Human samples
215 cases of human ccRCC tissues were obtained from the clinical database of Chinese PLA General Hospital. Informed consent was obtained from each patient and the study was approved by the Institutional Review Board of Chinese PLA General Hospital. All samples of cancer tissue had been pathologically confirmed as ccRCC according to the 2011 Union for International Cancer Control TNM classification of malignant tumors. All patients were informed and signed a consent on the use of clinical specimens for scientific research. Tissue microarray was constructed in our laboratory.
Cell culture and drug exposure
Human Embryonic Kidney Cell HEK293TN cell, human ccRCC cell lines SN12-PM6, Caki-1, Caki-2, 786-O, 769-P, A498, and normal kidney cell lines HK2, HKC cells were originally purchased from the National Platform of Experimental Cell Resources for Sci-Tech. SN12-PM6 cells were preserved in our laboratory. Caki-1, Caki-2 were cultured in McCoy 5A medium (HyClone), 786-O, 769-P, A498, HK2, HKC were cultured in RPMI 1640 (Gibco) and SN12-PM6, HEK293TN cells were cultured in DMEM (HyClone) with 10% FBS (Gibco), respectively. All cells were cultured in a 5% CO2 incubator at 37°C. The GLI1/2 inhibitor GANT61 and the SMO inhibitor Erismo were obtained from Selleck Chemicals (Houston, TX, USA). Stock solutions were prepared in dimethyl sulfoxide (DMSO) and stored at − 20°C. Working solutions were prepared immediately before use and control cells were treated with the corresponding drug solvent.
Western blot and antibodies
Cells were lysed using radioimmunoprecipitation assay (RIPA; Beyotime, Shanghai, China) buffer. The total protein concentration was measured using a BCA Protein Assay Kit. Equal amounts of total protein were separated by SDS-PAGE and transferred to 0.25 µm PVDF membranes (Millipore, Billerica, USA). Primary antibodies included anti-β-actin (1:5000, 66009-1-Ig; Proteintech); anti-VHL (1:500, sc135657; Santa Cruz); anti-P62 (1:10000, ab109012, Abcam); anti-LC3B (1:2000, ab192890; Abcam), anti-KIF3A (1:1000, 13930-1-AP; Proteintech); anti-IFT88 (1:1000, 13967-1-AP; Proteintech); anti-GLI1 (1:2000, 66905-1-Ig; Proteintech). After washing thrice with TBST, the membranes were incubated with an HRP-conjugated (horseradish peroxidaseconjugated; the Promoter Biotechnology, Wuhan, China) secondary antibody at a 1:5000 dilution for 1 h at room temperature. Antibody binding was detected using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). Experiments were repeated at least 3 times, and band intensities were quantified using ImageJ software.
MTT assay
The cells in different groups were seeded into 96-well plates (3000 cells per well). Absorbance was measured at 24, 48, 72, and 96 hours after seeding at 37°C with 5% CO2. The viability of cells was assessed using 20µL MTT reagent (Cell Titer 96 Aqueous One Solution Reagent, Promega, Beijing, China). All experiments were performed triplicate.
Cell migration and invasion assay
Twenty-four–well plates were applied with transwell chambers (corning) containing 8-µm polycarbonate membrane filters. For the invasion assay, diluted Matrigel (BD Biosciences) was used. Cancer cells (5 x 104/well) were planted in 200 µl of medium without FBS seeding on the upper chamber. The lower chamber was filled with 500 µl medium containing 15% FBS. After incubated for 24h at 37°C in 5% CO2, cells were fixed with 4% paraformaldehyde and the migrated cells were stained by 0.5% crystal violet (C8470, Solarbio, china), photographed and counted under a light microscope.
Immunofluorescence
Cells of different groups were seeded and grown on glass slides at 24 hours prior to the proper experiment. After fixation with 4% paraformaldehyde/PBS for 15 minutes, cells were washed once with PBS and permeabilized with 0.5% Triton X-100 for 10min, and then blocked with 3% NGS (Gibco) for 30 min. The cells were then incubated with the anti-Arl13b (1:200, 17711-1-AP; Proteintech); anti-ac-tubulin (1:500, 66200-1-Ig; Proteintech); anti-SMO (1:200, sc166685; Santa Cruz) at 37℃ for 2 h, and then with a secondary antibody for 1 h at 37 ℃. Nuclei staining was performed with 0.2 mg/mL DAPI.
Immunohistochemistry
Immunohistochemical (IHC) staining was performed on the samples from the as previously described with antibodies specific for VHL, GLI1 and Ki-67. The degree of positivity was initially classified according to scoring both the proportion of positive staining tumor cells and the staining intensities. Scores representing the proportion of positively stained tumor cells were graded as: 0 (< 10%); 1 (11–25%); 2 (26–50%); 3 (51–75%) and 4 (> 75%). The intensity of staining was determined as: 0 (no staining); 1 (weak staining = light yellow); 2 (moderate staining = yellow brown); and 3 (strong staining = brown). The staining index was calculated as the product of staining intensity × percentage of positive tumor cells, resulting in scores of 0, 1, 2, 3, 4, 6, 8, 9 and 12. Only cells with clear tumor cell morphology were scored.
Adenovirus transfection
mCherry-GFP-LC3B was delivered into adeno-associated virus and transfected into SN12-PM6 cell using Lipofectamine 2000 (Invitrogen). Quantification of fluorescence puncta was recorded and analyzed using fluorescence confocal microscope.
Transmission electron microscope assay
SN12-PM6 cell was cultured with/without knockdown of IFT88 gene or treatment with Erismo before being trypsinized and fixed in 2.5% glutaraldehyde. Later, different cells were fixed in 1% osmium tetroxide with 0.1% potassium ferricyanide, dehydrated and embedded in epoxy resin. Samples were cut into ultrathin sections, which were stained with 2% uranyl acetate. The images were acquired using transmission electron microscope.
Plasmid construction, transfection, and infection
Short hairpin RNA (shRNA) sequences targeting human IFT88, KIF3A, GLI1, VHL, oligonucleotides (IFT88: 5’- GAACAAGTTACAACTCCAGAA-3’; KIF3A: 5’-GCAACTAATATGAACGAACAT-3’; GLI1: 5’- CGTGAGCCTGAATCTGT-3’; VHL: 5’- TAGGATTGACATTCTTACAGTT − 3’ were designed and synthesized by BGI (Shenzhen, China) and cloned into pLKO.1 vector. In addition, three mutation sites of PTCH1 (G37R, G466H, P1315L) and two mutation sites of PTCH2 (l104p, G207D) were constructed using whole plasmid, single-round PCR method. Two oligonucleotide primers containing the desired mutation sites were designed and synthesized, and are extended using DNA polymerase with wild-type plasmid template, and then a circular plasmid containing the indicated mutation site was obtained.
Lentivirus were generated in 293T cells. Cells were transfected with 6 µg vector plasmids and 4.5µg psPAX2 and 1.5 µg pMD2-VSVG using the standard calcium chloride transfection method. Calcium transfection kit was purchased from Macgene Biotech (Beijing, China). 48h and 72h after transfection, viral supernatant containing released viruses was collected and filtered through 0.45µm filter. Target cells were infected with virus and 10 ug/ml polybrene for 24 hours. Later, infected cells were selected with 2µg/mL puromycin (Sigma, USA) for three or four days until they were stable. Knockdown of IFT88, KIF3A, GLI1 plasmids were transfected into SN12-PM6, Caki-1 and Caki-2 cells with 72 hours.
RNA extraction and qRT-PCR
TRIzol reagent (Invitrogen) was used to extract total RNA. Complementary DNA was synthesized with ProtoScript® Ⅱ First-Strand cDNA Synthesis Kit (E6300S, NEB, USA) according to the manufacturer’s instruction. Afterwards, the mRNA expression levels of genes were detected with NovoStart® SYBR Green SuperMix Plus (E096-01A, novoprotein, China). Relative mRNA expressions were normalized to peptidylprolyl isomerase A (PPIA) with the 2−ΔΔCT method. The primer sequences used are listed in Supplementary Table S1.
Primary renal cancer cell culture
Tumor specimens from two renal cell cancer patients were isolated with collagenase digestion and transported to the lab within 10 min. After removing blood clots, the samples were rinsed with sterile phosphate-buffered saline (PBS) twice and cut into small fragments in a size of about 1 mm3. Then, the fragments were incubated with collagenase of 1% (Solarbio) in a gently shaking water bath. After incubation with collagenase, the rest of samples were collected and put into 24 well plates. Cells were isolated and divided for culture using F medium containing 25% Ham’s F-12 nutrient mix (Thermo Fisher Scientific, Carlsbad, CA) supplemented with 10% FBS.
In vivo metastasis studies
SN12-PM6 cells were prepared with Luciferase (for imaging), with/without knocked down of KIF3A, IFT88, GLI1. The cells (1 x 106 in 0.1 mL of sterilized PBS) were mixed with Matrigel, 1:1) in respective groups were injected into the renal capsule of 4- to 5-week-old male nude mice (6 mice per group). The GLI1/2 inhibitor GANT61 (50mg/kg) or DMSO was administered to the SN12-PM6-luc xenograft mouse models through an orogastric tub three times a week. Lesions, including the orthotopic xenograft tumors and lung metastatic nodules, were monitored in vivo with a molecular imaging system (NightOWL II LB983). The signal intensity of luc-labeled cells from lung tissues represented the amount of lung metastatic lesions. All mice were sacrificed 2 months post-injection. Tissue samples were collected and measured, and HE, IHC, IF staining were performed.
Statistical analysis
The Cancer Genome Atlas (TCGA) database (http://cancergenome.nih.gov) was analyzed using UALCAN (http://ualcan.path.uab.edu/index.html) to determine Hedgehog signaling gene mutation. All analyses, unless specified otherwise, were performed using raphPad Prism8.0.1 (GraphPad Software, CA, USA). Data are presented as the mean ± standard deviation (SD). Categorical data were analyzed with either chi-square or Fisher exact test. For comparison between two groups, unpaired student’s t test was performed. The Kaplan–Meier survival analysis was performed using the log-rank test with the SPSS software (version 23.0). Significant differences were represented as *P < 0.05, **P < 0.01, ***P < 0.001, ****p < 0.0001 unless otherwise indicated.