing 2% (wt/vol) FBS. Peripheral blood was obtained from mice by cardiac puncture, and a single-cell suspension of peripheral blood was prepared with ACK lysis buffer (KGP11100, KeyGen). After intensive washing, the cells were labeled with fluorochrome-conjugated surface marker antibodies for fluorescence-activated cell sorting (FACS) analysis. The data were analyzed with a FACSCanto II (BD Biosciences, USA), and the percentage of each cell population and mean fluorescence intensity (MFI) were analyzed using FlowJo Ⅹ software (TreeStar, Inc.). Forward scatter (FSC) and side scatter (SSC) were used to gate live cells, excluding red blood cells, debris, cell aggregates, and doublets. The following antibodies were used to identify monocytes/macrophages (Mo/MΦs). In the blood, Ly6C^hi classical monocytes were identified as CD45⁺/CD11b⁺/Ly6G⁻/Ly6C^hi. In the brain, infiltrating Mo/MΦs were identified as CD45⁺/CD11b⁺/Ly6G⁻/CX3CR1⁺/Ly6C⁺[36]. The absolute count of cells was determined by flow cytometry using Counting Beads (424902, Biolegend). Ly6C-positive cells were enriched after the isolation of single cells from the blood of mice as described above[37]. The cells were stained with the fluorochrome-conjugated antibodies described above and sorted using a FACSAria Fusion cell sorter (BD Biosciences USA). The sorted cells were subsequently subjected to adoptive transfer experiments.

Enzyme‑linked immunosorbent assay (ELISA)

After anesthetization, blood was collected from the right atrium, drawn into a heparinized centrifuge tube and centrifuged at 1000× g for 20 min. The levels of soluble TREM-1 (sTREM-1), IL-6, IL-1β, and TNF-α were measured using an established ELISA kit (JL 18245, J&L Biological, China; BR6000009, BR5210104, and BR6000087, Bioleaper, China) according to the manufacturer’s instructions.

High-performance liquid chromatography (HPLC) analysis

The levels of dopamine in the striatum were measured using an HPLC apparatus as described previously[38]. Briefly, mice were sacrificed by decapitation and the striatum was quickly removed on ice. The striatum was subsequently weighed and homogenized in perchloric acid (HClO₄) (0.1 mol/L). After full lysis, the samples were centrifuged at 10,000 × g (4°C) for 20 min, after which the supernatants were collected. The dopamine content in the SNpc was measured using HPLC and is expressed as ng/mg equivalent of striatal tissue.

Statistical analysis

The data are expressed as the mean ± SEM and all the statistical analyses were performed using GraphPad Prism V 9.0. Student’s t test was used for comparisons between two groups. One-way analysis of variance (ANOVA) or two-way ANOVA with Tukey’s multiple-comparison test was performed for multiple comparisons. Pearson’s correlation test was applied for correlation analysis. Significance levels are indicated as follows: * P < 0.05, ** P < 0.01, *** P < 0.001, and not significant (n.s.).

MPTP administration causes dopaminergic neuron injury in the SNpc and motor dysfunction

We established a subacute PD mouse model by intraperitoneal injection of MPTP (30 mg/kg for 5 consecutive days), and a series of behavioral assessments such as OFT, rotarod test, and pole test were performed on Day 1 after the last MPTP injection to detect motor dysfunction (Fig. 1a). The substantia nigra is located in the midbrain posterior to the cerebral peduncle and is divided into

the SNpc and the substantia nigra pars reticulata (SNpr). Dopaminergic neurons reside mainly in the SNpc and VTA[39] (Fig. 1b, c). Tyrosine hydroxylase is the rate-limiting enzyme in the biosynthesis of dopamine and can be defined as a marker of dopaminergic neurons. To evaluate dopaminergic neuron damage, we quantified the number of TH-positive cells and dopamine levels at 7 days after MPTP injection. Both the number of TH-positive neurons (Fig. 1d, e) and the TH protein levels (Fig. 1f, g) were significantly lower in the MPTP group than in the control group. Similarly, striatal dopamine levels were significantly lower in MPTP-injected mice than in control (N + Sal) mice (Fig. 1h), as measured via HPLC. Mice injected with MPTP exhibited decreased locomotor activity. In contrast to those in the naive and saline groups, the MPTP-injected mice traveled shorter distances in the OFT (Fig. 1i, j) and had a significantly shorter latency to fall in the rotarod test (Fig. 1k, l). In the pole test, MPTP injection resulted in an increase in the time taken to reach the bottom (Fig. 1m, n). These results indicated that the MPTP-induced PD model was successfully established in mice.

Monocytes are needed for dopaminergic neuron and behavioral deficits in PD model mice

We next investigated whether the dopaminergic neuron injury in the SNpc and motor dysfunction in PD model mice require the involvement of monocytes. Monocytes are a subset of myeloid cells that play critical roles in the peripheral immune system[13]. Under several diseases conditions, monocytes can infiltrate the brain parenchyma[16]. To evaluate the activation status of innate immune cells in PD model mice, we first examined the resident and infiltrating Mo/MΦs in the SNpc. Recent massive single-cell analyses revealed that Hexb is exclusively expressed in brain microglia but not in Mo/MΦs[37, 40]. Importantly, this newly defined microglia-specific gene identified Hexb as a stably expressed microglial core gene during homeostasis and disease, Iba1 is a calcium-binding protein both expressed in microglia and Mo/MΦs. Double-staining allows visualization of infiltrating Mo/MΦs in brain based on their expression of Iba1 and lack of colocalization with Hexb, green fluorescence indicates infiltrating Mo/MΦs (white arrow). Our results revealed that infiltrating Mo/MΦs were present in the SNpc of PD model mice (Fig. 2a). Flow cytometry was used to determine the proportions and numbers of infiltrating Mo/MΦs in the SNpc of these mice. In these studies, we used CD45, CD11b, CX3CR1, Ly6C, and Ly6G as markers to reliably discriminate microglia (CD45⁺/CD11b⁺/Ly6G⁻/CX3CR1⁺) from infiltrating monocytes (CD45⁺/CD11b⁺/Ly6G⁻/CX3CR1⁺/Ly6C⁺). Full gating strategies from representative plots are shown in Supplementary Fig. S9 gating strategy .

We found that both the proportion and number of Ly6C⁺ Mo/MΦs were increased in the SNpc (Fig. 2b, c) and that Ly6C^hi monocytes were also detected at a greater frequency in the peripheral blood of PD model mice than in that of control mice (Fig. 2d, e; Supplementary Fig. S1a). To determine whether peripheral monocytes result in dopaminergic neuron and behavioral deficits in PD patients, we performed in vivo monocyte depletion using CLP (Fig. 2f). Flow cytometry analysis revealed a marked decrease in proinflammatory monocytes in the peripheral blood of the PD model mice that received CLP (Fig. 2g, h). The nondepleted control group received clodronate or PBS injection, which did not cause apparent infection or motor deficit. We found that saline-injected mice that received PBS liposomes or CLP behaved normally. However, compared with PD model mice, PD model mice that received CLP traveled more of a distance than PD model mice that received PBS liposomes (Fig. 2i); moreover, compared with PD model mice that received CLP, PD model mice that received PBS liposomes had a significantly decreased latency to fall in the rotarod test (Fig. 2j). Similarly, the PD model mice that underwent CLP exhibited a decrease in the time taken to reach the bottom in the pole test (Fig. 2k). Consistent with these changes in behaviors, the PD model mice received CLP presented a greater number of dopaminergic neurons than the PD model mice (Fig. 2l, m). MPTP toxicity depends on the enzymatic conversion of MPTP to MPP⁺ by monoamine oxidase. To exclude the possibility that the administration of CLP affects MPTP metabolism, we measured striatal MPP⁺ levels 90 min after MPTP application. Similar levels of MPP⁺ were observed in PBS liposome-treated mice and CLP-treated mice, indicating that MPTP metabolism was not influenced by CLP treatment (Supplementary Fig. S4b). These results indicated that peripheral monocytes mediate dopaminergic neuron injury and motor dysfunction in PD model mice.

TREM-1 was elevated in peripheral infiltrating monocytes in the SNpc

To investigate whether TREM-1 contributes to the progression of PD, we detected the expression of TREM-1 in the SNpc. We found that sTREM-1 in the plasma was significantly increased (Fig. 3a). Flow cytometry revealed a marked increase in the TREM-1 MFI in infiltrating CD45⁺/CD11b⁺/Ly6C⁺ Mo/MΦs in the SNpc of PD model mice (Fig. 3b, c). Consistent with these data, WB and qRT-PCR analyses indicated that the expression of TREM-1 was significantly greater in PD model mice than in control mice (Fig. 3d-f). These results revealed the possible involvement of TREM-1 in PD pathogenesis. Regulating the peripheral immune response with agents that target TREM-1 may be useful for improving PD progression.

Monocytes contribute to the increase in TREM-1 and proinflammatory cytokine levels in the SNpc

These results suggest that peripheral blood monocytes are critical for MPTP-induced dopaminergic neuron and motor deficits. To explore the molecular mechanisms mediated by monocytes, we first measured the protein levels of proinflammatory cytokines in the SNpc of PD model mice. WB and qRT-PCR analyses confirmed that, compared with those in the naive and saline groups, the PD model mice exhibited significantly greater IL-6, IL-1β, and TNF-α concentrations (Fig. 4a-c). The correlation analysis showed a significant correlation between the inflammatory cytokines (IL-1β, IL-6, and TNF-α) in the Snpc and motor deficit (Supplementary Fig. S2). To determine whether monocytes are needed for the MPTP-induced increase in TREM-1 levels in the SNpc, we performed WB analysis in mice that were depleted of monocytes. Our study revealed significantly lower amounts of TREM-1 (Fig. 4d-f) and proinflammatory cytokines in PD model mice depleted of monocytes by CLP than in mice with intact peripheral immune cells (Fig. 4g-i). These results suggested that monocytes are needed to increase TREM-1 levels in the SNpc and amplify neuroinflammation in PD model mice.

TREM-1 knockout alleviates neuroinflammation, dopaminergic neuron injury, and motor dysfunction in PD model mice

We next tested the contribution of TREM-1 expressed on myeloid cells in general to PD incidence. We took advantage of mice deficient in TREM-1 in the myeloid lineage (Fig. 5a, b). Five days after the first MPTP injection, the remaining TH-positive dopaminergic neurons in the SNpc were assessed by immunofluorescence. Our data shows that TREM-1 knockout did not affect dopamine neurons and inflammatory cytokines in normal mice (Supplementary Fig. S5). The mice treated with MPTP exhibited a significant loss of TH-positive neurons in the SNpc. In contrast, Trem-1^−/− mice injected with MPTP were protected against MPTP-induced neurodegeneration (Fig. 5c, d). By knocking out the TREM-1 gene we observed a significant increase in TH levels in SNpc (Fig. 5e, f) and striatal dopamine levels (Fig. 5g), this alteration notably alleviated motor dysfunction in PD model mice, as evidenced by their improved performance on behavioral tests including the OFT, pole test, and rotarod test (Fig. 5h-k). Flow cytometry analysis revealed a significant decrease in the infiltration of Mo/MΦs in the SNpc of Trem-1^−/− mice injected with MPTP (Fig. 5l, m; Supplementary Fig. S1b). These results indicated that TREM-1 mediated the infiltration of peripheral circulating monocytes in the SNpc. We assessed the effect of genetic ablation of TREM-1 on inflammatory cytokine expression. Compared with those in Trem-1^−/− mice, the release of the proinflammatory cytokines IL-6, IL-1β, and TNF-α in the SNpc was markedly greater in MPTP-treated mice (Fig. 5n-p).

Pharmacological neutralization of TREM-1 reduces the production of inflammatory cytokines, alleviates dopaminergic neuron injury, and ameliorates motor dysfunction

The induction of TREM-1 suggested that systemic targeting of TREM-1 might alleviate peripheral immune responses and reduce MPTP toxicity. Accordingly, we tested whether the decoy peptide LP17 (Fig. 6a), an inhibitor of TREM-1[41], might attenuate the immune amplification of TREM-1. The LP17 blocking peptide was identified as a competitive antagonist of membrane-bound TREM-1 for its natural ligand[42]. A previous study showed that human monocytes treated with LP17 in vitro attenuated the LPS-induced induction of inflammatory cytokines, indicating the ability of LP17 to block cellular TREM-1[43]. Further studies have suggested that in vivo treatment with LP17 improves outcomes in sepsis[43, 44], inflammatory bowel disease[45], and cancer[46]. First, we investigated the effect of LP17 on the trafficking of monocytes to the SNpc of PD model mice. We found that the administration of LP17 during MPTP injection reduced the number of brain-infiltrating Mo/MΦs (Fig. 6b, c; Supplementary Fig. S1c). The expression of TREM-1 was markedly decreased in LP17-treated mice (Fig. 6d-h). Consistent with the results above, inflammatory cytokine expression was detected via WB and qRT-PCR in all the groups, and LP17-treated mice partially prevented the MPTP-induced release of IL-1β, IL-6, and TNF-α (Fig. 6i-k). Our study revealed that LP17 treatment also increased striatal dopamine levels (Fig. 6l) and attenuated MPTP-induced dopaminergic neuron loss (Fig. 6m, n) and motor dysfunction (Fig. 6o-r). After the pharmacologic blockade of TREM-1 with the synthetic peptide LP17, the inflammatory response in the SNpc and dopaminergic neuron injury were substantially alleviated. LP17 was similarly intranasally administered as described previously[32]. LP17 was labeled with rhodamine according to previous methods[32]. We showed that intranasally injected LP17 could penetrate the brain (Supplementary Fig. S3a). In addition, LP17 levels were determined by HPLC from SNpc (Supplementary Fig. S3b). We believe the LP17 reached an effective therapeutic concentration in the brain and the expression of TREM-1 was effectively inhibited. Intranasal drug administration is an efficient and noninvasive method for bypassing the BBB and rapidly targeting various chemicals or peptides to the brain, which is valuable for clinical translation[47]. To exclude the possibility that the protective effect of LP17 was due to alterations in MPTP metabolism, we measured the MPP⁺ concentration via HPLC and found that intranasal administration of LP17 did not affect the concentration of MPP⁺, the metabolite of MPTP, in the striatum (Supplementary Fig. S4a).

Infiltrating peripheral monocyte TREM-1 mediates dopaminergic neuron injury and neuroinflammation in PD model mice

Given that monocytes are needed for dopaminergic neuron injury, motor dysfunction, and elevated TREM-1 levels in the SNpc, the pathogenesis of PD model mice is likely mediated by peripheral monocytes through TREM-1 signaling. Therefore, we next explored whether monocytes induce dopaminergic neuron injury and motor deficits in a TREM-1-dependent manner.

In this study, we collected monocytes from the peripheral blood of WT and Trem-1^−/− mice after MPTP injection and sorted the cells based on the surface expression of CD45, CD11b and Ly6C by FACS (Fig. 7a). The naive mice were intravenously injected with 3 × 10⁶ sorted CD45⁺/CD11b⁺/Ly6C⁺ and CD45⁺/CD11b⁺/Ly6C⁺ cells (Fig. 7b). Five days after sorted cell transfer, we observed a substantial decrease in the number of dopaminergic neurons in naive mice that received Ly6C⁺ cells from PD model mice compared to that in naive mice that received Ly6C⁻ cells from PD model mice. Notably, there were no differences in the number of dopaminergic neurons in naive mice that received Ly6C⁺ cells collected from Trem-1^−/− PD model mice (Fig. 7c, d). We also found that the expression of TREM-1 was significantly increased in the naive mice that received Ly6C⁺ cells from PD model mice (Fig. 7e-g). We subsequently detected inflammatory cytokine expression in the SNpc and serum, and compared with naive mice injected with Ly6C⁻ cells, naive mice injected with Ly6C⁺ cells exhibited markedly increased levels of IL-6, IL-1β, and TNF-α (Fig. 7h-j, Supplementary Fig. S6). These results support the theory that TREM-1 is an inflammatory response amplifier and suggest that the administration of TREM-1-producing monocytes alone is sufficient to induce dopaminergic neuron injury and neuroinflammation in PD model mice.

Accumulating evidence highlights the involvement of innate immune cells in PD, but the neuroimmune mechanisms underlying the infiltration of monocytes into the SNpc in PD remain unclear. Taken together, the results of our study indicate that the amplification of peripheral monocytes by TREM-1 is involved in the aggravation of dopaminergic neurodegeneration in MPTP-induced PD model mice. Genetic ablation of TREM-1 or LP17 blockade prevented the loss of dopaminergic neurons in the SNpc. We presume this effect was predominantly based on the inhibition of the TREM-1-mediated peripheral innate immune response and brain-infiltrating monocytes. These dopaminergic neuron and behavioral deficits were prevented by in vivo deletion of peripheral monocytes or ablation of TREM-1, both of which attenuated the increase in TREM-1 signaling in response to MPTP. Together, our findings reveal the underlying mechanism of neuroinflammation in PD and highlight monocyte TREM-1 signaling as a potential target for attenuating the neurodegeneration effects of PD.

A previous study revealed that the inflammatory component of PD was driven by myeloid cells, including resident microglia and infiltrating peripheral Mo/MΦs[48]. Clinical research has suggested that classical monocytes are enriched in the blood of PD patients[10], and our current study also demonstrated the point that PD monocytes are predisposed to inflammation, as previously mentioned[11]. These findings were confirmed by the results of a series of in vivo experiments. Initially, following the successful establishment of the PD model mice, the number of Ly6C^hi monocytes in the peripheral blood and infiltrating brain Mo/MΦs increased. Concurrently, the levels of inflammatory cytokines (IL-1β, IL-6, TNF-α) in the SNpc also increased. Notably, these changes showed a significant correlation with the behavioral outcomes (OFT, Pole Test, Rotarod). (Supplementary Fig. S2). Moreover, the depletion of peripheral monocytes after CLP could prevent MPTP-induced deterioration of dopaminergic neurons and behavior. CLP is widely used to deplete peripheral Mo/MΦs[49–51]. These results are consistent with previous studies showing that the depletion of peripheral monocytes prevents inflammation and neurodegeneration in a model of PD[52, 53]. Our data demonstrated that treatment with CLP does not impair or enhance the metabolism of MPTP to MPP⁺, providing a reliable model for evaluating neuroprotection induced by CLP injection.

However, the specific molecular mechanisms by which monocyte TREM-1 impairs dopaminergic neurons and motor function have not been determined. In the peripheral immune system, inflammatory cytokines, which are capable of influencing the CNS, are released from the peripheral circulation to the CNS, via multiple routes[54–56]. Two different forms of TREM-1 have been identified: membrane-bound TREM-1 and soluble receptor 1 (sTREM-1). Both the concentration of sTREM-1 in plasma and the expression of TREM-1 in the SNpc increase after MPTP injection, and depletion of peripheral monocytes via CLP prevents the expression of TREM-1 in the SNpc. These results suggest that peripheral TREM-1 can reach the brain parenchyma by crossing the BBB. Previous research has confirmed that MPTP-induced PD model mice exhibit increased BBB permeability[57, 58]. When peripheral monocytes TREM-1 infiltrate in the brain, they can promote the release of proinflammatory cytokines including IL-6, IL-1β, and TNF-α, which ultimately leads to dopaminergic neuron damage. For the first time, we found that TREM-1 is expressed on Mo/MΦ that infiltrates the SNpc of PD model mice. As an amplifier of the inflammatory immune response, once in the brain, we speculate that TREM-1 can be sensed by microglia and that activated microglia can release additional proinflammatory cytokines; in turn, a vicious cycle is formed with persistent neuroinflammation in PD, which leads to dopaminergic neuron injury.

Available genetically modified mice have greatly advanced our understanding of the pivotal role of TREM-1 in disease. This phenomenon is the best exemplified by studies on the role of TREM-1 in stroke treatment. Experiments in which mouse TREM-1 was ubiquitously ablated showed that these mice were protected against intracerebral hemorrhage-induced neurobehavioral deficits, indicating that triggering of TREM-1 on myeloid cells induces a neuroinflammatory response[59, 60]. The latest study using TREM-1 positron emission tomography tracer technology revealed infiltrating myeloid cells in the brains of PD model mice[61]. Despite the different modeling methods used, these results suggest that TREM-1 is involved in the peripheral myeloid-mediated proinflammatory innate immune response, which has implications for our study.

A novel finding of our study was that blockade of TREM-1 after MPTP injection prevents circulating peripheral monocytes from infiltrating the SNpc. Our results revealed that brain-invading Ly6C^hi inflammatory monocytes are drivers of neuroinflammation, dopaminergic neuron injury, and motor dysfunction, which is consistent with the role of TREM-1 in the inflammatory response[62]. Therefore, we inferred that TREM-1 plays a negative role in PD model mice. We speculate that one possibility is that global deficiency of TREM-1 prevents monocyte recruitment by quenching early neuroinflammation, namely, the production of chemokines. Another possible explanation is that TREM-1 is activated by monocytes to migrate to inflammatory sites, and inhibiting TREM-1 signaling directly on monocytes might block their recruitment to the SNpc. The current phenomenon that monocyte brain infiltration and SNpc inflammation are both inhibited by global TREM-1 depletion leads to the fascinating hypothesis that the benefits of TREM-1 antagonism might be largely attributed to blocking monocyte recruitment to the SNpc in PD model mice. Previous research has shown that the TREM-1 protein is expressed by infiltrating Mo/MΦs, not microglia, at the peak of neuroinflammation[63]. These findings further support our proposed theory that peripheral monocyte-derived TREM-1 contributes to PD-related neuroinflammation.

Indeed, we have unexpectedly discovered a population of Ly6C⁺/CX3CR1⁺ monocytes that appear ungated in the TREM1^−/− condition and the LP17 + MPTP condition. This distinct subset of monocytes may have varying roles in the context of the CNS, including inflammatory responses or tissue repair, depending on the environmental conditions. CX3CR1 high monocytes have been shown to infiltrate the injured tissue to differentiate into regenerative macrophages that promote neuronal protection and repair following excitotoxicity-mediated injury [64]. Our findings suggest that inhibition of TREM-1 activity reduces the inflammatory response in the brains of PD model mice, which may facilitate the differentiation of a portion of Ly6C^hi inflammatory monocytes transdifferentiate into CX3CR1⁺/Ly6C low ‘repair’ macrophages in the brain. We have added a supplemental figure (Supplementary Fig. S8) quantifying this population in both the TREM1^−/− and LP17 + MPTP conditions. In our quantitative analysis, we found that approximately 5% of the cells under the TREM1^−/− condition and 2% under the LP17 + MPTP condition are CX3CR1⁺/Ly6C low monocytes. The data sheds light on the frequency of this particular cell population under the experimental conditions we studied. This hypothesis enriches our understanding of the shifting dynamics among monocyte populations in the CNS, depending on the conditions. To probe further into the role of this cell population, it might be necessary to use additional markers for a more accurate identification of these cells and a clearer delineation of their function.

Previously, Feng’s research groups utilized LP17 to knock down TREM-1 expression in a BV2 cell model and partially protected dopaminergic neurons against 6-OHDA[65]. However, our research focused on the regulatory effect of TREM-1 in the SNpc in PD patients and emphasized that TREM-1 expression on infiltrating peripheral monocytes mediates dopaminergic neuronal damage. To clarify the cell type-specific mechanisms involved, we used adoptive cell transfer in the last part of our study to test our hypothesis. Although the results of this study are quite encouraging, it still has some limitations. For adoptive transfer experiments, we primarily relied on functional markers and phenotypic characteristics to differentiate between donor and recipient cells. While the method we employed has proven its efficacy in numerous studies[66, 67], we acknowledge that it does not afford us the precision to delineate the exact proportion of circulating cells originating from the donor versus the recipient. Despite this limitation, the data and insights gleaned from our research remain valuable and informative. We will consider using the CD45.1/CD45.2 system or other methods that can more accurately label and track donor and recipient cells in future research to further enhance the accuracy and reliability of our experiments. In addition, TREM-1 is also expressed by epithelial cells, endothelial cells, lymphocytes, and platelets as previously reported[68–70]. Lymphocytes accumulate and infiltrate the CNS in PD model mice [9, 71], and we detected CD4⁺ lymphocyte infiltration into the SNpc. However, the MFI of TREM-1 expressed on CD4⁺ lymphocytes was very low and there was no significant difference between the control group and the MPTP group (Supplementary Fig. S7). Additional studies are necessary to further explore the inflammatory mechanism of PD mediated by other sources of TREM-1.

In summary, we identified TREM-1 as a key factor contributing to PD pathogenesis through the regulation of both monocyte infiltration and neuroinflammation. Targeting TREM-1 might constitute a novel and very useful therapeutic strategy to limit PD progression.

Figure 8. Schematic diagram of monocyte TREM-1-mediated dopaminergic neuron damage.

The figure illustrates that in experimental MPTP-induced PD model mice, the number of inflammatory monocytes in the peripheral blood increases, after which the monocytes infiltrate the CNS through the BBB. These infiltrating monocytes increase the release of inflammatory cytokines and eventually cause neuronal injury. TREM-1 gene deletion and pharmacological blockade limit inflammatory monocyte recruitment into the SNpc and ameliorate neuroinflammatory events and the loss of dopaminergic neurons.

BBB

blood-brain barrier

CLP

clodronate liposomes

CNS

central nervous system

ELISA

enzyme‑linked immunosorbent assay

Eppendorf

FACS

fluorescence-activated cell sorting

FSC

forward scatter

Hexb

hexosaminidase subunit beta

HPLC

High-performance liquid chromatography

immunofluorescence

IL-1β

interleukin-1β

IL-6

interleukin-6

Parkinson's disease

MFI

mean fluorescence intensity

MPTP

1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine hydrochloride

OFT

open field test

qRT-PCR

quantitative reverse transcription polymerase chain reaction

room temperature

SNpc

substantia nigra pars compacta

SNpr

substantia nigra pars reticulata

SSC

side scatter

tyrosine hydroxylase

TNF-α

tumor necrosis factor-α

TREM-1

Triggering receptor expressed on myeloid cells-1

wild type

Acknowledgement

The authors thank Qian-qian Dai for their technical assistance and emotional support.

Author contributions

All the authors contributed significantly to this work. WS, RH and YMZ conceived and designed the experiments; WS, ZMZ, LLZ, HFS, JRX and XQ performed the experiments; WS wrote the manuscript; and RH and YMZ revised and edited the manuscript. All the authors read and approved the final manuscript.

Funding

These studies were supported by STI2030-Major Projects (2021ZD0203100), grants from the National Natural Science Foundation of China (No. 82271257; No. 82071228), the Xuzhou Science and Technology Planning Project (KC21051), the Natural Science Foundation of Jiangsu Province (BK20221224), the Qing Lan Project, and Open Competition Grant from Xuzhou Medical University (JBGS202202).

Availability of data and materials

The data in this study are available from the corresponding author upon reasonable request.

Ethics approval and consent to participate

Animal protocols were approved by the Institutional Animal Care and Use Committee of Xuzhou Medical University.

Consent for publication

All the authors read and approved the publication of this manuscript.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Poewe W, Seppi K, Tanner CM, Halliday GM, Brundin P, Volkmann J, Schrag AE, Lang AE: Parkinson disease. Nat Rev Dis Primers 2017, 3:17013.
Pradhan S, Andreasson K: Commentary: Progressive inflammation as a contributing factor to early development of Parkinson's disease. Exp Neurol 2013, 241:148-155.
Glass CK, Saijo K, Winner B, Marchetto MC, Gage FH: Mechanisms underlying inflammation in neurodegeneration. Cell 2010, 140:918-934.
McKim DB, Niraula A, Tarr AJ, Wohleb ES, Sheridan JF, Godbout JP: Neuroinflammatory Dynamics Underlie Memory Impairments after Repeated Social Defeat. J Neurosci 2016, 36:2590-2604.
Chen H, O'Reilly EJ, Schwarzschild MA, Ascherio A: Peripheral inflammatory biomarkers and risk of Parkinson's disease. Am J Epidemiol 2008, 167:90-95.
Reale M, Iarlori C, Thomas A, Gambi D, Perfetti B, Di Nicola M, Onofrj M: Peripheral cytokines profile in Parkinson's disease. Brain Behav Immun 2009, 23:55-63.
Qin XY, Zhang SP, Cao C, Loh YP, Cheng Y: Aberrations in Peripheral Inflammatory Cytokine Levels in Parkinson Disease: A Systematic Review and Meta-analysis. JAMA Neurol 2016, 73:1316-1324.
Liu Z, Zhai XR, Du ZS, Xu FF, Huang Y, Wang XQ, Qiu YH, Peng YP: Dopamine receptor D2 on CD4(+) T cells is protective against neuroinflammation and neurodegeneration in a mouse model of Parkinson's disease. Brain Behav Immun 2021, 98:110-121.
Williams GP, Schonhoff AM, Jurkuvenaite A, Gallups NJ, Standaert DG, Harms AS: CD4 T cells mediate brain inflammation and neurodegeneration in a mouse model of Parkinson's disease. Brain 2021, 144:2047-2059.
Grozdanov V, Bliederhaeuser C, Ruf WP, Roth V, Fundel-Clemens K, Zondler L, Brenner D, Martin-Villalba A, Hengerer B, Kassubek J, et al: Inflammatory dysregulation of blood monocytes in Parkinson's disease patients. Acta Neuropathol 2014, 128:651-663.
Bliederhaeuser C, Zondler L, Grozdanov V, Ruf WP, Brenner D, Melrose HL, Bauer P, Ludolph AC, Gillardon F, Kassubek J, et al: LRRK2 contributes to monocyte dysregulation in Parkinson's disease. Acta Neuropathol Commun 2016, 4:123.
Nissen SK, Shrivastava K, Schulte C, Otzen DE, Goldeck D, Berg D, Moller HJ, Maetzler W, Romero-Ramos M: Alterations in Blood Monocyte Functions in Parkinson's Disease. Mov Disord 2019, 34:1711-1721.
Ginhoux F, Jung S: Monocytes and macrophages: developmental pathways and tissue homeostasis. Nat Rev Immunol 2014, 14:392-404.
De Vlaminck K, Van Hove H, Kancheva D, Scheyltjens I, Pombo Antunes AR, Bastos J, Vara-Perez M, Ali L, Mampay M, Deneyer L, et al: Differential plasticity and fate of brain-resident and recruited macrophages during the onset and resolution of neuroinflammation. Immunity 2022, 55:2085-2102 e2089.
Parisi L, Gini E, Baci D, Tremolati M, Fanuli M, Bassani B, Farronato G, Bruno A, Mortara L: Macrophage Polarization in Chronic Inflammatory Diseases: Killers or Builders? Journal of Immunology Research 2018, 2018:1-25.
Zhao M, Tuo H, Wang S, Zhao L: The Roles of Monocyte and Monocyte-Derived Macrophages in Common Brain Disorders. Biomed Res Int 2020, 2020:9396021.
Shapouri‐Moghaddam A, Mohammadian S, Vazini H, Taghadosi M, Esmaeili SA, Mardani F, Seifi B, Mohammadi A, Afshari JT, Sahebkar A: Macrophage plasticity, polarization, and function in health and disease. Journal of Cellular Physiology 2018, 233:6425-6440.
Gao S, Yi Y, Xia G, Yu C, Ye C, Tu F, Shen L, Wang W, Hua C: The characteristics and pivotal roles of triggering receptor expressed on myeloid cells-1 in autoimmune diseases. Autoimmun Rev 2019, 18:25-35.
Wong-Baeza I, Gonzalez-Roldan N, Ferat-Osorio E, Esquivel-Callejas N, Aduna-Vicente R, Arriaga-Pizano L, Astudillo-de la Vega H, Villasis-Keever MA, Torres-Gonzalez R, Estrada-Garcia I, et al: Triggering receptor expressed on myeloid cells (TREM-1) is regulated post-transcriptionally and its ligand is present in the sera of some septic patients. Clin Exp Immunol 2006, 145:448-455.
Schenk M, Bouchon A, Seibold F, Mueller C: TREM-1--expressing intestinal macrophages crucially amplify chronic inflammation in experimental colitis and inflammatory bowel diseases. J Clin Invest 2007, 117:3097-3106.
Siskind S, Brenner M, Wang P: TREM-1 Modulation Strategies for Sepsis. Front Immunol 2022, 13:907387.
Caer C, Gorreja F, Forsskahl SK, Brynjolfsson SF, Szeponik L, Magnusson MK, Borjesson LG, Block M, Bexe-Lindskog E, Wick MJ: TREM-1+ Macrophages Define a Pathogenic Cell Subset in the Intestine of Crohn's Disease Patients. J Crohns Colitis 2021, 15:1346-1361.
Wu K, Liu Y-y, Shao S, Song W, Chen X-h, Dong Y-t, Zhang Y-m: The microglial innate immune receptors TREM-1 and TREM-2 in the anterior cingulate cortex (ACC) drive visceral hypersensitivity and depressive-like behaviors following DSS-induced colitis. Brain, Behavior, and Immunity 2023, 112:96-117.
Bouchon A, Facchetti F, Weigand MA, Colonna M: TREM-1 amplifies inflammation and is a crucial mediator of septic shock. Nature 2001, 410:1103-1107.
Nathan C, Ding A: TREM-1: A new regulator of innate immunity in sepsis syndrome. Nature Medicine 2001, 7:530-532.
Joffre J, Potteaux S, Zeboudj L, Loyer X, Boufenzer A, Laurans L, Esposito B, Vandestienne M, de Jager SC, Henique C, et al: Genetic and Pharmacological Inhibition of TREM-1 Limits the Development of Experimental Atherosclerosis. J Am Coll Cardiol 2016, 68:2776-2793.
Boufenzer A, Lemarie J, Simon T, Derive M, Bouazza Y, Tran N, Maskali F, Groubatch F, Bonnin P, Bastien C, et al: TREM-1 Mediates Inflammatory Injury and Cardiac Remodeling Following Myocardial Infarction. Circ Res 2015, 116:1772-1782.
Vandestienne M, Zhang Y, Santos-Zas I, Al-Rifai R, Joffre J, Giraud A, Laurans L, Esposito B, Pinet F, Bruneval P, et al: TREM-1 orchestrates angiotensin II-induced monocyte trafficking and promotes experimental abdominal aortic aneurysm. J Clin Invest 2021, 131.
Collins CE, La DT, Yang HT, Massin F, Gibot S, Faure G, Stohl W: Elevated synovial expression of triggering receptor expressed on myeloid cells 1 in patients with septic arthritis or rheumatoid arthritis. Ann Rheum Dis 2009, 68:1768-1774.
Nguyen-Lefebvre AT, Ajith A, Portik-Dobos V, Horuzsko DD, Arbab AS, Dzutsev A, Sadek R, Trinchieri G, Horuzsko A: The innate immune receptor TREM-1 promotes liver injury and fibrosis. J Clin Invest 2018, 128:4870-4883.
Xu P, Hong Y, Xie Y, Yuan K, Li J, Sun R, Zhang X, Shi X, Li R, Wu J, et al: TREM-1 Exacerbates Neuroinflammatory Injury via NLRP3 Inflammasome-Mediated Pyroptosis in Experimental Subarachnoid Hemorrhage. Transl Stroke Res 2021, 12:643-659.
Xu P, Zhang X, Liu Q, Xie Y, Shi X, Chen J, Li Y, Guo H, Sun R, Hong Y, et al: Microglial TREM-1 receptor mediates neuroinflammatory injury via interaction with SYK in experimental ischemic stroke. Cell Death Dis 2019, 10:555.
Haque ME, Azam S, Akther M, Cho DY, Kim IS, Choi DK: The Neuroprotective Effects of GPR4 Inhibition through the Attenuation of Caspase Mediated Apoptotic Cell Death in an MPTP Induced Mouse Model of Parkinson's Disease. Int J Mol Sci 2021, 22.
Sun J, Li H, Jin Y, Yu J, Mao S, Su KP, Ling Z, Liu J: Probiotic Clostridium butyricum ameliorated motor deficits in a mouse model of Parkinson's disease via gut microbiota-GLP-1 pathway. Brain Behav Immun 2021, 91:703-715.
Elgueta D, Contreras F, Prado C, Montoya A, Ugalde V, Chovar O, Villagra R, Henríquez C, Abellanas MA, Aymerich MS, et al: Dopamine Receptor D3 Expression Is Altered in CD4+ T-Cells From Parkinson's Disease Patients and Its Pharmacologic Inhibition Attenuates the Motor Impairment in a Mouse Model. Frontiers in Immunology 2019, 10.
Sinner P, Peckert-Maier K, Mohammadian H, Kuhnt C, Draßner C, Panagiotakopoulou V, Rauber S, Linnerbauer M, Haimon Z, Royzman D, et al: Microglial expression of CD83 governs cellular activation and restrains neuroinflammation in experimental autoimmune encephalomyelitis. Nature Communications 2023, 14.
Masuda T, Amann L, Sankowski R, Staszewski O, Lenz M, d´Errico P, Snaidero N, Costa Jordão MJ, Böttcher C, Kierdorf K, et al: Novel Hexb-based tools for studying microglia in the CNS. Nature Immunology 2020, 21:802-815.
Li S, Zhang H, Wang A, Liu Y, Liu H, Yue F, Abulaiti X, Zhang C, Li L: Differentiation of adult human retinal pigment epithelial cells into dopaminergic-like cells in vitro and in the recipient monkey brain. Molecular Medicine 2019, 25.
Yuan L, Liang T-Y, Deng J, Sun Y-G: Dynamics and Functional Role of Dopaminergic Neurons in the Ventral Tegmental Area during Itch Processing. The Journal of Neuroscience 2018, 38:9856-9869.
Shah S, Wong LM, Ellis K, Bodnar B, Saribas S, Ting J, Wei Z, Tang Y, Wang X, Wang H, et al: Microglia-Specific Promoter Activities of HEXB Gene. Frontiers in Cellular Neuroscience 2022, 16.
Luo L, Zhou Q, Chen XJ, Qin SM, Ma WL, Shi HZ: Effects of the TREM-1 pathway modulation during empyema in rats. Chinese med j-peking 2010, 123:1561-1565.
Pelham CJ, Pandya AN, Agrawal DK: Triggering receptor expressed on myeloid cells receptor family modulators: a patent review. Expert opin ther pat 2014, 24:1383-1395.
Gibot S, Kolopp-Sarda MN, Bene MC, Bollaert PE, Lozniewski A, Mory F, Levy B, Faure GC: A soluble form of the triggering receptor expressed on myeloid cells-1 modulates the inflammatory response in murine sepsis. J Exp Med 2004, 200:1419-1426.
Gibot S, Buonsanti C, Massin F, Romano M, Kolopp-Sarda MN, Benigni F, Faure GC, Bene MC, Panina-Bordignon P, Passini N, Levy B: Modulation of the triggering receptor expressed on the myeloid cell type 1 pathway in murine septic shock. Infect Immun 2006, 74:2823-2830.
Kokten T, Gibot S, Lepage P, D'Alessio S, Hablot J, Ndiaye NC, Busby-Venner H, Monot C, Garnier B, Moulin D, et al: TREM-1 Inhibition Restores Impaired Autophagy Activity and Reduces Colitis in Mice. J Crohns Colitis 2018, 12:230-244.
Sigalov AB: A novel ligand-independent peptide inhibitor of TREM-1 suppresses tumor growth in human lung cancer xenografts and prolongs survival of mice with lipopolysaccharide-induced septic shock. Int Immunopharmacol 2014, 21:208-219.
Lobaina Mato Y: Nasal route for vaccine and drug delivery: Features and current opportunities. International Journal of Pharmaceutics 2019, 572.
Raj T, Rothamel K, Mostafavi S, Ye C, Lee MN, Replogle JM, Feng T, Lee M, Asinovski N, Frohlich I, et al: Polarization of the effects of autoimmune and neurodegenerative risk alleles in leukocytes. Science 2014, 344:519-523.
Gliem M, Mausberg AK, Lee JI, Simiantonakis I, van Rooijen N, Hartung HP, Jander S: Macrophages prevent hemorrhagic infarct transformation in murine stroke models. Ann Neurol 2012, 71:743-752.
Ma Y, Li Y, Jiang L, Wang L, Jiang Z, Wang Y, Zhang Z, Yang GY: Macrophage depletion reduced brain injury following middle cerebral artery occlusion in mice. J Neuroinflammation 2016, 13:38.
Ramachandran P, Pellicoro A, Vernon MA, Boulter L, Aucott RL, Ali A, Hartland SN, Snowdon VK, Cappon A, Gordon-Walker TT, et al: Differential Ly-6C expression identifies the recruited macrophage phenotype, which orchestrates the regression of murine liver fibrosis. Proceedings of the National Academy of Sciences 2012, 109.
Harms AS, Thome AD, Yan Z, Schonhoff AM, Williams GP, Li X, Liu Y, Qin H, Benveniste EN, Standaert DG: Peripheral monocyte entry is required for alpha-Synuclein induced inflammation and Neurodegeneration in a model of Parkinson disease. Exp Neurol 2018, 300:179-187.
Yan A, Zhang Y, Lin J, Song L, Wang X, Liu Z: Partial Depletion of Peripheral M1 Macrophages Reverses Motor Deficits in MPTP-Treated Mouse by Suppressing Neuroinflammation and Dopaminergic Neurodegeneration. Front Aging Neurosci 2018, 10:160.
Jeon M-T, Kim K-S, Kim ES, Lee S, Kim J, Hoe H-S, Kim D-G: Emerging pathogenic role of peripheral blood factors following BBB disruption in neurodegenerative disease. Ageing Research Reviews 2021, 68.
Passaro AP, Lebos AL, Yao Y, Stice SL: Immune Response in Neurological Pathology: Emerging Role of Central and Peripheral Immune Crosstalk. Frontiers in Immunology 2021, 12.
Salvador AF, de Lima KA, Kipnis J: Neuromodulation by the immune system: a focus on cytokines. Nat Rev Immunol 2021, 21:526-541.
Chung YC, Kim Y-S, Bok E, Yune TY, Maeng S, Jin BK: MMP-3 Contributes to Nigrostriatal Dopaminergic Neuronal Loss, BBB Damage, and Neuroinflammation in an MPTP Mouse Model of Parkinson’s Disease. Mediators of Inflammation 2013, 2013:1-11.
Chen X, Lan X, Roche I, Liu R, Geiger JD: Caffeine protects against MPTP-induced blood-brain barrier dysfunction in mouse striatum. Journal of Neurochemistry 2008.
Liu Q, Johnson EM, Lam RK, Wang Q, Bo Ye H, Wilson EN, Minhas PS, Liu L, Swarovski MS, Tran S, et al: Peripheral TREM1 responses to brain and intestinal immunogens amplify stroke severity. Nat Immunol 2019, 20:1023-1034.
Lu Q, Liu R, Sherchan P, Ren R, He W, Fang Y, Huang Y, Shi H, Tang L, Yang S, et al: TREM (Triggering Receptor Expressed on Myeloid Cells)-1 Inhibition Attenuates Neuroinflammation via PKC (Protein Kinase C) delta/CARD9 (Caspase Recruitment Domain Family Member 9) Signaling Pathway After Intracerebral Hemorrhage in Mice. Stroke 2021, 52:2162-2173.
Lucot KL, Stevens MY, Bonham TA, Azevedo EC, Chaney AM, Webber ED, Jain P, Klockow JL, Jackson IM, Carlson ML, et al: Tracking Innate Immune Activation in a Mouse Model of Parkinson's Disease Using TREM1 and TSPO PET Tracers. J Nucl Med 2022, 63:1570-1578.
Dantas P, Matos AO, da Silva Filho E, Silva-Sales M, Sales-Campos H: Triggering receptor expressed on myeloid cells-1 (TREM-1) as a therapeutic target in infectious and noninfectious disease: a critical review. Int Rev Immunol 2020, 39:188-202.
DePaula-Silva AB, Gorbea C, Doty DJ, Libbey JE, Sanchez JMS, Hanak TJ, Cazalla D, Fujinami RS: Differential transcriptional profiles identify microglial- and macrophage-specific gene markers expressed during virus-induced neuroinflammation. Journal of Neuroinflammation 2019, 16.
Bellavance M-A, Gosselin D, Yong VW, Stys PK, Rivest S: Patrolling monocytes play a critical role in CX3CR1-mediated neuroprotection during excitotoxicity. Brain Structure and Function 2014, 220:1759-1776.
Feng C-W, Chen N-F, Sung C-S, Kuo H-M, Yang S-N, Chen C-L, Hung H-C, Chen B-H, Wen Z-H, Chen W-F: Therapeutic Effect of Modulating TREM-1 via Anti-inflammation and Autophagy in Parkinson’s Disease. Frontiers in Neuroscience 2019, 13.
Chen Y-S, Lin H-H, Hsueh P-T, Ni W-F, Liu P-J, Chen P-S, Chang H-H, Sun D-S, Chen Y-L: Involvement of L-selectin expression inBurkholderia pseudomallei-infected monocytes invading the brain during murine melioidosis. Virulence 2016, 8:751-766.
Haupeltshofer S, Leichsenring T, Berg S, Pedreiturria X, Joachim SC, Tischoff I, Otte J-M, Bopp T, Fantini MC, Esser C, et al: Smad7 in intestinal CD4+T cells determines autoimmunity in a spontaneous model of multiple sclerosis. Proceedings of the National Academy of Sciences 2019, 116:25860-25869.
Chen LC, Laskin JD, Gordon MK, Laskin DL: Regulation of TREM expression in hepatic macrophages and endothelial cells during acute endotoxemia. Exp Mol Pathol 2008, 84:145-155.
Wu Y, Fang YM, Ding L, Liu X, Francisco NM, Wen J, Liao C, Ma Z, Li Z, Li M, et al: Activation and Regulation of Blood Vdelta2 T Cells Are Amplified by TREM-1(+) during Active Pulmonary Tuberculosis. J Immunol 2018, 200:1627-1638.
Jolly L, Lemarie J, Carrasco K, Popovic B, Derive M, Boufenzer A, Gibot S: Triggering Receptor Expressed on Myeloid cells-1: a new player in platelet aggregation. Thromb Haemost 2017, 117:1772-1781.
Brochard V, Combadière B, Prigent A, Laouar Y, Perrin A, Beray-Berthat V, Bonduelle O, Alvarez-Fischer D, Callebert J, Launay J-M, et al: Infiltration of CD4+ lymphocytes into the brain contributes to neurodegeneration in a mouse model of Parkinson disease.Journal of Clinical Investigation 2008.

(Not answered)

Download PDF

Editorial decision: revise
17 Jul, 2024
Review #3 received at journal
11 Jul, 2024
Reviewer #3 agreed at journal
27 Jun, 2024
Reviewer #2 agreed at journal
25 Jun, 2024
Review #1 received at journal
31 May, 2024
Reviewer #1 agreed at journal
15 May, 2024
Reviewers invited by journal
11 Apr, 2024
Submission checks completed at journal
28 Mar, 2024
First submitted to journal
27 Mar, 2024
Unknown event
27 Mar, 2024
Editor assigned by journal
26 Mar, 2024

You are reading this latest preprint version

Infiltrating Peripheral Monocyte TREM-1 Mediates Dopaminergic Neuron Injury in Substantia Nigra of Parkinson's Disease Model Mice

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Statistical analysis

Results

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1