Unraveling Hypervirulent Klebsiella pneumoniae (hvkp): leveraging the Maga gene as a biomarker for strong biofilm forming hvkp

doi:10.21203/rs.3.rs-4190645/v1

Background

This study aims to distinguish hypervirulent Klebsiella pneumoniae (hvKp) from its classical counterpart (cKp) by utilizing Potassium tellurite agar (PTA) and the String test, with a focus on biofilm formation. The magA gene is investigated as a potential biomarker for identifying robust biofilm-producing hvKp strains, highlighting the significance of this research in addressing the global health threat posed by hvKp.

Methods

From January to December 2022, 102 Klebsiella pneumoniae isolates were collected from patients at AVMC&H, Puducherry. The identification of hvKp was performed using both phenotypic (PTA and the String test) and genotypic methods, including antimicrobial susceptibility testing and 96-well plate biofilm assays. The expression of hvKp-associated genes (rmpA, rmpA2, and magA) was assessed through conventional PCR.

Results

Phenotypic tests identified 28 isolates as hvKp via PTA and 23 through the String test. All rmpA-positive isolates were PTA positive, with 8 also positive in the String test. For rmpA2-positive isolates, 14 were positive in both tests. Fifteen isolates expressed the magA gene, with all showing positivity in the String test and 14 in PTA. Biofilm assays categorized isolates into non-biofilm producers (1.02%), moderate (36.73%), and strong biofilm producers (62.24%). Strong biofilm producers showed resistance to multiple antibiotics.

Conclusions

PTA and the String test are effective in identifying hvKp, with the magA gene serving as a promising biomarker for strong biofilm-producing isolates. The study reveals a concerning trend of antibiotic resistance among biofilm-producing isolates, indicating the potential for hvKp to evolve into a pan-drug-resistant superbug. This underscores the need for heightened global attention to mitigate the threats posed by hvKp.

Hypervirulent Klebsiella pneumoniae

Biofilm

String Test

magA

Potential biomarker

Strong Biofilm Producer

Klebsiella pneumoniae, a Gram-negative bacterium discovered by Edwin Klebs in 1882, is both a benign colonizer and a formidable pathogen, particularly in healthcare settings [1, 2]. Hypervirulent strains of Klebsiella pneumoniae pose additional challenges by affecting individuals not traditionally at risk [3]. Biofilm development significantly influences its pathogenicity and persistence, emphasizing the need for accurate identification of hypervirulent strains [4]. This study focuses on the magA gene as a biomarker for discerning strong biofilm-producing strains, crucial for tailored therapy and infection control. Understanding magA's role in biofilm development could enhance treatment efficacy. Effective diagnosis and management of biofilm-associated illnesses are vital for infection control, particularly in hospitals, where antimicrobial sensitivity in biofilm-producing strains is pivotal for addressing pan-drug resistance. This underscores the urgency for antimicrobial stewardship and innovative treatment options [5, 6].

Klebsiella pneumoniae, a Gram-negative bacterial pathogen, was meticulously isolated from diverse clinical specimens, including pus, urine, sputum, blood, and bronchoalveolar lavage. Throughout a comprehensive study spanning from January 2022 to December 2022, a total of 102 non-repeated samples were judiciously gathered.

Inclusion Criteria:

Only clinical samples exhibiting a culture-positive Klebsiella pneumoniae were considered. Moreover, a meticulous assessment of gram staining was employed, with only those culture-positive Klebsiella pneumoniae samples demonstrating a moderate or abundant presence of pus cells being included in the study.

Exclusion Criteria:

Samples lacking sufficient clinical data were excluded to ensure a comprehensive understanding of the bacterial strains under investigation. Additionally, samples displaying few or no pus cells were omitted from the analysis, thereby focusing on cases with a more pronounced clinical impact.

2.1. Phenotypic Identification of hvKp:

To unveil the hypervirulent Klebsiella pneumoniae (hvKp) phenotypes within our study, we employed two discerning methods: Potassium Tellurite Agar (PTA) and the String test.

Potassium Tellurite Agar (PTA):

This technique involved meticulously preparing a solution by dissolving 0.1 g of potassium tellurite powder in 10 ml of sterile water, followed by filtration through 0.45 µm pore-size membrane filters. Subsequently, 300 µl of the potassium tellurite solution was delicately added to 100 ml of autoclaved and cooled Muller-Hinton agar medium, maintaining temperatures between 45°C to 55°C. The resulting solution was meticulously distributed into sterile plates. After an overnight incubation at 37°C, colonies emerged, and a thorough inspection was conducted. Isolates that developed distinctive black colonies were earmarked as probable hvKp, warranting further exploration [7].

The String Test:

An additional method in our phenotypic arsenal was the String Test, a method that relied on the elongation of a single colony on an agar plate using a bacteriologic loop. Remarkably, any isolates that manifested a viscous string exceeding 5 mm or more in length were hailed as positive, signifying their potential hypervirulent nature [8].

2.2. Antimicrobial Susceptibility Pattern of Klebsiella pneumoniae Isolates:

All isolated strains underwent comprehensive antimicrobial susceptibility testing employing the Kirby Bauer disc diffusion method. Eighteen antimicrobial agents were meticulously assessed, including amoxyclav, amikacin, gentamicin, piperacillin with tazobactum, ciprofloxacin, meropenem, nitrofurantoin, ceftazidime, cefepime, cotrimoxazole, cefotaxime, ofloxacin, imipenem, ceftazidime with clavulanic acid, cefoperazone sulbactam, teicoplanin, aztreonam, and tigecycline (HiMedia Laboratories Pvt Ltd). Adhering to Clinical and Laboratory Standards Institute (CLSI, 2016) recommendations, our diligent assessment categorized the isolates into three distinct groups: sensitive, intermediate, and resistant.

2.3. Quantitative Biofilm Assay

This study utilized a 96-well flat-bottomed plastic tissue culture plate for the biofilm assay. Each strain was assessed by adding 180 µl of LB (Luria-Bertani) broth, supplemented with 1% glucose, into three wells, followed by 20 µl of an overnight bacterial culture. Klebsiella pneumoniae ATCC 13883 served as the positive control, while a sterile LB with 1% glucose was used as the negative control.

Following incubation at 37°C for 18–24 hours, each well was washed three times with phosphate-buffered saline (PBS) and subsequently dried for one hour at 60°C. Biofilm formation was stained using 180 µl of 2% crystal violet for 15 minutes and washed with Sterile water. Post staining, excess dye was removed, and plates were air-dried in an inverted position. The crystal violet bound to the adherent cells was solubilized using 180 µl of 33% acetic acid. The absorbance of the resulting solution was measured at 570 nm using a Synergy spectrophotometer (United States). This assay was replicated four times for accuracy.

The ODc (Optical Density cut-off) value was calculated by averaging the OD (Optical Density) of the negative control and adding thrice the standard deviation (SD) of the negative control. Based on their OD values, the strains were categorized into four groups: non-biofilm producers (OD ≤ ODc), weak (ODc < OD ≤ 2×ODc), moderate (2×ODc < OD ≤ 4×ODc), and strong biofilm producers (4×ODc < OD) [9].

2.4. DNA Extraction

DNA was extracted from the isolates using the Origin DNA extraction kit (Origin, Kerala, India), adhering strictly to the manufacturer's instructions. The concentration and purity of the extracted DNA were determined using a Nanodrop spectrophotometer (Eppendorf, Germany).

2.5. Genotypic Detection of Hypervirulent Klebsiella pneumoniae

The isolates were screened for hypervirulence markers using Polymerase Chain Reaction (PCR). The PCR reaction was carried out in a 10 µl volume containing 5 µl of master mix, 0.5 µl each of forward and reverse primers (as detailed in Table 1), 1.5 µl of template DNA, and 2.5 µl of nuclease-free water. The amplification process was conducted in a Bio-Rad thermal cycler, under optimized conditions.

Table 1

Oligonucleotides used for the detection of hvKp
GENE	PRIMER	SEQUENCE	SIZE (bp)	Reference
rmpA	rmpA-F	ACTGGGCTACCTCTGCTTCA	536	[10]
rmpA	rmpA-R	CTTGCATGAGCCATCTTTCA	536	[10]
rmpA2	rmpA2-F	AAGGGAGAAAGGCGGGAACAG	369	[11]
rmpA2	rmpA2-R	CTTGTAGGTGCCGGGGAAAT	369	[11]
magA	magA-F	CGCCGCAAATACGAGAAGTG	302	[10]
magA	magA-R	TTCCCACTCCCTCTCCAAGT	302	[10]

2.6. STATISTICAL ANALYSIS

Statistical Analysis was rigorously performed using IBM SPSS software. This comprehensive analysis included various correlation and statistical tests relevant to the experiment. The threshold for statistical significance was stringently set, with p-values less than 0.05 being considered indicative of significant results.

3.1. Characterization of Klebsiella pneumoniae Isolates

Through meticulous culture and biochemical analysis, we successfully isolated and confirmed the presence of 102 Klebsiella pneumoniae strains from a variety of clinical samples. This comprehensive approach ensured the accurate identification of these bacterial isolates.

3.2. Phenotypic Identification of Hypervirulent Klebsiella pneumoniae (hvKp)

For the phenotypic identification of hvKp isolates, two distinct methods were employed. Firstly, the string test was utilized (Figure 1), revealing that 23.52% of the isolates (24 out of 102) were positive for hvKp characteristics. Secondly, employing a Potassium tellurite agar (PTA) assay (Figure 2), we identified that 27.45% (28 out of 102) of the isolates exhibited hvKp phenotypes. These methodologies provided a robust framework for the accurate phenotypic identification of hvKp among the isolated strains.

(Figure 1 & 2 place here only )

3.3. Antimicrobial Susceptibility Pattern of Klebsiella pneumoniae Isolates

In this study, we analysed the antimicrobial resistance patterns of 102 Klebsiella pneumoniae isolates, comprising 24 hypervirulent (hvKp) and 78 classical (cKp) strains. The findings are as follows:

Amoxyclav Resistance: Among cKp isolates, 34 showed resistance, and 4 hvKp isolates were also resistant. Amikacin Resistance: Resistance was observed in 15 cKp and 3 hvKp isolates. Gentamicin Resistance: 18 cKp and 1 hvKp isolate exhibited resistance. Piperacillin-Tazobactam Resistance: 20 cKp and 4 hvKp isolates were resistant. Ciprofloxacin Resistance: A notable resistance was seen in 33 cKp and 5 hvKp isolates. Meropenem Resistance: 9 cKp and 3 hvKp isolates showed resistance. Nitrofurantoin Resistance: Found exclusively in 13 cKp isolates. Ceftazidime Resistance: 24 cKp and 3 hvKp isolates were resistant. Cefepime Resistance: 8 cKp isolates exhibited resistance. Ceftriaxone Resistance: Notably, 34 cKp and 4 hvKp isolates were resistant. Cotrimoxazole Resistance: Found in 29 cKp and 2 hvKp isolates. Imipenem Resistance: 3 cKp and 1 hvKp isolate showed resistance. Fosfomycin Resistance: Observed in 2 cKp isolates. Ofloxacin Resistance: 3 cKp isolates were resistant. Ceftazidime-Clavulanic Acid Resistance: 2 cKp and 1 hvKp isolates showed resistance. Cefoperazone-Sulbactam Resistance: 4 cKp and 1 hvKp isolates were resistant. Teicoplanin Resistance: Found in 4 cKp isolates. Aztreonam Resistance: 8 cKp isolates exhibited resistance. Tigecycline Resistance: Found in 1 cKp isolate. Levofloxacin Resistance: 8 cKp and 1 hvKp isolates showed resistance (Figure 3).

3.4. Quantitative Biofilm Assay

The biofilm-producing capabilities of the isolates were quantitatively assessed and categorized based on their final Optical Density (OD) readings. The classification was as follows:

- Non-Biofilm Producers: A minimal percentage of 0.98% (1 out of 102) isolates fell into this category.

- Weak Biofilm Producers: Remarkably, none of the isolates (0% or 0/102) were classified as weak biofilm producers.

- Moderate Biofilm Producers: A substantial 35.29% (36 out of 102) of the isolates were categorized as moderate biofilm producers.

- Strong Biofilm Producers: The majority, accounting for 59.80% (61 out of 102), were identified as strong biofilm producers.

3.5. Genotypic Detection of Hypervirulent Klebsiella pneumoniae (hvKp)

The genotypic analysis confirmed 24 isolates as hvKp. Key findings include:

magA Gene: Detected in 15 isolates, characterized by a 302 bp fragment (as illustrated in Figure 4). rmpA2 Gene: Also found in 15 isolates, identified by a 369 bp fragment (shown in Figure 5). rmpA Gene: Present in 10 isolates, indicated by a 536 bp fragment (depicted in Figure 6).

The specific oligonucleotide sequences used for these detections are detailed in Table 1. Additionally, the conditions employed for the amplification of all genes are thoroughly outlined in Table 2.

Table 2: Conditions for PCR

Gene

Denaturation

Annealing

Extension

Holding

rmpA

95^o C for 5 mints

1 Cycle

95^o C for 30 Seconds

35 cycles

72 ^o C for 5 Minutes

1 cycle

4^oC

53 ^o C for 30 Seconds

72 ^o C for 45 Seconds

rmpA2

95^o C for 5 mints

1 Cycle

95^o C for 30 Seconds

35 cycles

72 ^o C for 5 Minutes

1 cycle

52 ^o C for 30 Seconds

72 ^o C for 45 Seconds

magA

95^o C for 5 mints

1 Cycle

95^o C for 30 Seconds

35 cycles

72 ^o C for 5 Minutes

1 cycle

52 ^o C for 30 Seconds

72 ^o C for 45 Seconds

3.5. STATISTICAL ANALYSIS

Correlation of Phenotypic Methods of hvKp with PCR Results

		PCR				Total N=102		Chi-square value	P value
		Negative N=78		Positive N=24
PTA	Positive	6	7.7%	22	91.7%	28	27.5%	64.984	<0.001*
	Negative	72	92.3%	2	8.3%	74	72.5%
STRING TEST	Positive	1	1.3%	22	91.7%	23	22.5%	85.85	<0.001*
	Negative	77	98.7%	2	8.3%	79	77.5%

Table 3 - Correlation of Phenotypic Methods of hvKp with PCR Results (Placed here only)

Our study conducted a detailed analysis of two phenotypic methods - Potassium Tellurite Agar (PTA) and the STRING TEST - concerning PCR outcomes, revealing significant correlations (Table 3).

Potassium Tellurite Agar (PTA) Analysis:

- Positive Correlation: Among the isolates that tested positive on the PTA, a remarkable 91.7% also showed positive results in PCR, demonstrating a strong concordance between these methods.

- Negative Correlation: Conversely, 7.7% of the PTA-positive isolates were PCR-negative. Additionally, among PTA-negative isolates, a significant 92.3% were also negative in PCR tests, with only 8.3% showing PCR positivity.

- Statistical Significance: The statistical analysis yielded a chi-square value of 64.984. The exceptionally low p-value of <0.001* highlights the robust statistical significance of the correlation between PTA and PCR results.

STRING TEST Analysis:

- Positive Correlation: In the case of the STRING TEST, 91.7% of the isolates that tested positive also exhibited positive PCR results, underscoring a strong agreement between these testing methods.

- Negative Correlation: Only a marginal 1.3% of STRING TEST-positive isolates were PCR-negative. Among the STRING TEST-negative isolates, a substantial 98.7% were also negative in PCR tests, with a small fraction (8.3%) showing positive PCR results.

- Statistical Significance: The chi-square value here was 85.85, reaffirming the significant association between STRING TEST outcomes and PCR results. The p-value of <0.001* further reinforces the statistical significance of this correlation.

Analysis of hyper-virulence Genes in Biofilm-Producing Groups of Klebsiella pneumoniae

		BIOFILM						Total		Chi-square value	P value
		MB (N=36)		NB (N=1)		SB (N=61)		Total		Chi-square value	P value
RMPA	N	32	88.90%	1	100.00%	55	90.20%	88	89.80%	0.155	0.925
RMPA	R	4	11.10%	0	0.00%	6	9.80%	10	10.20%	0.155	0.925
RMPA2	N	31	86.10%	1	100.00%	51	83.60%	83	84.70%	0.292	0.864
RMPA2	R	5	13.90%	0	0.00%	10	16.40%	15	15.30%	0.292	0.864
MAGA	M	0	0.00%	0	0.00%	15	24.60%	15	15.30%	10.743	0.005*
MAGA	N	36	100.00%	1	100.00%	46	75.40%	83	84.70%	10.743	0.005*

Table 4- Analysis of hyper-virulence Genes in Biofilm-Producing Groups of Klebsiella pneumoniae (Place here only)

Our study meticulously analyzed the presence of hyper-virulence genes rmpA, rmpA2, and magA across different biofilm-producing groups, revealing varied patterns of association (Table 4).

rmpA Gene Analysis:

- Moderate Biofilm Group (MB): A significant 88.90% of MB samples exhibited the rmpA gene, with 11.10% lacking it.

- Non-Biofilm Group (NB): Strikingly, 100% of the NB samples tested positive for rmpA, suggesting a notable association.

- Strong Biofilm Group (SB): Here, 90.20% carried the rmpA gene, whereas 9.80% did not.

- Statistical Significance: Despite these findings, the chi-square test indicated a value of 0.155 and a p-value of 0.925, implying that the association between rmpA presence and biofilm production might not be statistically significant.

rmpA2 Gene Analysis:

- MB Group: The rmpA2 gene was present in 86.10% of the MB samples, while absent in 13.90%.

- NB Group: All NB samples (100%) were positive for rmpA2, indicating a strong correlation.

- SB Group: In this group, 83.60% of samples contained the rmpA2 gene, and 16.40% did not.

- Statistical Significance: The chi-square value for rmpA2 was 0.292 with a p-value of 0.864, suggesting that its association with biofilm production may not be statistically significant.

magA Gene Analysis:

- MB Group: None of the MB samples showed the presence of the magA gene.

- NB Group: Remarkably, all NB group samples (100%) tested positive for magA.

- SB Group: 24.60% had the magA gene, contrasting with 75.40% that did not.

- Statistical Significance: The chi-square value was 10.743 with a p-value of 0.005*, indicating a statistically significant association between magA presence and strong biofilm production.

This study focused on Klebsiella pneumoniae, specifically hypervirulent strains (hvKp), utilizing phenotypic methods like the String test and Potassium Tellurite Agar (PTA) for initial screening. A notable proportion of isolates were identified as hvKp (23.52% by String test, 27.45% by PTA), suggesting the effectiveness of these methods. However, genotypic validation is recommended for confirmation.

Antimicrobial resistance patterns were explored in both classical (cKp) and hypervirulent types, revealing concerning resistance to antibiotics like amoxyclav, amikacin, and ciprofloxacin, highlighting the need for improved antimicrobial stewardship.

Biofilm formation, crucial for pathogenicity, showed diverse capabilities among isolates, with many being strong producers, posing challenges in treatment due to their resilience against antibiotics.

PCR was utilized to detect hypervirulence-associated genes (magA, rmpA2, and rmpA) in hvKp isolates, with magA showing prevalence in strong biofilm producers, suggesting its potential as a biomarker for such strains.

Overall, the effectiveness of the String test and PTA for hvKp identification aids in early detection and management. The link between magA gene expression and strong biofilm production offers new insights for therapeutic interventions.

In conclusion, this study enriches our understanding of Klebsiella pneumoniae, emphasizing the characteristics of hypervirulent strains. The efficacy of phenotypic screening methods and the identification of the magA gene as a potential biomarker for strong biofilm-producing hvKp strains stand out as significant contributions. In the context of increasing antibiotic resistance and the complexity of biofilm-related infections, these insights are vital for developing targeted treatment strategies and advancing antimicrobial stewardship. Our findings pave the way for further research into novel biomarkers and treatment methods for hvKp-related biofilm infections

Ethics approval and consent to participate

Ethical committee functioning at Aarupadai Veedu Medical College and Hospital, have studied the research proposal and they approved the study.

IHEC NO: AV/IEC/2022/025

Consent for publication

My manuscript does not contain any individual person’s data in any form (including any individual details, images, or videos).

Competing interests

There is no competing of interest.

Funding

Self-Funding

Authors' contributions

1.Aravind C Sasi: Conceptualization, Methodology, Writing - Original Draft Preparation, Investigation. (First author)

2. R. Latha: Supervision, Project Administration, Review & Editing. (Corresponding author)

3. K. Kavitha: Data Curation, Formal Analysis. (Co-Author Name 1)

4. Thiyagarajan Sanjeevi: Visualization, Validation. (Co-Author Name 2)

5. S. Pramodhini: Resources, Data Collection. (Co-Author Name 3)

6. Aboobacker P A : Resources, Data Collection. (Co-Author Name 4)

Acknowledgements

The authors are thankful to Vinayaka Missions Research Foundation (Deemed To be University) for providing the necessary facilities for this study.

Harriet Sumathy J V. A Study on The Enterobacteriaceae Pathogen Klebsiella Pneumoniae Isolated From Sewage And Drinking Water Environment. IOSR Journal of Biotechnology and Biochemistry (IOSR-JBB. 4(5):1-05. doi:10.9790/264X-0405020105
Chang D, Sharma L, Dela Cruz CS, Zhang D. Clinical Epidemiology, Risk Factors, and Control Strategies of Klebsiella pneumoniae Infection. Front Microbiol. 2021;12. doi:10.3389/fmicb.2021.750662
Shon AS, Russo TA. Hypervirulent Klebsiella pneumoniae: The next superbug? Future Microbiol. 2012;7(6):669-671. doi:10.2217/fmb.12.43
Jagnow J, Clegg S. Klebsiella pneumoniae MrkD-mediated biofilm formation on extracellular matrix- and collagen-coated surfaces. Microbiology (N Y). 2003;149(9):2397-2405. doi:10.1099/mic.0.26434-0
Piperaki ET, Syrogiannopoulos GA, Tzouvelekis LS, Daikos GL. Klebsiella pneumoniae: Virulence, Biofilm and Antimicrobial Resistance. Pediatric Infectious Disease Journal. 2017;36(10):1002-1005. doi:10.1097/INF.0000000000001675
Lee CR, Lee JH, Park KS, et al. Antimicrobial resistance of hypervirulent Klebsiella pneumoniae: Epidemiology, hypervirulence-associated determinants, and resistance mechanisms. Front Cell Infect Microbiol. 2017;7(NOV). doi:10.3389/fcimb.2017.00483
Sanikhani R, Moeinirad M, Solgi H, Hadadi A, Shahcheraghi F, Badmasti F. The face of hypervirulent Klebsiella pneumoniae isolated from clinical samples of two Iranian teaching hospitals. Ann Clin Microbiol Antimicrob. 2021;20(1). doi:10.1186/s12941-021-00467-2
Hagiya H, Watanabe N, Maki M, Murase T, Otsuka F. Clinical utility of string test as a screening method for hypermucoviscosity-phenotype K lebsiella pneumoniae . Acute Medicine & Surgery. 2014;1(4):245-246. doi:10.1002/ams2.40
Vuotto C, Longo F, Pascolini C, et al. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol. 2017;123(4):1003-1018. doi:10.1111/jam.13533
Yu WL, Ko WC, Cheng KC, et al. Association between RmpA and MagA Genes and Clinical Syndromes Caused by Klebsiella Pneumoniae in Taiwan.; 2006. https://academic.oup.com/cid/article/42/10/1351/277546.
Monem Mohammed KA, Abdalla Ali Elhag S, Tag Elser Sed Ahmed S, et al. Molecular Detection of Virulence genes (rmpA2, iuc & iroB) of Hypervirulent Klebsiella pneumoniae in Clinical Isolates from Patients in Khartoum State, Sudan. Asian Journal of Research in Infectious Diseases. April 2022:23-31. doi:10.9734/ajrid/2022/v9i430275

No competing interests reported.

Unraveling Hypervirulent Klebsiella pneumoniae (hvkp): leveraging the Maga gene as a biomarker for strong biofilm forming hvkp

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

1. INTRODUCTION

2. MATERIALS AND METHODS

2.1. Phenotypic Identification of hvKp:

2.2. Antimicrobial Susceptibility Pattern of Klebsiella pneumoniae Isolates:

2.3. Quantitative Biofilm Assay

2.4. DNA Extraction

2.5. Genotypic Detection of Hypervirulent Klebsiella pneumoniae

2.6. STATISTICAL ANALYSIS

3. RESULTS

4. DISCUSSION

5. CONCLUSION

Declarations

References

Additional Declarations

Status:

Version 1