Zebrafish maintenance. Four-month-old AB strain zebrafish were purchased from Shanghai FishBio Co., Ltd. (Shanghai, China). Feeding was carried out under standard conditions of temperature (28 ± 0.5°C) and pH (7.0 ± 1.0) under 14 hours of light/10 hours of darkness (Sprague, Bayraktaroglu et al. 2008). This study was approved by the Ethics Committee of the Experimental Animal Center of North China University of Science and Technology (Number: LX2021079). Before the start of the exposure experiment, zebrafish purchased from the company will be domesticated in a laboratory environment for 15 days to adapt to the laboratory environment, during which the zebrafish mortality rate is less than 1%.
Chemical treatments.ROV capsules and PRA capsules were purchased from Lunanbeite Pharmaceuticals Co., Ltd., (Linyi, China) and Lizhu Group Lizhu Pharmaceutical Factory (Zhuhai, China). Zebrafish (six in each group) were randomly placed in a 3 L fish tank and exposed to ROV solution (0.05, 0.5, 5 mg/L) or PRA solution (0.1, 1, 10 mg/L) for 48 h. The exposure solution was completely replaced every 24 h to reduce the impact of zebrafish excreta on the experiment, while maintaining a constant drug concentration. There was no zebrafish death during the experiment. After 48 h of exposure experiment, the quality and length of zebrafish did not change significantly compared with that before the exposure experiment. During the experiment, the activity and alertness of zebrafish were not significantly reduced compared with the control group. The choice of exposure concentration was based on the following two considerations: the low concentration was based on the concentration of statins detected in surface water, river water and wastewater (Conley, Symes et al. 2008, Lee, Peart et al. 2009, André, Liliana J G Silva et al. 2015). The high concentration was determined according to preliminary experiments, mainly considering whether it was sufficient to cause obvious oxidative damage in the liver of zebrafish, which would be helpful to explore the molecular mechanism of the antioxidant effect caused by ROV and PRA. After 48 h of ROV and PRA exposure, zebrafish exposed to different concentrations of statins for 48 h were fished out and euthanised by placing the zebrafish on ice for 20 min (Wallace, Bright et al. 2018). Death of zebrafish was determined when the gill covers stopped moving and the mouth of the fish stopped moving closed. After that, the zebrafish was quickly placed under the body microscope (Sunny Optical Technology (Group) Co., Ltd., Yuyao, China), the zebrafish was dissected with medical anatomical tools, and the liver of the zebrafish was taken out and placed in a pre-cooled centrifuge tube for use.
ROS determination. The changes of ROS in zebrafish liver were measured using a commercial kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The dissected zebrafish liver was placed on a nylon mesh and washed with PBS. The cell suspension was collected and centrifuged at 500 × g for 10 min, then the cells were resuspended with diluted DCFH-DA and incubated at 37℃ for 30 minutes. After incubation, the single cell suspension was collected and centrifuged at 1000 × g for 10 min. The supernatant was removed to collect the cell pellet, which was washed twice with PBS to fully remove DCFH-DA that did not enter the cells. After centrifugation at 1000 × g for 5 min, the cell pellet was collected for fluorescence detection. The collected cell pellet was resuspended in PBS, and the cell suspension was added to a black 96-well plate. The fluorescence intensity was measured using a microplate reader, with excitation and emission wavelengths of 488 nm and 525 nm, respectively.
Antioxidant responses. The weight of zebrafish liver tissue was accurately weighed. According to the ratio of weight (g) : volume (mL) = 1:99, 99 times the volume of PBS was added and diluted to create a 1% tissue homogenate. The homogenate was mechanically homogenized with a hand-held homogenizer in an ice water bath, then the homogenates were centrifuged at 3000g for 10 min at 4℃. The supernatant was transferred to a clean test tube, and the enzyme activity (CAT, SOD, CuZn-SOD, GPx and GST), as well as the GSH and MDA content, were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
Gene expression analysis. Total RNA was extracted from zebrafish liver tissue using a tissue RNA rapid extraction kit from Beijing Juhemei Biotechnology Co., Ltd. (Beijing, China). The concentration of total RNA was determined using an ultramicro spectrophotometer (Beijing Kaio Technology Development Co., Ltd., Beijing, China). RNA integrity was determined by electrophoresis analysis of 28S and 18S rRNA subunits. The brightness ratio of ribosomal RNA bands was approximately 2:1. Primers were designed using Primer Premier 5.0 (http://www.premierbiosoft.com) software. All gene primer information is shown in Table 1, with β-actin as the internal reference gene. The primers were synthesized and purified by Beijing Ruiboxingke Biotechnology Co., Ltd. (Beijing, China), and frozen at -80°C, then diluted to the required concentration with RNase-Free water. A 2× M5 HiPer SYBR Premix ExTaq kit from Beijing Juhemei Biotechnology Co., Ltd. was used to configure a 20 μL qRT-PCR reaction system with three replicates in each group. The Applied Biosystems 7500 system (Foster City, CA, USA) was used for qRT-PCR. Finally, the relative gene expression was calculated by the 2-ΔΔCt method (Livak and Schmittgen 2001).
Table 1 qRT-PCR primer sequences used in this study
Gene name
|
Forward primer (5'-3')
|
Reverse primer (5'-3')
|
β-actin
|
CGAGCAGGAGATGGGAACC
|
CAACGGAAACGCTCATTGC
|
Cat
|
AGGGCAACTGGGATCTTACA
|
TTTATGGGACCAGACCTTGG
|
Sod
|
GTCCGCACTTCAACCCTCA
|
TCCTCATTGCCACCCTTCC
|
Gpx
|
AGGCACAACAGTCAGGGATT
|
CAGGAACGCAAACAGAGGG
|
Nrf2
|
TCGGGTTTGTCCCTAGATG
|
AGGTTTGGAGTGTCCGCTA
|
Pi3k
|
AAGTTGTGAGCCCAGTCCA
|
GTTCATACCGTTGTTAGCG
|
Western blot analysis. Total protein was extracted from the dissected zebrafish liver using RIPA lysis buffer (Beijing Pulilai Gene Technology Co., Ltd., Beijing, China). Each well was loaded with 50 μg of protein, separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to a polyvinylidene difluoride (PVDF) membrane by electroblotting, and then blocked with 5% skimmed milk at room temperature for 2 h. Diluted Nrf2 and SOD (GeneTex, Irvine, CA, USA) primary antibodies were added and incubated overnight at 4℃ on a shaker, and then diluted secondary antibodies were added and incubated at room temperature for 2 h. The labeled protein was detected using ECL luminescent liquid (Zhao, Wang et al. 2020). Finally, Image J software (NIH, Bethesda, MD, USA) was used to standardize the gray value of the target protein to GAPDH expression.
Western blot analysis after treatment with 740Y-P.In order to further verify whether ROV and PRA regulate the antioxidant system in zebrafish liver through the PI3K/Nrf2/ARE signaling pathway, we used 740Y-P, an activator of PI3K (Yimeng Wang, Tianli Tang et al. 2023). The 740Y-P stock solution was prepared with dimethyl sulfoxide (DMSO; Sinopharm Chemical Reagent Co. Ltd., Shanghai, China) and diluted to the final concentration with zebrafish aquaculture water immediately before use. The final concentration of DMSO in the experimental solution was not more than 0.01%. The expression of Nrf2 and SOD in zebrafish liver was analyzed by western blotting following treatment with 200 μg/L of the PI3K activator 740Y-P (MedChemExpress, Monmouth Junction, NJ, USA).
Homology modeling and molecular docking. The zebrafish PI3K (zfPI3K) protein was predicted by Swiss-model (https://swissmodel.expasy.org) (PDB ID:5FI4) (Wu, Huang et al. 2019, Mendonca-Gomes, da Costa Araujo et al. 2021). AutoDock vina1.1.2 (https://autodock.scripps.edu) software was used to simulate the binding of ROV and PRA to zebrafish PI3K protein. The specific docking operation was performed as described in a previous report by Zhao et al. (Zhao, Wang et al. 2020).
Statistical analysis. All data in the present study were reported as the mean ± SEM. Significant differences between the treatment group and the control were evaluated by one-way analysis of variance (ANOVA) followed by Dunnett's post-hoc test using GraphPad Prism 8.3.0 software (GraphPad Software Inc., San Diego, CA, USA). p < 0.05 indicates that any differences were statistically significant (*p < 0.05,**p < 0.01).