Exosomes derived from bone marrow mesenchymal stem cells promote angiogenesis via transfer of miR-21-5p after cerebral ischemia in mice

doi:10.21203/rs.3.rs-421529/v1

Download PDF

Research Article

Exosomes derived from bone marrow mesenchymal stem cells promote angiogenesis via transfer of miR-21-5p after cerebral ischemia in mice

https://doi.org/10.21203/rs.3.rs-421529/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Mesenchymal stem cells (MSCs) transplantation is a potential clinical therapy for cerebral ischemia. The therapeutic effects of MSCs primarily depends on the paracrine action by releasing exosomes (Exos). Exosomes derived from bone marrow mesenchymal stem cells (BMSC-Exos) could modulate target cell functions by transferring microRNAs (miRs) cargo. In this study, we aimed to investigate whether BMSC-Exos could promote angiogenesis via transfer of miR-21-5p after cerebral ischemia.

Methods

BMSC-Exos were isolated from conditioned medium of BMSCs by differential ultracentrifugation, and confirmed by transmission electron microscopy, nanoparticle tracking analysis, and western blot analysis. In mice with middle cerebral artery occlusion (MCAO), the neurological function was evaluated by Zea Longa’s method, and the infarct volume and microvessel density were detected by TTC staining and vWF immunofluorescence staining, respectively. The proangiogenic effects of BMSC-Exos were assessed via proliferation, migration, and tube formation of human umbilical vein endothelial cells (HUVECs) in vitro assays. The miR-21-5p expression was detected by qRT-PCR. The expression levels of VEGF, VEGFR2, Ang-1, and Tie-2 were determined by western blot.

Results

BMSC-Exos significantly improved neurological function and reduced infract volume after cerebral ischemia. Moreover, BMSC-Exos significantly upregulated the microvessel density and the expression levels of proangiogenic proteins VEGF, VEGFR2, Ang-1 and Tie-2 in the ischemic boundary region. MiR-21-5p expression was also dramatically increased after cerebral ischemia. In vitro assays revealed that BMSC-Exos enhanced HUVECs functions including proliferation, migration and tube formation, as well as increasing the expression of VEGF and VEGFR2. However, these proangiogenic effects of BMSC-Exos on HUVECs were reversed by miR-21-5p inhibitor.

Conclusion

Our study indicated that BMSC-Exos could promote angiogenesis and neurological function recovery via transfer of miR-21-5p. Therefore, the application of miR-21-5p-loaded BMSC-Exos might be an attractive treatment strategy of cerebral ischemia.

Stem Cell & Developmental Cell Biology

Bone marrow mesenchymal stem cells

Exosome

MicroRNA

Angiogenesis

Cerebral ischemia

Stroke is one of the leading causes of death and disability worldwide [1]. Up to now, the only recommended drug for treatment of acute cerebral ischemia is tissue-type plasminogen activator (tPA), which works as a thrombolytic agent. However, the narrow therapeutic time window and potentially fatal hemorrhage severely limited the clinical application of tPA [2]. Therefore, novel effective strategies designed to improve functional recovery after ischemic stroke are urgently needed. A growing number of researches have indicated that stem cell-based therapy represents a new approach for the treatment of ischemic stroke [3-5]. Mesenchymal stem cells (MSCs) can be obtained easily and expanded rapidly in vitro, which make it an ideal candidate for cell-based therapy [6]. A variety of studies have demonstrated that transplanted MSCs could promote neurogenesis and angiogenesis, thus facilitate the recovery from stroke [7, 8]. As for the underlying mechanism of these functions, it was initially believed that MSCs homed to ischemic tissues and differentiated to replace injured cells [9, 10]. Nevertheless, following researches reported that the engraftment and differentiation of MSCs into impaired sites are at a poor level and transient [11, 12]. Until now, it is proposed that MSCs exert their beneficial effects mainly by secreting paracrine factors, such as trophic factors and extracellular microvesicles (EVs) [13, 14].

Exosomes (Exos) are small EVs sized approximately 30‐150 nm in diameter [15]. They are secreted by a diversity of cell types, and contain biological molecules, including proteins, lipids, mRNAs and microRNAs (miRs) [16]. The beneficial effects of MSCs-derived Exos on stroke have been particularly studied, but the mechanisms of action are still not fully clarified [17, 18]. Recent studies have shown that Exos transfer miRs to the recipient cells in the brain to affect the nervous and vascular systems, and ultimately alleviate cerebral ischemic injury [19-21].

MiRs are small single-stranded noncoding RNAs that bind to target mRNAs and suppress proteins expression by inhibiting translation or degrading mRNAs [22]. They are engaged in many physiological and pathological processes, such as cell proliferation, migration, differentiation, metabolism and apoptosis [23, 24]. Increasing evidence has demonstrated that miRs are important regulators of angiogenesis. MiR-21-5p notably promoted local neovascularization in myocardial infarction model [25]. Exos derived from endothelial progenitor cell can promote endothelial cell repair by transferring miR-21-5p [26]. MSCs could promote ischemic tissue repair and angiogenesis of diabetic foot by exosomal miR-21-5p [27]. Recent studies indicated that miR-21-5p was abundantly expressed in BMSC-Exos [28]. However, it is not clear whether BMSC-Exos promote angiogenesis after cerebral ischemia through transfer of miR-21-5p.

In this study, we firstly studied the putative beneficial effects of BMSC-Exos on the neurological function and angiogenesis with cerebral ischemia, and then further confirmed whether these proangiogenic effects are related to the miR-21-5p transferred by BMSC-Exos.

Animals

Male Sprague-Dawley rats weighing 80-100 g (3 weeks old) and male ICR mice weighing 25-30 g (8-10 weeks old) were obtained from SIPPR/BK Laboratory Animal (Shanghai, China). The animals were kept at stable temperature (22 ± 2 °C) and humidity (60 ± 5%) condition, with 12-h light/dark cycle and free access to water and food. All animal care and experimental procedures were approved by the Zhejiang Chinese Medical University Animal Welfare Ethics Committee (reference number: ZSLL-2017-058), and performed in accordance with the NIH guidelines for the Care and Use of Laboratory Animals [29].

Cell culture

BMSCs were isolated based on our previously described method [30]. Briefly, the bone marrow was flushed with prechilled DMEM/F12 containing 1% (v/v) penicillin and streptomycin (Haotian Biological Technology, Hangzhou, China) from the femurs and tibias of rats. Then, centrifuged the bone marrow aspirates and suspended the cells in DMEM/F12 supplemented with 10% fetal bovine serum (FBS) (Gibco, Thermo Fisher Scientific, MD, USA). The medium was replaced 2 days after and every 3 days thereafter. The cells were passaged when 80-90% confluence was reached with a ratio of 1:2. The passage 3-4 BMSCs were used for the following experiments. To identify the BMSCs, cells were detected by flow cytometry using specific antibodies against cell surface markers, including CD34 (Santa Cruz, CA, USA), CD29, CD45 and CD90 (Biolegend, San Diego, CA,USA).

Human umbilical vein endothelial cells (HUVECs) obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) were cultured in RPMI-1640 medium (Hyclone, UT, USA) containing 10% FBS and 1% antibiotics. Humidified condition at 37 °C with 5% CO₂ was maintained. HUVECs were passaged every two or three days.

BMSC-Exos isolation, purification and identification

BMSC-Exos were isolated and purified by differential ultracentrifugation method [31]. Brieﬂy, upon reaching 70-80% conﬂuence, BMSCs were rinsed three times with PBS and cultured in fresh medium containing 10% Exos-free FBS medium (SBI Biosciences, CA, USA). The supernatants were collected after an additional 48 h incubation, and sequentially centrifuged at 300 × g and 2000 × g for 10 min to remove the dead cells. Then, the supernatant was centrifuged at 10,000 × g for 30 min at 4°C to clear the residual cellular debris and ﬁltered with a 0.22-μm ﬁlter (Millipore, MA, USA). Afterwards, the filtrates were ultracentrifuged at 4°C and 100,000 × g for 2 h, followed by washing with PBS and ultracentrifuged at 100,000 × g for 2 h. At last, the pelleted Exos were resuspended in 100 μL PBS and quantified by total proteins using a Micro BCA Protein Assay kit (Thermo Scientific, IL, USA), then stored at -80°C.

For identiﬁcation of Exos, the morphology, particle concentration, size distribution, and specific surface markers (CD9, CD63 and TSG101) of isolated Exos were detected by transmission electron microscope (TEM, Hitachi, Japan), nanoparticle tracking analysis (NTA), and western blot analysis respectively.

Focal cerebral ischemia model in mice

Focal cerebral ischemia was induced by middle cerebral artery occlusion (MCAO) as previously described [32]. Briefly, male ICR mice were intraperitoneally anesthetized with 10% chloral hydrate at a final dose of 350 mg/kg. Then, a tip blunted and poly-L-lysine coated 6-0 nylon monofilament suture was advanced approximately 10 mm distal to the right carotid bifurcation to occlude the origin of the MCA. After 60 min of ischemia, the suture was carefully and slowly withdrawn. Sham-operated mice received identical surgery without inserting a suture. During the surgery, the rectal temperature of mice was maintained at 37°C with a homeothermic pad.

BMSC-Exos administration and BrdU labeling

To evaluate the therapeutic effects of BMSC-Exos, mice were allocated to four cohorts: sham operation group, MCAO group, 25 μg BMSC-Exos group and 50 μg BMSC-Exos group, and then were administered with Exos in 100 μL PBS or PBS alone by tail vein injection at 24 h after ischemia. To observe cell proliferation, mice were administered 50 mg/kg of 5-bromo-2-deoxyuridine (BrdU, Sigma-Aldrich, MO, USA) by initial intraperitoneal injection 24 h after ischemia, followed by daily consecutive injection for up to14 days.

Neurological function evaluation

The neurological deficit score was evaluated 1, 3, 7, and 14 days after stroke according to the Zea Longa score [33]: 0, no deficit; 1, failure to fully extend left forepaw; 2, circling to the left; 3, paresis to the left; 4, depressed level of consciousness and no spontaneous walking. The corner test was carried out as previously described [34]. Briefly, two 30 cm×20 cm×1 cm boards were attached to each other at an angle of 30° and with a small opening between the two boards. A mouse was placed into the central square facing the corner. When both sides of the vibrissae were stimulated by boards, the mouse then reared forward and upward, after which it turned back to face the open end. Each mouse was tested for ten trials, and the selected turning sides were recorded.

Infarct volume assessment

Mice were euthanized by overdose anesthesia with 10% chloral hydrate, and brains were moved and frozen immediately at -20°C for approximately 5 min, and then dissected into 1 mm-thick coronal slices. The slices were stained with 2% 2,3,5-triphenyltetrazolium chloride (TTC) for 15 min, and fixed with 4% paraformaldehyde for 24 h. The infarct volume was evaluated by Image J software.

Immunofluorescence staining

Mice were transcardially perfused with normal saline followed by 4% paraformaldehyde solution for 10 min at 14 days after MCAO. Brains were fixed overnight at 4°C, and then soaked in 30% sucrose solution. The brains were frozen and cut into 10-μm-thick frozen sections (Leica, Wetzlar, Germany). BrdU/von Willebrand factor (vWF) was detected by double immunofluorescence staining as described in our previous study [30].

BMSC-Exos uptake by HUVECs

To label Exos with green ﬂuorescent dye, Exos were firstly resuspended with the PKH67 dye (Sigma-Aldrich, Munich, Germany) and incubated for 5 min, then terminated by 2% bovine serum albumin. Next, Exos were ultracentrifuged at 100,000 × g for 1 h to clear unbound dyes. HUVECs were incubated with PKH67-labelled Exos for 12 h followed by 4% paraformaldehyde fixation for 15 min and 4’,6-diamidino-2-phenylindole (DAPI) stain for 5 min. The internalization of PKH67-labeled Exos by HUVECs was observed using a fluorescence microscope (Leica, Wetzlar, Germany).

MiR-21-5p inhibitor transfection

The miR-21-5p inhibitor and the negative control (NC) were synthesized by RiboBio (Guangzhou Ribobio, Guangzhou, China). BMSCs at 80% confluence were transfected with 100 nM miR-21-5p inhibitor or NC, which were performed using Lipofectamine 2000 and Opti-MEM medium (Invitrogen, CA, USA) according to the manufacturer’s protocol. After 6 h, the transfection mixture was replaced by DMEM/F12 containing 10% exosome-free FBS. Conditioned medium of transfected cells was collected and centrifuged as described above.

MTT assay

The proliferation of HUVECs was measured using the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay (Beyotime, Shanghai, China). HUVECs plated on 96-well plates (1×10⁴ cells/well) were cocultured with Exos (25 and 50 μg/mL) for 12, 24, 36, and 48 hours, and then 10 μL of MTT tetrazolium salt solution (5 mg/mL) was added into each well. After incubation for another 4 h, the formazan crystals were dissolved by adding 150 μL of dimethyl sulfoxide (Sigma, MO, USA). The optical density (OD) value of each well was measured at 490 nm by microplate reader (Tecan Austria GmbH, Grodig, Austria). Each experimental group was performed in six replicate wells.

Scratch wound healing assay

HUVECs were seeded into 6-well plates (5×10⁵ cells/well) for confluence, followed by scratching with 200 μL pipette tip when reaching 90% confluence. Then, 2 mL of serum-free RPMI-1640 medium supplemented with Exos was added to each well. Images were captured at 0 h and 24 h after wounding. The migration rate (%) was calculated as follows: migration rate (%)= (initial wound area (t=0 h)–residual area (t=24 h))/ initial wound area (t=0 h)×100%. Each experiment was repeated three times.

Transwell migration assay

Transwell migration assay was carried out using 24-well chambers (8 μm, Corning, NY, USA). 500 μL of the RPMI-1640 containing 1% FBS was added into the lower chamber, and HUVECs (6×10⁴ cells/well) suspended in 100 μL FBS-free medium were seeded in the upper chamber in the presence or absence of Exos. After 8 h for migration, nonmigratory cells were removed from the top of the insert membrane using humidified cotton swabs. The migrated cells at the bottom surface of membrane were fixed in 4% paraformaldehyde and stained with 0.1% crystal violet. The migrated cells were imaged and counted at 5 random fields. Three duplicates were set in each group.

Tube formation assay

After thawed overnight at 4 °C, 50 μL per well matrigel matrix (BD Biosciences, CA, USA) was added into precooled 96-well plates and incubated at 37°C to polymerize for 30 min. Next, HUVECs (2 × 10⁴ cells/well) in FBS-free RPMI-1640 containing Exos were seeded onto matrigel-coated plates. Capillary-like tubular structures were captured after 6 h incubation. The total tube lengths from five random microscopic fields were calculated using Angiogenesis Analyzer Image J software.

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

Total RNA from brain tissues of ischemic boundary region or cells was extracted using miRNeasy Mini Kit (Qiagen, Hilden, Germany). cDNA was produced from the total RNA using Mir-X^TMmiRNA First-strand Synthesis Kit (TaKaRa, Dalian, China). Subsequently, the product from reverse transcription was amplified with the SYBR Premix Ex Taq Kit (TaKaRa, Dalian, China) on an iQ5 real-time PCR detection system (Bio-Rad, CA, USA). Relative expression levels of miRNA were calculated by the 2^−ΔΔCt and were normalized to U6. Each sample repeated 3 times and at least three samples obtained from independent experiments were examined. All primers used in this study are listed in Table 1.

Table 1 Primer sequences for qRT-PCR

Primers	Sequences
miR-21-5p	5’-CCGCGTAGCTTATCAGACTCAGACTGATGTTGA -3’
miR-22-3p	5’- CGAAGCTGCCAGTTGAAGAACTGT -3’
miR-486	5’- TCCTGTACTGAGCTGCCCC -3’
let-7i-5p	5’- GCGTGAGGTAGTAGTTTGTGCTGTT -3’

Note: The forward and reverse primers of U6, and the mRQ 3’Primer used as the universal reverse primer for above miRs, were supplied in the Mir-X miRNA First-strand Synthesis kit (Cat No. 638313)

Western blot analysis

Total protein was extracted with RIPA lysis buffer containing protease inhibitor PMSF ( Beyotime, Shanghai, China),and quantified using BCA protein assay kit (Beyotime, Shanghai, China). Firstly, equal amounts of protein were separated by 10% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and transferred to PVDF membranes (Millpore, CA, USA). After being blocked with 5% skim milk in TBST, the membranes were incubated with the following primary antibodies overnight at 4°C: CD9 (1:1000; Bioworld, MN, USA), CD63 (1:1000; Bioworld, MN, USA), TSG101 ( 1:1000; Abcam, MA, USA ), VEGF (1: 500; Santa Cruz, CA, USA), VEGFR (1:500; Abcam, MA, USA ), Ang-1 (1:1000; Santa Cruz, CA, USA), Tie-2 (1:1000; Santa Cruz, CA, USA) and GAPDH (1:1000; Santa Cruz, CA, USA), followed by incubation with corresponding secondary antibodies at room temperature for 1 h. Signals were visualized by enhanced chemiluminescence detection kit (Millpore, CA, USA). Relative expression levels were normalized to levels of GAPDH.

Statistical analysis

Data were analyzed by SPSS software (version 25.0, SPSS, IL, USA) and presented as mean ± standard deviation (SD). Neurological deficit and corner test data were analyzed by nonparametric Kruskal-Wallis H test. One-way analysis of variance (ANOVA) (Student-Newman-Keuls) statistical differences between groups was used for analyzing all other data. P<0.05 was considered statistically significant.

Characterization of BMSCs and BMSC-Exos

The primary BMSCs (P0) initially displayed short bar shapes, while BMSCs at passage 3 (P3) exhibited a typical spindle-shaped morphology (Fig. 1a). To characterize the phenotype of BMSCs, the BMSCs surface markers were analyzed by flow cytometry. The results showed that these cells were negative for CD34 (1.44%) and CD45 (0.30%) (hematopoietic cell specific markers), whereas strongly positive for CD29 (99.83%) and CD90 (99.88%) (mesenchymal stem-cell specific markers ) (Fig. 1b).

As presented in Fig. 2a , the BMSC-Exos had a typical spherical or cup-shaped morphology. NTA revealed a bell-shaped curve of BMSC-Exos size distribution with a peak at approximately 108.4 nm, and an average concentration of the particles was 4.8 ×10⁷ particles/ml (Fig. 2b). Additionally, the isolated BMSC-Exos expressed exosomal markers CD9, CD63 and TSG101 without the expression of non-exosome marker protein GAPDH (Fig. 2c). These properties indicated that the BMSC-derived particles were Exos.

BMSC-Exos ameliorated ischemic brain injury in mice

To determine whether BMSC-Exos improved neurological function recovery, the neurological deficit score and the corner test were performed at 1, 3, 7 and 14 days after MCAO in mice. The results demonstrated that BMSC-Exos decreased the neurological deficit score and right-turn number in dose-related manner (Fig. 3a-b). Results of TTC staining showed that BMSC-Exos significantly reduced infarction volume on 3 days after ischemia. At 14 days after ischemia, apparent atrophy of the ischemic hemisphere was observed in all groups of mice, except the sham-operated group. Moreover, the cerebral atrophy in the BMSC-Exos group was markedly reduced compared to the MCAO group. In addition, compared with the 25 μg BMSC-Exos group, the cerebral atrophy was significantly reduced in the 50 μg BMSC-Exos group (Fig. 3c-d).

BMSC-Exos promoted angiogenesis in the ischemic boundary region

Microvessel density was estimated by BrdU/vWF immunofluorescent staining at 14 days after MCAO. Significantly increased number of BrdU⁺/vWF⁺ cells was observed in the MCAO and BMSC-Exos groups compared to the sham group. Furthermore, microvessel density in the BMSC-Exos group increased more significantly than which in MCAO group (Fig. 4a-b).

BMSC-Exos increased VEGF/VEGFR and Ang-1/Tie2 protein expression after ischemia in mice

To test whether BMSC-Exos promote angiogenesis via upregulating the expression of VEGF, VEGFR2, Ang-1 and Tie2, the expression levels of these proteins were detected by western blot analysis. Compared with the sham group, the expression levels of VEGF, VEGFR2, Ang-1 and Tie2 were increased in the MCAO group and BMSC-Exos group. Furthermore, the expression levels of these proteins were increased more obviously in BMSC-Exos group compared to the MCAO group (Fig. 4c-d).

BMSC-Exos increased miR-21-5p expression after ischemia in mice

To study the changes of specific miRs expression levels after stroke, the expression of several candidate miRs, including Let-7i-5p，miR-21-5p，miR-22-3p and miR-486 were detected by qRT-PCR at 14 days after MCAO. The expression levels of these miRs were increased in the BMSC-Exos group compared to the MCAO group. In particular, miR-21-5p expression levels increased approximately 22-fold (Fig. 5a-d).

HUVECs uptake BMSC-Exos

To confirm that BMSC-Exos could be internalized into HUVECs, BMSC-Exos were labeled with PKH67 and then were added to HUVECs for 12 h incubation. Fluorescence images showed that PKH67 fluorescence were incorporated into the cytoplasm of HUVECs (Fig. 6a). This result revealed that our purified BMSC-Exos had been taken up and transferred to HUVECs.

BMSC-Exos promoted HUVECs angiogenesis by transferring miR-21-5p

Since endothelial cell proliferation, migration, and sprouting of are critical for angiogenesis, the effects of BMSC-Exos on HUVECs proliferation, migration and tube formation were studied. MTT assay, scratch wound healing assay, transwell assay and tube formation assay indicated that BMSC-Exos can enhance the above-mentioned capability of HUVECs (Fig. 6b-h). Moreover, the effects of BMSC-Exos were in a dose-related manner，so 50 μg/mL was selected for the following experiments.

To clarify whether BMSC-Exos promote angiogenesis of HUVECs by transferring specific miRs, the expression levels of Let-7i-5p, miR-21-5p, miR-22-3p and miR-486 in HUVECs were analyzed. Results showed that miR-21-5p expression was significantly increased in BMSC-Exos treated HUVECs (Fig. 7a), which was consist with the results in vivo. To further investigate the mechanisms, BMSCs were transfected with miR-21-5p inhibitor or NC. The miR-21-5p expression in BMSCs and BMSC-Exos both were downregulated as analyzed by qRT-PCR (Fig. 7b-c). Furthermore, the miR-21-5p expression in HUVECs administrated with miR-21-5p inhibitor transfected BMSC-Exos (miR-21-5p-Exos) was downregulated as well (Fig. 7d). Upon downregulation of miR-21-5p, the effects of BMSC-Exos on HUVECs proliferation, migration and tube formation were eliminated (Fig. 8a-g). Thus, our results indicated that the proangiogenic activity of BMSC-Exos was partially mediated by miR-21-5p.

BMSC-Exos upregulated VEGF and VEGFR2 expression in HUVECs by transferring miR-21-5p

To examine the mechanisms of proangiogenic action of BMSC-Exos, the VEGF and VEGFR2 protein expression in HUVECs were detected by western blot analysis. Results showed that BMSC-Exos remarkably improved the expression levels of VEGF and VEGFR2. However, this effect was reversed by the miR-21-5p inhibitor (Fig. 8h-j). The above results revealed that BMSC-Exos enhances VEGF and VEGFR2 expression by transferring miR-21-5p into HUVECs.

In the present study, we firstly confirmed that systemic treatment of BMSC-Exos could improve cerebral ischemia injury and promote angiogenesis in mice. Simultaneously, BMSC-Exos increased proangiogenic proteins expression, including VEGF, VEGFR, Ang-1 and Tie-2, and upregulated miR-21-5p expression in the ischemic boundary regions. Then, we transfected miR-21-5p inhibitor into BMSCs and further confirmed BMSC-Exos improved HUVECs angiogenesis via transferring miR-21-5p in vitro.

Increasing evidence suggests that BMSCs exert their therapeutic effects through paracrine mechanisms including secretion of Exos [35, 36]. Moreover, Exos not only show the same effects as BMSCs, but also show the advantages on targeted delivery, low immunogenicity, and high repairability [37]. BMSCs have been proven to secret Exos that show the potential for treatment of ischemic disease including ischemic stroke [38]. Recent studies showed that Exos derived from BMSCs promoted activation of microvascular endothelial cells and played an antiapoptotic role in cerebral ischemia/reperfusion injury [39]. In addition, BMSC-Exos could protect against myocardial ischemia reperfusion injury [40, 41]. In this work, we found that BMSC-Exos could promote angiogenesis and improve ischemia/reperfusion injury in mice. Moreover, we also confirmed that BMSC-Exos promoted the proliferation, migration, and tube formation of HUVECs in vitro. Thus, our research presents a new evidence in favor of the concept that BMSC-Exos possess a potent proangiogenic activity.

Nowadays, accumulated studies have shown that angiogenesis is essential for brain tissue repair following stroke, and the promotion of angiogenesis is broadly recognized as a promising therapeutic strategy [42, 43]. Angiogenesis is commonly defined as a multi-step process, involving proliferation, sprouting, migration and tube formation from the pre-existing vasculature [44]. It is regulated by multiple proangiogenic factors, among which VEGF, VEGFR2, Ang-1, and Tie-2 play the most important roles. The first step of angiogenesis is to remove the mural cells from the endothelial cells of established blood vessels, which results in an unstable blood vessel. Then, VEGF bonds to its receptor VEGFR2 and triggers downstream angiogenic signals, which lead to endothelial cells in these unstable blood vessel display different phenotypes: migratory tip cells or proliferating stalk cells [45, 46]. In the presence of VEGF and other angiogenic factors, endothelial cells proliferate and migrate and then form new vascular tube [47]. However, the newly formed endothelial cell tubes are unstable due to the lack of pericytes. Ang-1 is one of the key angiogenic factors for the recruitment of the pericytes, and it act through the tyrosine kinase receptor Tie-2. The Ang-1/Tie-2 signal regulates maturation of newly formed vasculature, which eventually results in complex vascular network formation [48, 49]. In this study, we found that BMSC-Exos could dramatically improve the levels of VEGF, VEGFR2, Ang-1, and Tie-2 in the peripheral zone of ischemic mice. Unfortunately, we could only find the improved expression of VEGF and VEGFR2 in HUVECs after BMSC-Exos administration.

MiRs are a class of non-coding RNA that influence nearly all fundamental biological processes, and are stable in Exos due to the prevention of RNase degradation [50]. To date, a considerable amount studies have reported miRs related to angiogenesis. MiR-22 could regulate endothelial angiogenesis, inflammation, and tissue injury by targeting vascular endothelial-cadherin [51]. MiR-486-5p released by adipose-derived stem cell-derived EV could mediate wound healing and promote angiogenesis [52]. MiR-21-5p could promote extracellular matrix degradation and angiogenesis in the unilateral anterior crossbite model [53]. More importantly, it has been reported that miR-486-5p, miR-22, miR-21-5p and Let-7i-5p were abundant in BMSC-Exos [28]. Thus, we detected the expression of Let-7i-5p, miR-21-5p, miR-22-3p, and miR-486 in ischemic boundary region of stroke mice and HUVECs. The qRT-PCR data indicated that BMSC-Exos up-regulated the expression of these miRs, among which miR-21-5p was the most significant one. Then, we transfected miR-21-5p inhibitor into BMSCs, the expression of miR-21-5p in BMSC-Exos was significantly decreased confirmed by qRT-PCR. More importantly, the proangiogenic effects of BMSC-Exos on HUVECs were greatly abolished by miR-21-5p inhibitor. Moreover, the expression levels of VEGF and VEGFR2 in HUVECs were also significantly reduced by exosomes derived from BMSCs transfected with miR-21-5p inhibitor. These results suggest that the therapeutic effects of BMSC-Exos on angiogenesis may depend on the transport of miR-21-5p. However, although our study found that BMSC-derived exosomal miR-21-5p promoted angiogenesis in cerebral ischemia mice, the target genes of miR-21-5p and the detail mechanism need to be further investigated.

Our study indicates that BMSC-Exos can promote angiogenesis by transfer of miR-21-5p after stroke in mice. These findings show that BMSC-Exos might be a promising candidate for stroke treatment, and that BMSC-Exos could be tailored to maximize therapeutic effect.

Acknowledgements

Not applicable.

Authors’ contributions

H.H., X.W.H.: conception and design, collection and assembly of data, data analysis and interpretation, manuscript writing; L.L.: conception and design, provision of study material, collection and assembly of data, manuscript writing; J.J.G., Y.Y.: administrative support, provision of study material, collection data; Y.F.: supervision, financial support, data analysis and interpretation; J.D.X: data analysis and interpretation, manuscript writing; L.S.C.: conception and design, financial support, provision of study material, manuscript writing, final approval of manuscript, supervision.

Funding

This work was supported by the National Natural Science Foundation of China (No. 81873028, 81903949), the Public Welfare Technology Application Research Project of Zhejiang Province (No. 2016C33185), and the Natural Science Foundation of Zhejiang Province (LQ19H290004).

Availability of data and materials

All data generated or analyzed during this study are available from the corresponding author upon reasonable request.

Ethics approval and consent to participate

All animal experimental procedures were approved by the Experimental Animal Ethics Committee of Zhejiang Chinese Medical University (reference number: ZSLL-2017-058), and performed in accordance with the guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health.

Consent for publication

The authors declare that they consent to publication.

Competing interests

The authors declare no potential conflicts of interest.

Author details

¹Department of Physiology, Zhejiang Chinese Medical University, Hangzhou 310053, China. ²Department of Pathology, Zhejiang Chinese Medical University, Hangzhou 310053, China.

BMSCs: Bone marrow mesenchymal stem cell; BMSC-Exos: Bone marrow mesenchymal stem cell-derived exosomes; MCAO: Middle cerebral artery occlusion; TTC: 2,3,5-triphenyltetrazolium chloride; BrdU: 5-Bromo-2-deoxyuridine; vWF: von Willebrand factor; qRT-PCR: Quantitative reverse transcription-polymerase chain reaction; HUVECs: Human umbilical vein endothelial cells; FBS: Fetal bovine serum; tPA: Tissue-type plasminogen activator; PBS: Phosphate-buffered saline; NTA: nanoparticle tracking analysis; TEM: transmission electron microscope; DAPI: 4’,6-diamidino-2-phenylindole; MTT: 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide; OD: Optical density; VEGF: Vascular endothelial growth factor; VEGFR2: Vascular endothelial growth factor receptor 2; Ang-1: Angiogenin-1; Tie-2: Tyrosine kinase receptor-2; GAPDH: Glyceraldehyde-3-phosphate dehudrogenase; SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis; HRP: Horseradish peroxidase; ECL: Enhanced chemiluminescence

Benjamin EJ, Blaha MJ, Chiuve SE, Cushman M, Das SR, Deo R et al. Heart Disease and Stroke Statistics-2017 Update: A Report From the American Heart Association. Circulation. 2017;135(10):e146-e603.
Powers WJ, Rabinstein AA, Ackerson T, Adeoye OM, Bambakidis NC, Becker K et al. 2018 Guidelines for the Early Management of Patients With Acute Ischemic Stroke: A Guideline for Healthcare Professionals From the American Heart Association/American Stroke Association. Stroke. 2018;49(3):e46-e110.
Park YJ, Niizuma K, Mokin M, Dezawa M, Borlongan CV. Cell-Based Therapy for Stroke: Musing With Muse Cells. Stroke. 2020;51(9):2854-2862.
Suda S, Nito C, Yokobori S, Sakamoto Y, Nakajima M, Sowa K et al. Recent Advances in Cell-Based Therapies for Ischemic Stroke. Int J Mol Sci. 2020;21(18).
Noh JE, Oh SH, Park IH, Song J. Intracerebral Transplants of GMP-Grade Human Umbilical Cord-Derived Mesenchymal Stromal Cells Effectively Treat Subacute-Phase Ischemic Stroke in a Rodent Model. Front Cell Neurosci. 2020;14:546659.
Parekkadan B, Milwid JM. Mesenchymal stem cells as therapeutics. Annu Rev Biomed Eng. 2010;12:87-117.
Nalamolu KR, Chelluboina B, Fornal CA, Challa SR, Pinson DM, Wang DZ et al. Stem cell treatment improves post stroke neurological outcomes: a comparative study in male and female rats. Stroke Vasc Neurol. 2021.
Wei L, Fraser JL, Lu ZY, Hu X, Yu SP. Transplantation of hypoxia preconditioned bone marrow mesenchymal stem cells enhances angiogenesis and neurogenesis after cerebral ischemia in rats. Neurobiol Dis. 2012;46(3):635-645.
Prockop DJ. Marrow stromal cells as stem cells for nonhematopoietic tissues. Science. 1997;276(5309):71-74.
Prockop DJ, Gregory CA, Spees JL. One strategy for cell and gene therapy: harnessing the power of adult stem cells to repair tissues. Proc Natl Acad Sci U S A. 2003;100 Suppl 1:11917-11923.
Rojas M, Xu J, Woods CR, Mora AL, Spears W, Roman J et al. Bone marrow-derived mesenchymal stem cells in repair of the injured lung. Am J Respir Cell Mol Biol. 2005;33(2):145-152.
Wang C, Cheng L, Xu H, Liu Z. Towards whole-body imaging at the single cell level using ultra-sensitive stem cell labeling with oligo-arginine modified upconversion nanoparticles. Biomaterials. 2012;33(19):4872-4881.
Spees JL, Lee RH, Gregory CA. Mechanisms of mesenchymal stem/stromal cell function. Stem Cell Res Ther. 2016;7(1):125.
Fu Y, Karbaat L, Wu L, Leijten J, Both SK, Karperien M. Trophic Effects of Mesenchymal Stem Cells in Tissue Regeneration. Tissue Eng Part B Rev. 2017;23(6):515-528.
Vlassov AV, Magdaleno S, Setterquist R, Conrad R. Exosomes: current knowledge of their composition, biological functions, and diagnostic and therapeutic potentials. Biochim Biophys Acta. 2012;1820(7):940-948.
Colombo M, Raposo G, Thery C. Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles. Annu Rev Cell Dev Biol. 2014;30:255-289.
Doeppner TR, Herz J, Gorgens A, Schlechter J, Ludwig AK, Radtke S et al. Extracellular Vesicles Improve Post-Stroke Neuroregeneration and Prevent Postischemic Immunosuppression. Stem Cells Transl Med. 2015;4(10):1131-1143.
Kim HY, Kim TJ, Kang L, Kim YJ, Kang MK, Kim J et al. Mesenchymal stem cell-derived magnetic extracellular nanovesicles for targeting and treatment of ischemic stroke. Biomaterials. 2020;243:119942.
Zhang Y, Liu J, Su M, Wang X, Xie C. Exosomal microRNA-22-3p alleviates cerebral ischemic injury by modulating KDM6B/BMP2/BMF axis. Stem Cell Res Ther. 2021;12(1):111.
Rahmani A, Saleki K, Javanmehr N, Khodaparast J, Saadat P, Nouri HR. Mesenchymal stem cell-derived extracellular vesicle-based therapies protect against coupled degeneration of the central nervous and vascular systems in stroke. Ageing Res Rev. 2020;62:101106.
Castelli V, Antonucci I, d'Angelo M, Tessitore A, Zelli V, Benedetti E et al. Neuroprotective effects of human amniotic fluid stem cells-derived secretome in an ischemia/reperfusion model. Stem Cells Transl Med. 2021;10(2):251-266.
Condorelli G, Latronico MV, Cavarretta E. microRNAs in cardiovascular diseases: current knowledge and the road ahead. J Am Coll Cardiol. 2014;63(21):2177-2187.
Cai Y, Yu X, Hu S, Yu J. A brief review on the mechanisms of miRNA regulation. Genomics Proteomics Bioinformatics. 2009;7(4):147-154.
Lim PK, Patel SA, Gregory LA, Rameshwar P. Neurogenesis: role for microRNAs and mesenchymal stem cells in pathological states. Curr Med Chem. 2010;17(20):2159-2167.
Li Y, Chen X, Jin R, Chen L, Dang M, Cao H et al. Injectable hydrogel with MSNs/microRNA-21-5p delivery enables both immunomodification and enhanced angiogenesis for myocardial infarction therapy in pigs. Sci Adv. 2021;7(9).
Hu H, Wang B, Jiang C, Li R, Zhao J. Endothelial progenitor cell-derived exosomes facilitate vascular endothelial cell repair through shuttling miR-21-5p to modulate Thrombospondin-1 expression. Clin Sci (Lond). 2019;133(14):1629-1644.
Huang C, Luo W, Wang Q, Ye Y, Fan J, Lin L et al. Human mesenchymal stem cells promote ischemic repairment and angiogenesis of diabetic foot through exosome miRNA-21-5p. Stem Cell Res. 2021;52:102235.
Baglio SR, Rooijers K, Koppers-Lalic D, Verweij FJ, Perez Lanzon M, Zini N et al. Human bone marrow- and adipose-mesenchymal stem cells secrete exosomes enriched in distinctive miRNA and tRNA species. Stem Cell Res Ther. 2015;6:127.
Council NR. Guide for the Care and Use of Laboratory Animals. The National Academies Press. Washington (DC); 2011.
Li L, Chu L, Fang Y, Yang Y, Qu T, Zhang J et al. Preconditioning of bone marrow-derived mesenchymal stromal cells by tetramethylpyrazine enhances cell migration and improves functional recovery after focal cerebral ischemia in rats. Stem Cell Research & Therapy. 2017;8(1):112-121.
Thery C, Amigorena S, Raposo G, Clayton A. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. Curr Protoc Cell Biol. 2006;Chapter 3:Unit 3 22.
Broughton BR, Brait VH, Kim HA, Lee S, Chu HX, Gardiner-Mann CV et al. Sex-dependent effects of G protein-coupled estrogen receptor activity on outcome after ischemic stroke. Stroke. 2014;45(3):835-841.
Bederson JB, Pitts LH, Tsuji M, Nishimura MC, Davis RL, Bartkowski H. Rat middle cerebral artery occlusion: evaluation of the model and development of a neurologic examination. Stroke. 1986;17(3):472-476.
Ren H, Kong Y, Liu Z, Zang D, Yang X, Wood K et al. Selective NLRP3 (Pyrin Domain-Containing Protein 3) Inflammasome Inhibitor Reduces Brain Injury After Intracerebral Hemorrhage. Stroke. 2018;49(1):184-192.
Xie L, Wang J, Zhang Y, Chen H, Lin D, Ding J et al. The effects of local injection of exosomes derived from BMSCs on random skin flap in rats. Am J Transl Res. 2019;11(11):7063-7073.
Mastri M, Lin H, Lee T. Enhancing the efficacy of mesenchymal stem cell therapy. World J Stem Cells. 2014;6(2):82-93.
Tang Y, Zhou Y, Li HJ. Advances in mesenchymal stem cell exosomes: a review. Stem Cell Res Ther. 2021;12(1):71.
Liang B, Liang JM, Ding JN, Xu J, Xu JG, Chai YM. Dimethyloxaloylglycine-stimulated human bone marrow mesenchymal stem cell-derived exosomes enhance bone regeneration through angiogenesis by targeting the AKT/mTOR pathway. Stem Cell Res Ther. 2019;10(1):335.
Li X, Zhang Y, Wang Y, Zhao D, Sun C, Zhou S et al. Exosomes Derived from CXCR4-Overexpressing BMSC Promoted Activation of Microvascular Endothelial Cells in Cerebral Ischemia/Reperfusion Injury. Neural Plast. 2020;2020:8814239.
Sun XH, Wang X, Zhang Y, Hui J. Exosomes of bone-marrow stromal cells inhibit cardiomyocyte apoptosis under ischemic and hypoxic conditions via miR-486-5p targeting the PTEN/PI3K/AKT signaling pathway. Thromb Res. 2019;177:23-32.
Chen Q, Liu Y, Ding X, Li Q, Qiu F, Wang M et al. Bone marrow mesenchymal stem cell-secreted exosomes carrying microRNA-125b protect against myocardial ischemia reperfusion injury via targeting SIRT7. Mol Cell Biochem. 2020;465(1-2):103-114.
Wesley UV, Sutton IC, Cunningham K, Jaeger JW, Phan AQ, Hatcher JF et al. Galectin-3 protects against ischemic stroke by promoting neuro-angiogenesis via apoptosis inhibition and Akt/Caspase regulation. J Cereb Blood Flow Metab. 2021;41(4):857-873.
Ma R, Xie Q, Li H, Guo X, Wang J, Li Y et al. l-Borneol Exerted the Neuroprotective Effect by Promoting Angiogenesis Coupled With Neurogenesis via Ang1-VEGF-BDNF Pathway. Front Pharmacol. 2021;12:641894.
Hatakeyama M, Ninomiya I, Kanazawa M. Angiogenesis and neuronal remodeling after ischemic stroke. Neural Regen Res. 2020;15(1):16-19.
Viallard C, Larrivee B. Tumor angiogenesis and vascular normalization: alternative therapeutic targets. Angiogenesis. 2017;20(4):409-426.
Huang H, Bhat A, Woodnutt G, Lappe R. Targeting the ANGPT-TIE2 pathway in malignancy. Nat Rev Cancer. 2010;10(8):575-585.
Parker LH, Schmidt M, Jin SW, Gray AM, Beis D, Pham T et al. The endothelial-cell-derived secreted factor Egfl7 regulates vascular tube formation. Nature. 2004;428(6984):754-758.
Cho CH, Kim KE, Byun J, Jang HS, Kim DK, Baluk P et al. Long-term and sustained COMP-Ang1 induces long-lasting vascular enlargement and enhanced blood flow. Circ Res. 2005;97(1):86-94.
Babaei S, Teichert-Kuliszewska K, Zhang Q, Jones N, Dumont DJ, Stewart DJ. Angiogenic actions of angiopoietin-1 require endothelium-derived nitric oxide. Am J Pathol. 2003;162(6):1927-1936.
Nahar S, Ranjan N, Ray A, Arya DP, Maiti S. Potent inhibition of miR-27a by neomycin-bisbenzimidazole conjugates. Chem Sci. 2015;6(10):5837-5846.
Gu W, Zhan H, Zhou XY, Yao L, Yan M, Chen A et al. MicroRNA-22 regulates inflammation and angiogenesis via targeting VE-cadherin. FEBS Lett. 2017;591(3):513-526.
Lu Y, Wen H, Huang J, Liao P, Liao H, Tu J et al. Extracellular vesicle-enclosed miR-486-5p mediates wound healing with adipose-derived stem cells by promoting angiogenesis. J Cell Mol Med. 2020;24(17):9590-9604.
Ma S, Zhang A, Li X, Zhang S, Liu S, Zhao H et al. MiR-21-5p regulates extracellular matrix degradation and angiogenesis in TMJOA by targeting Spry1. Arthritis Res Ther. 2020;22(1):99.

Download PDF

Version 1

posted

You are reading this latest preprint version

Exosomes derived from bone marrow mesenchymal stem cells promote angiogenesis via transfer of miR-21-5p after cerebral ischemia in mice

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusions

Declarations

Abbreviations

References

Supplementary Files

Status:

Version 1