Study design and bacterial isolates
A total of 119 non-duplicate, gram-negative, non-fermentative isolates suspected to Acinetobacter baumannii were collected from September 2018 to May 2019. The isolates were from samples of patients referred to the medical diagnostic laboratories of the four teaching hospitals (Golestan, Emam Khomeini, Razi and Taleghani) affiliated to the Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. Isolates were originated from different clinical samples such as blood, wound, cerebrospinal fluid, urine, as well as different wards including intensive care unit (ICU), surgery, neonatal intensive care unit (NICU), and Women's internal ward. The isolates were streaked on MacConkey agar (Merck, Darmstadt, Germany) and incubated aerobically at 37°C for 24 hours, and were confirmed by microbiological standard tests including Gram staining, motility, oxidase, peroxidase, and oxidative-fermentation (OF) reactions [14].
Molecular identification of A. baumannii
Boiling method was used for DNA extraction as described previously [15]. The DNA quantity and quality were evaluated using Nano Drop Spectrophotometer PROMO (Thermo Scientific,
USA) and agarose gel electrophoresis respectively. Identification of A. baumannii was confirmed by PCR detection of blaOXA-51-like gene according to Turton et al. [16], and gyrB gene based on the method of Higgins et al. [17].
Antimicrobial susceptibility testing (AST)
The susceptibility of isolates to 6 antibiotics was determined by Kirby–Bauer disk diffusion method on Mueller–Hinton agar (Merck, Darmstadt, Germany) according to the Clinical and Laboratory Standards Institute (CLSI) guideline [18]. The antibiotics were as: piperacillin-tazobactam (100/10 µg), imipenem (10 µg), meropenem (10 µg), gentamicin (10 µg), amikacin (30 µg), and ciprofloxacin (5 µg) ((MAST, Berkshire, UK). Escherichia coli ATCC 25922 was used as quality control.
Antiseptic susceptibility
Antiseptics OCT (Octenisept), and BZK were obtained from Schulke & Mayr (Norderstedt, Germany) & Sigma Aldrich (St Louis, MO, USA) respectively. Minimum inhibitory concentration (MIC) of antiseptics were determined by the broth microdilution according to the CLSI guideline [18]. The OCT and BZK (100 µl) were subjected to two-fold serial dilutions in a 96-well microtiter plate with sterile Mueller–Hinton broth (MHB) to achieve final concentrations ranging from 0.625 to 1280 µg/ml for BZK and 0.122 to 250 µg/ml for OCT. Finally, 100 µl of bacterial suspensions (adjusted to 1 × 106 CFU/ml), were added to each well to achieve the final concentration of 5 × 105 CFU/ml. Plates were incubated at 37°C for 24 h. The lowest concentration of the disinfectant preventing bacterial growth was considered to be the MIC.
The minimum bactericidal concentration (MBC) was defined as the lowest concentration of antiseptics where 99.9 % or more of the initial inoculum was killed and was determined by subculture of 10 µl, from each well where visible growth was prevented, on Mueller–Hinton agar (MHA) plates.
PCR amplication qacE and qac ΔE1 genes
The presence of qacE and qac ΔE1 genes in A. baumannii isolates was determined using the set of primers described previously [9, 19]. PCR assay was done in a thermocycler (Eppendorf, Germany). Each 25 PCR tube contained 1 µl DNA template, 9.5 µl sterile water, 1 µl of 10 pM each primer (Metabion, Steinkirchen, Germany) and 12.5 µl 2x Taq Master Mix (Ampliqon, Odense, Denmark). The PCR conditions was set as follows: 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 45 s, annealing temperatures for qacE and qac ΔE1 genes at 55°C and 53°C respectively for 45s, and extension at 72°C for 45s and a final extension of 72°C for 5 min. Amplified PCR products were analyzed on 1.5% agarose gel stained with DNA safe stain (Yektatajhiz, Iran) by electrophoresis, and visualized under UV light. The primers’ sequences, annealing temperature, and PCR product size are shown in Table 1.
Table 1
Primers used in this study
Primer
|
Oligonucleotide sequence (5′ to 3′)
|
Annealing temperature
|
Product size (bp)
|
Reference
|
OXA-51 like F
|
TAA TGC TTT GAT CGG CCT TG
|
54
|
350
|
16
|
OXA-51 like R
|
TGG ATT GCA CTT CAT CTT GG
|
|
sp2 F
|
GTTCCTGATCCGAAATTCTCG
|
64
|
490
|
17
|
Sp4 R
|
AACGGAGCTTGTCAGGGTTA
|
|
qacE F
|
GCGAAGTAATCGCA ACATCC
|
55
|
240
|
9
|
qacE R
|
GCCCCATACCTACAAA GCC
|
|
qac ΔE1 F
|
AATCCATCCCTGTCGGTGTT
|
53
|
175
|
19
|
qac ΔE1 R
|
CGCAGCGACTTCCACGATGGGGAT
|
|
RAPD4
|
AAGACGCCGT
|
48
|
variable
|
20
|
Randomly amplified polymorphic DNA (RAPD)-PCR
RAPD assays were carried out using a single primer of RAPD4 (Table 1), as described previously [20]. PCR was performed with a composition of 2 µl of template DNA, 1 µl of each primer (10 pmol), 9.5 µl sterile distilled water, and 12.5 µl 2x multiplex master mix in a total volume of 25 µl. The cycling program was as follows: 1 cycle at 94°C for 15 min, 40 cycles at 94°C for 1 min, 37°C for 1 min, and 72°C for 2 min as final extension. The amplicons were separated on 1.5% agarose gel and visualized using ultraviolet light after staining with DNA safe stain.
For analysis of DNA banding patterns, Gel Compare II software version 4.0 (Applied Maths, Sint-Matens-latem, Belgium) was used. Dice coefficient was used for determination of degrees of homology, dendrogram was generated for the RAPD gels and calculation of clustering algorithm was done by the UPGMA (un-weighted pair group method with arithmetic averages) with 80% similarity cut-off.
Statistical analysis
SPSSTM software, version 22.0 (IBM Corporation, Armonk, NY, USA) was used for analysis of data. The results are presented as descriptive statistics in terms of relative frequency. Values are expressed as the percentages of the group (categorical variables). For determination the significance of differences Chi-square or Fisher’s exact tests were used. A difference was considered statistically significant if the p-value was < 0.05.