Human colorectal carcinoma derived HCT116 cell line
The human colorectal carcinoma derived HCT116 cell line used in this study were purchased from ATCC, and were passaged and stored in the laboratory. In this study, we used Only cells with less than 20 of passages for the experiments.
Cell culture and hypoxia treatment
HCT116 cells were cultured with Dulbecco's modified Eagle's medium (DMEM) (Wako, Cat #044-29765), supplying with 10% fetal bovine serum (FBS) (Life Technologies, Cat #F7524). FBS was heat-inactivated at 56℃ for 30 min. HCT116 cells were cultured in a humidified incubator (Thermo Fisher Scientific, MODEL #370, REL #1, S/N #310370-4133) with 5% CO2 at 37℃. For hypoxia treatment, the cells were precultured for 24 h, followed by culturing in hypoxia chamber (RUSKINN, UM-025, Version #2.0-_CSC2.01) with 1% O2, 5% CO2, and 94% N2 at 37℃ for specified time.
Collection of RNA and protein samples
For collection of RNAs samples, the cells were washed twice with phosphate-buffered saline (PBS) and then total RNA was isolated using RNAiso Plus (Takara, #9109) according to the manufacturer’s protocol. Where appropriate, genomic DNA included in RNA samples are removed by Recombinant DNase I treatment (Recombinant DNase I (Takara, #2270), DNase I Buffer (Takara, #2270), Recombinant RNase Inhibitor (Takara, #2313), 37℃, 1 h), and RNAs were purified using RNAiso Plus again. For collection of protein samples, intracellular proteins were collected using 2×SDS sample buffer (20% glycerol, 100 mM Tris-HCl (pH 6.8), 40 mg/mL SDS, 0.01% Bromophenol Blue, 12% 2-mercaptoethanol), followed by fragmentation of genomic DNAs using sonication (15 sec, three times) and heat denaturation (95℃, 5 min).
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
We reverse-transcribed appropriate amount of total RNA purified from cell lysate using 5×PrimeScript RT Master Mix (Takara, #9109) according to the manufacturer’s protocol, and then quantified expression level of individual genes by PCR using SYBR Premix Ex TaqⅡ (Perfect Real Time) (Takara, RR041) with the cDNA as templates. For the PCR, we used Thermal Cycler Dice Real Time system II (Takara, TP900) with 2 step PCR mode (95 ℃ for 5 sec, and 60 ℃ for 30 sec, 40 cycles). The Expression levels were quantified with ΔΔCt methods against corresponding control condition and internal control. Primer sequences used for the PCR are indicated in Table 1.
Table 1
Primer sequences for quantitative polymerase chain reaction
Gene symbol | Forward primer | Reverse primer |
GLUT1 | GGTTGTGCCATACTCA | CAGATAGGACATCCAG |
CA9 | CCTTTGCCAGAGTTGA | GCAACTGCTCATAGGC |
MMP1 | GAGATCATCGGGACAACTCTCCTT | GTTGGTCCACCTTTCATCTTCATCA |
HK1 | TGAACCGCCTGCGTGATA | AATGAGCCAGGGTCTCCTCT |
PFKL | CATCAGCAACAACGTCCCTG | GGCCAGGTAGCCACAGTAAC |
PKM | TCCAGGTGAAGCAGAAAGGT | TTCTTGCTGCCCAAGGAG |
ACTB | CCAACCGCGAGAAGAT | CCAGAGGCGTACAGGG |
SDS polyacrylamide gel electrophoresis (PAGE), SYPRO Ruby staining, and western plotting (WB)
Proteins samples collected from the cells were separated by SDS-PAGE with Mini-protean TGX Gels (BIO-RAD, Cat#4561086) or hand-made gels consisted of 3% stacking gel (for one large gel: ultrapure water 3.0 mL, 40% acrylamide bis mixed 0.34 mL, 4×wide range buffer 1.13 mL, 5% APS 90 µL, TEMED 9.0 µL) and 8% of separating gel (for one large gel: ultrapure water 5.4 mL, 40% acrylamide bis mixed 2.0 mL, 4×wide range buffer 2.5 mL, 5% APS 100 µL, TEMED 6.0 µL), subjected to SYPRO Ruby (Invitrogen, S12000) staining or WB. For SYPRO Ruby staining, the gel was incubated twice in 25 mL of fix solution (12.5 mL 100% methanol, 1.75 mL acetic acid in nuclease-free water) on shaker at RT for 15 min. Then we stained the gel with 25 mL of SYPRO Ruby in microwave for 15 sec, and incubated on shaker at RT for 3 min (avoid light); continued to heat the gel in microwave for 10 sec and incubated on shaker at RT for 3 min (avoid light); after that, heat the gel in microwave for another 10 sec and incubate on shake at RT for 30 min (avoid light). The SYPRO Ruby stained gel was washed with 25 mL wash solution (2.5 mL 100% methanol, 1.75 mL acetic acid in nuclease-free water) on shaker at RT for 30 min, and then stained proteins were detected with LAS 4000 mini (Fujifilm). For WB, the separated proteins are transferred on Immobilon-P PVDF membrane (Millipore, MA) with Trans-Blot SD Semi-Dry Transfer CeLL (Bio-Rad, #1703940) (0.05A, 45 min or 120 min). The membranes were incubated with antibodies diluted to corresponding dilutions (Table 2) at room temperature. Corresponding secondary antibodies are applied and then intensities of bands were detected with LAS 4000 mini.
Table 2
Properties and dilution of antibodies
Antibody | Class | Dilution | Supplier and Cat# |
Rabbit monoclonal anti-HIF1α | IgG | 1:1000 | Cell signaling technology, Cat#14179s |
Rabbit monoclonal anti-HK1 | IgG | 1:1000 | Cell signaling technology, Cat#2024s |
Rabbit monoclonal anti-PFKL | IgG | 1:1000 | Abcam, Cat#ab181064 |
Mouse monoclonal anti-PKM1/2 | IgG | 1:5000 | Cell signaling technology, Cat#3190s |
Mouse monoclonal anti-β-actin | IgG | 1:2000 | MBL, Cat#M177-3 |
Polyclonal anti-rabbit IgG/HRP | IgG | 1:5000 | Cell signaling technology, Cat#7074s |
RNA sequencing (RNA-seq) analysis
We sequenced 100 ng of total RNA samples purified from cell lysate using Nova-seq 6000 (Illumine). The sequencings were requested to Macrogen Japan (https://www.macrogen-japan.co.jp/). Briefly, poly(A)-tailed RNAs were enriched using oligo(dT)-conjugate beads, and qualities of the enriched poly(A)-tailed RNAs were assessed using Bioanalyzer (Agilent). The sequence libraries were prepared with TruSeq stranded mRNA Sample Prep Kit (Illumine, RS-122-2101), and then standard Illumina protocols were used to generate 150-bp paired end read libraries that were sequenced on the Nova-seq 6000 platform. Based on the RNA-seq data, we estimated expression level of individual genes. We used HISAT2 (ver. 2.1.0)76 with hg38 genomic sequences as references to align the sequenced fragments. The gene expression profiles were quantified using StringTie (ver. 1.3.4d)77,78. Both alignment and quantification of gene expression profiles were performed with default parameters of HISAT2 and StringTie tools.
Principal component analysis (PCA)
We performed PCA on the gene expression profiles estimated from the RNA-seq data and eRIC-MS data to identify latent variables in the data sets. PCA was performed using prcomp function in R with default parameters. Each dataset was standardized to make the mean and variance constant.
RNA digestion and HPLC measurement
We performed HPLC measurement according to a previous report79. Total RNAs purified from cell lysate were treated with DNase, followed by digestion to nucleotides (0.1 mM DL-Dithiothreitol solution (DTT) (Sigma-Aldrich, #3483-12-3), 13.8 mM MgCl2 (Wako, #136–03995), 34.6 mM Tris-HCl (pH 7.5) (Invitrogen, #15567027), 1.6U Alkaline Phosphatase (E. coli C75) (BAP) (Takara, #2120), 0.2U Phosphodiesterase I (Worthington, LS003926), 37℃ for 16 h). After purification, peaks of the nucleotides were determined using Prominence HPLC system (Shimadzu) with HPLC buffer A (3% acetonitrile (Wako, #015-08633), 0.1 M TEAA (Wako, #202–02646)) and HPLC buffer B (900 mL acetonitrile (Wako, #015-08633), and 100mL ultrapure water). Concentration of the nucleotides and nucleotide analogs were quantified based on area of the peaks.
Alkylation of 4sUracil
We alkylated the 20 µg of 4sUracil by reacting with 10 mM of IAA under optimal conditions (50% DMSO (SIGMA #D-8418), 10 mM iodoacetamide (Wako #095-02151), 50 mM sodium phosphate buffer pH8.0 (1M NaH2PO4 (Nacalai Tesgue #317 − 18) 4.66 mL, 1M Na2HPO4 (Wako #196–02835) 340 µL, up to 10mL with UltraPure Distilled Water (Invitrogen #10977-015)), for 15 min at 50℃). The reaction was halted by adding 100 mM of DTT, and the spectrum of absorbance was measured using e-Spect (Malcom). The absorbance at 400 nm of wavelength was measured as the reference wavelength.
SLAM-seq
RNA labeling and IAA treatment
We seeded HCT116 cells with 7.5×104 cells/mL of concentration on 12 well plate (Thermo Scientific #150628). Following 24 h of preculture, we cultured the cells under normoxic and hypoxic condition for 36 h. We added final concentration of 100 µM 4sU into the culture medium to label newly synthesized RNAs. The cells were collected after 0, 1, 2, 4, 8, 12 h after the 4sU addition, and the total RNAs were purified. We alkylated the 20 µg of total RNA by reacting with 10 mM of IAA under optimal conditions (50% DMSO (50% DMSO (SIGMA #D-8418), 10 mM iodoacetamide (Wako #095-02151), 50 mM sodium phosphate buffer pH8.0 (1M NaH2PO4 (Nacalai Tesgue #317 − 18) 4.66 mL, 1M Na2HPO4 (Wako #196–02835) 340 µL, up to 10mL with UltraPure Distilled Water (Invitrogen #10977-015)), for 15 min at 50℃). Quality of the total RNAs were assessed after ethanol precipitation. We requested DNA Tech (https://dnatech.genomecenter.ucdavis.edu/) to provide the total RNA to QuantSeq analysis. The QuantSeq analysis were performed twice for each sample.
Detection of T-to-C conversion by SLAMDUNK tool
We quantified the expression level and newly synthesized RNA level based on the QuantSeq data of each time point using SLAMDUNK tool (ver. 0.3.3)41, a pipeline for analysis of SLAM-seq data. Since QuantSeq sequences 3’ end of RNA in poly(A)-dependent manner, we aligned the QuantSeq data to comprehensive 3’ untranslated regions (3’UTRs) sequences generated based on human genome sequences and annotation (hg38) obtained from Ensemble database (release 92)80. We performed the alignment with default parameters of the SLAMDUNK tool. Briefly, we trimmed twelve bases from the 5’ end as adaptor-clipped reads, and then removed four and more subsequent adenines from the 3’ end as remaining poly(A)-tail. VarScan (ver. 2.4.1)81 included in the SLAMDUNK tool regards a mismatch as a SNP when it has 0.8 and more of variant fraction and 10-fold and more coverage cutoff. Through these filters, we counted total number of reads and the number of those including T-to-C conversions aligned on the 3’ UTRs of individual genes. Since 4sU pairs with guanine (G) during reverse transcription instead of adenine (A), the 4sU-labeled reads were identified as those including T-to-C conversions. Since QuantSeq generates one read from one RNA, the number of reads including and not including T-to-C mutations correspond to the numbers of 4sU-labeled and unlabeled RNAs, respectively. Therefore, we counted the numbers of reads and those including T-to-C conversion corresponded to each gene, and normalized as count per million (CPM).
Identification of RNAs in a steady state
To remove the cells whose expression is fluctuated by biological or mechanical effect during 4sU labeling, we extracted the genes in a steady state with the procedure we developed previously46. Briefly, since the expression of a gene in a steady state changes dependent on only white noise, the sum of angles (SoA) formed by the lines connecting each time point is relatively small, whereas the SoA values in a differentially expressed gene (DEG) with a constant trend is relatively large. We calculated the SoA values from the angles formed by the lines connecting certain time points and neighboring ones, within a time series of expression level for each gene. Then, we calculated empirical p-values of the SoA by comparing those when all time points are randomly rearranged. We calculated FDR from the empirical p-values using Storey's procedure82. The genes whose FDR values are less than 0.001 were identified as genes in a steady state.
Identification of DEGs using paired t-test
We identified DEGs based on CPM of individual RNAs inferred from the SLAM-seq data. To avoid effect of 4sU labeling of gene expression, we tested differences in gene expression levels in cells in normoxia and hypoxia with paired t-test for each time point. Based on the p-values, we calculated FDR using Storey procedure82. Among the genes expressed in all time points, we identified the genes whose FDR are less than 0.01 as DEGs.
Inference of RNA synthesis and degradation rates
According to Eqs. 1 and 2, expression level of RNA is determined as ratio of RNA transcription rate, \({k}_{s}\), and degradation rate, \({k}_{d}\), and increase curves of 4sU-labeled RNAs depend on \({k}_{d}\). Therefore, fitting of the time series of 4sU-labeled RNAs on Eq. 1 enables us to infer \({k}_{s}\) and \({k}_{d}\) values. For RNAs derived from genes in steady states, we obtained the \({k}_{s}\) and \({k}_{d}\) values by fitting of the time series of 4sU-labeled RNAs on Eq. 1 according to previous report46, in genome-wide manner. Briefly, we performed fitting by combining an evolutionary algorithm (genetic algorithm) and hill climbing (L-BFGS-B algorithm), and evaluating with the least squares method in Python 2.7. The genetic algorithm was implemented using the DEAP library83 with a generation number of 200, population number of 50, crossover probability of 0.5, and mutation probability of 0.2. The L-BFGS-B algorithm was implemented using the minimize module in the SciPy package, in which the parameters estimated by the genetic algorithm are given as initial parameters. The fitness in each gene was evaluated as the correlation of actual newly synthesized RNA levels with estimated values. The probability of the null hypothesis that a population correlation coefficient is equivalent to zero was calculated for each gene using the OLS module in the StatsModels package84, and the \({k}_{s}\) and \({k}_{d}\) values of the genes whose FDR as determined by Storey's procedure82 was less than 10− 5 were extracted.
Functional enrichment analysis
For functional enrichment analysis of focused genes and protein, we performed functional enrichment analysis using DAVID tool (ver. 6.8) (https://david.ncifcrf.gov/). As functional term, we utilized Biological Process (GOTERM_BP_DIRECT), Cellular Component (GOTERM_CC_DIRECT), Molecular Function (GOTERM_MF_DIRECT), UniProt keywords (UP_KEYWORDS), and KEGG pathway (KEGG_PATHWAY). The p-values indicating enrichment were calculated based on modified hypergeometric test85,86. We selected optimal gene list as the background. The functional terms whose FDR values are less than thresholds were identified as those significantly enriched.
GSEA
The relationship between the biological function of genes and \({\rho }_{d}\) values, contribution of RNA degradation rate on differential expression, were examined using GSEA (ver. 4.0.3)51. For each individual gene, 1 was used as the control value and genes were ranked based on the ratio of the \({\rho }_{d}\) value to the control (i.e., the original \({\rho }_{d}\) value). Enrichment score (ES) for each term in the GSEA hallmark was calculated using default parameters, and compared with the distribution of ES values for random set of 10,000 genes to calculate empirical p-values. The empirical p-values were corrected as FDR. The terms whose FDR values are less than 0.05 were identified as those significantly enriched.
Lactate assay
Intracellular lactate was quantified using Lactate Assay Kit-WST (Doujin, #343–09281). The HCT cells were cultured in corresponding conditions with six of replicates and the medium were removed, and cell lysates were prepared with 0.1% Triton solution. We then added 20 µL of lactate standard solution and 80 µL of working solution to 20 µL of the cell lysate, followed by incubation on 37℃ for 30 minutes. The absorbance at 450 nm of wavelength was measured using an absorbance microplate reader (Tecan).
eRIC-MS
Coupling of the capture probe to Dynabeads
Dynabeads™ MyOne™ Carboxylic Acid (Invitrogen, #65012) was washed with double volumes of 100 mM MES (pH 4.8) and vortexed for 5 to 10 sec. We removed the supernatant with a magnet stand and resuspended the Dynabeads in 30 µL of 100mM MES (pH 4.8). Based on previous reports87, we utilized HPLC purified capture probe consisted of primary amine and C6 linker, followed by 20 thymidine nucleotides, in which every other nucleotide is a locked nucleic acid (LNA) (Exiqon); /ssH5AmC6-LNA10T10/T(L)TT(L)TT(L)TT(L)TT(L)TT(L)TT(L)TT(L)TT(L)TT(L)T (T(L): LNA thymidine, T: DNA thymidine)88. We prepared the LNA oligo(dT) to 97.2 µL/sample with 10.8 µL of 1M MES (pH 4.8) and 27 µL of 500mg/mL N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC) (Sigma-Aldrich, #E7750). The LNA oligo(dT) was coupled on Dynabeads by gently rotating mixture of 600 µL of Dynabeads slurry (10 mg/mL) and 97.2 µL of LNA oligo(dT) (200 µM) at room temperature for 3 h. The Dynabeads were then washed with two volumes of 250 mM Tris buffer (pH 8.0) and 0.01% Tween 20 for more the 30 min twice. The LNA oligo(dT) coupled Dynabeads were stored in 0.1% PBS-Tween at 4 ℃.
UV crosslink
The medium culturing HCT116 cells on the 15 cm dish was removed and cells were washed with 10 mL cold PBS for twice. To avoid effect of exposure on normoxic environment, the hypoxia treated cells were sealed with hybrid-bag after removing the PBS completely in the hypoxia chamber, and transferred from the chamber. For normoxia treated cells, hybrid-bag was also used in UV crosslink. 2,000 mJ/cm2 of UV was used in crosslink and irradiation was omitted in controls without UV crosslink (without UV). Immediately before sample collection, we added 1.0 mM DTT (Sigma-Aldrich, #43816) and 0.5 U/µL of recombinant RNase inhibitor (RRI) (Takara, #2313B) into prepared lysis buffer (10 mM Tris-HCl (pH 7.5) (Invitrogen, #15567027), 10 mM NaCl, 0.02% (w/v) Digitonin (Fujifilm, 043-21371), 1 mM EDTA pH 8.0 (Invitrogen, MA)). After irradiation, we opened the sealed hybrid-bag were, and kept the irradiation cell on ice. We then added 2.0 mL of cold hypo lysis buffer and collected cells with scraper (Corning). The cell lysates were mixed for 10 times and transferred into 5 mL centrifuge tubes. Cell lysates from two of 15 cm dishes were collected for one eRIC-MS sample. Above operations were done on ice quickly.
Capture of RNA-RBP conjugations
Cell lysates were mixed by inversion at 4 ℃ for 10 min. Cell lysates were then centrifuged at 1,000 g for 5 min at 4 ℃ to remove the nucleolus, the supernatants were transferred to new tubes, and continued to centrifuge at 15,000 g for 5 min at 4 ℃ to remove the organelles like mitochondria. We transferred the supernatants to new tubes and added 500 mM of lithium chloride (LiCl) (Sigma-Aldrich, #L9650), and inverted tubes completely before adding 0.5% lithium dodecyl sulfate (LiDS) (Sigma-Aldrich, #L9781). The mixture was Incubated at 60 ℃ for 15 min, and quickly cooled down on ice for 5 min. The mixtures were clarified with centrifuge at 15,000 g for 5 min at 4 ℃ and the supernatants were transferred into new tubes. We stored 40 µL and 50 µL supernatants as input for later RNA and protein analysis, respectively, and DTT was added to the remaining supernatants for a final concentration to be 5 mM. The remaining supernatants were mixed with the LNA oligo(dT) coupled Dynabeads washed with five volumes of the hypo lysis buffer for 3 times before usage, and gently rotated at 40 ℃ for 1 h to capture RNA-protein complexes.
Elution of RNA-RBP complex
We collected the Dynabeads capturing the RNA-protein complexes with a magnetic stand, and transferred supernatants to new tubes for later analysis. Beads were subjected to successive rounds of washes with wash buffer 1 (20 mM Tris-HCl (pH 7.5), 500 mM LiCl, 1 mM EDTA, 5 mM DTT, and 0.1% (w/v) LiDS), wash buffer 2 (20 mM Tris-HCl (pH 7.5), 500 mM LiCl, 1 mM EDTA, 5 mM DTT, and 0.02% (v/v) NP40), and wash buffer 3 (20 mM Tris-HCl (pH 7.5), 200 mM LiCl, 1 mM EDTA, 5 mM DTT, and 0.02% (v/v) NP40) for twice with gentle rotation at 40 ℃ for each 5 min. Pre-elution was performed in 440 µL nuclease-free water at 40 ℃ for 5 min. Afterwards, the beads suspension was divided into two groups: 400 µL of RNase-mediated elution for protein analysis; and 40 µL of heat-mediated elution for RNA/DNA analyses. For RNase-mediated elution, beads were resuspended in 400 µL of RNase buffer (0.25 µL of RNase mixture in 400 µL nuclease-free water; RNase mixture: 1 µg/µL RNase A, 40 U/µL RNase T1, 50 mm Tris (pH 7.0), 50 mm NaCl (Invitrogen, #AM9759), and 50% glycerol), and incubated at 37 ℃ for 30 min. For heat-mediated elution, beads were resuspended in 40 µL nuclease-free water, and incubated at 95 ℃ for 5 min. We took the supernatants immediately after beads were collected with a magnetic stand. To confirm the effect of above elution, heat-mediated second elution was conducted with above two groups. After that, stored all samples at -80 ℃.
MS measurement
Following a confirmation that ribosomal RNAs were removed from the heat-mediate elution using BioAnalyzier, and that no abnormalities such as contaminants occurs from a part of the RNase-mediate elution using SDS-page and SYPRO Ruby staining, the SDS in the RNase-mediate elution samples was removed using the methanol–chloroform protein precipitation method. Briefly, four volumes of methanol, one volume of chloroform, and three volumes of water were added to the eluted sample and mixed thoroughly. The samples were centrifuged at 15,000 rpm for 10 min, and the water phase was removed carefully, and then four volumes of methanol was added to the samples, and the samples were centrifuged at 15,000 rpm for 10 min. After that, the supernatant was removed and the pellet was washed with 100% ice-cold acetone once. The precipitated protein was re-dissolved in guanidine hydrochloride and reduced with Tris (2-carboxyethyl) phosphine hydrochloride, alkylated with iodoacetamide, followed by digestion with lysyl endopeptidase and trypsin. The digested peptide mixture was applied to a Mightysil-PR-18 (Kanto Chemical) frit-less column (45×0.150 mm ID), and separated using a 0–40% gradient of acetonitrile containing 0.1% formic acid for 80 min at a flow rate of 100 nL/min, and the eluted peptides were sprayed into a mass spectrometer (Triple TOF 5600+; AB Sciex) directly. MS and MS/MS spectra were obtained using the information-dependent mode. Up to 25 precursor ions above an intensity threshold of 50 counts/sec were selected for MS/MS analyses from each survey scan. All MS/MS spectra were searched against protein sequences of the RefSeq (NCBI) human protein database (RDB) using Proteome discoverer 2.2, and decoy sequences were then selected with FDR < 1%.
Identification of RBPs
RBPs reliably binding to poly(A)-tailed RNAs were identified by comparing eRIC-MS data from same condition with irradiation (with UV) and without irradiation (without UV). Among the peptides detected in both of with and without UV, signal intensities of those with two and more unique peptides number, using one-side Mann–Whitney U test. The p-values are corrected as FDR with Storey’s procedure82. To compensate lower detection power of Mann-Whitney U test, a non-parametric test, we adapted 5% as threshold of the FDR. RBPs including one and more peptides with FDRs less than the threshold were considered as those reliably binding to poly(A)-tailed RNAs. Note that, among the twelve samples (triplication for four conditions), one sample from group of “hypoxia with UV” and the other from group of “normoxia without UV” were excluded from later analysis because of lower reproducibility. Abundance of the RBPs were estimated as the value of signal intensity with the total normalized to 1,000,000.
Hypergeometric test to extract RBPs targeting stabilized glycolytic mRNAs
The glycolytic mRNAs were identified based on Reactome56–58, a database for biological pathways (https://reactome.org/download/current/Ensembl2Reactome_All_Levels.txt). The data obtained from Reactome database contains Ensembl gene IDs and relating biological pathways. We extracted entries corresponded to Ensembl gene IDs as whole transcriptome (background) of the hypergeometric test. Among these entries, we identified the entries corresponded to “Glycolysis” as glycolytic mRNAs (named as “Reactome mRNAs”), and extracted those whose \({k}_{d}\) values were decreased in chronic hypoxia condition compared with normoxia as stabilized Reactome mRNAs. For each RBP included in ENCODE, a database of functional elements of human genome59, we corresponded target RNAs and calculated p-value for enrichment of the stabilized Reactome mRNAs included in the targets against the background with hypergeometric test. Based on the p-values, we calculated FDR using Storey procedure82.
Depletion assay
HCT116 cells were seeded in 24-well plates at concentration of 2.5×104 cells/well with DMEM (Wako, Cat# 044-29765) supplying with 10% FBS ((Life Technologies, Cat# F7524), and incubated appropriate time in the humidified incubator (Normoxic condition) or in the hypoxia chamber (hypoxic condition). 1 µM of siRNAs (Table 3) were transfected into the HCT116 cells by using Opti-MEM (Gibco, Cat# 31985-070) and Lipofectamine RNAimax Reagent (Invitrogen, REF# 13778-500) according to manufacturer's protocol, followed by 48 h of incubation. The cells were washed twice with PBS and then total RNA was isolated using RNAiso Plus (Takara, #9109) according to the manufacturer’s protocol. Expression level of individual genes were quantified as described above, following the reverse-transcription.
Table 3
siRNAs used in this study
Target | # | Merchandise | siRNA ID | Cat # |
IGF2BP2 | #1 | Thermo Fisher, silencer select siRNA | s20923 | 4427037 |
IGF2BP2 | #2 | Thermo Fisher, silencer select siRNA | s20922 | 4427037 |
FMRP | #1 | Thermo Fisher, silencer select siRNA | s53175 | 4392420 |
FMRP | #2 | Thermo Fisher, silencer select siRNA | 556458 | 4399665 |