Preparation of Acacia glauca leaf extract
Fresh leaves of Acacia glauca were collected from a tree in the garden of the College of Science, University of Anbar, Iraq, in March 2023. The leaves were left to dry in the open air, then cleaned and ground using a pestle and mortar. Next, 10 g of Acacia glauca leaf powder was dissolved in 90 mL of distilled water on a magnetic stirrer for 3 hours. The resulting extract was filtered using Whatman filter paper (No. 1), then sealed in airtight vials and stored at 4°C.
Biosynthesis of chitosan-silver nanoparticles
Chitosan-coated silver nanoparticles (Ch-AgNPs) were synthesized following the method described in previous studies with some modifications (Hassan et al. 2020; Mutter and Hassan 2024). Briefly, 5 mL of previously prepared Acacia glauca leaf extract was added to 15 mL of 0.1% chitosan and 80 mL of 20 mM AgNO3, followed by heating at 80 °C on a magnetic stirrer for 30 minutes. The initial formation of Ch-AgNPs was detected by a color change from yellow to dark brown.
Characterization of Ch-AgNPs
The optical properties of Ch-AgNPs were evaluated by UV-vis spectroscopy. The properties of the functional groups were detected by monitoring the spectral bands with FTIR. TEM estimated the morphological characteristics (size and shape). FESEM was used to capture the microstructure of the nanomaterials. XRD was used to estimate the crystal and molecular structure, particle size, and degree of crystallinity. Zeta potential was performed to determine the surface charge and understand the degree of nanoparticle stability.
Bacterial sample
Staphylococcus aureus isolates were obtained from various clinical sources at Ramadi Teaching Hospital, Iraq. Isolates were identified using routine microbiological and biochemical tests, and the diagnosis was confirmed using the VITEK-2 compact system. Isolates were subjected to molecular screening with conventional PCR using the specific primers listed in Table 1 to detect housekeeping genes (16srRNA and gyrb), quorum sensing genes (RNAIII, AgrA, and AgrB), and some virulence genes. (mecA, coa, rot, spa, hla, and psm). One isolate that contained all the tested genes was selected for the gene expression study, as shown in Figure 7.
Table 1. Primers used in this study.
Gene
|
Primers' Sequences (5'→3')
|
Size product (bp)
|
References
|
RNAIII -F
RNAIII -R
|
GCACTGAGTCCAAGGAAACTAAC
AAGCCATCCCAACTTAATAACC
|
82
|
Jing et al. 2022
Wang et al. 2023
|
agrA -F
agrA -R
|
TCCAGCAGAATTAAGAACTCG
ATATCATCATATTGAACATACACT
|
141
|
Jing et al. 2022
Wang et al. 2023
|
agrB -F
agrB -R
|
GCCCATTCCTGTGCGACTTA
GGGCAAATGGCTCTTTGATG
|
101
|
Jing et al. 2022
|
psm -F
psm -R
|
TATCAAAAGCTTAATCGAACAATTC
CCCCTTCAAATAAGATGTTCATATC
|
176
|
Jing et al. 2022
|
hla -F
hla -R
|
AAAAAACTGCTAGTTATTAGAACGAAAGG
GGCCAGGCTAAACCACTTTTG
|
95
|
Jing et al. 2022
Gao et al. 2022
|
spa -F
spa -R
|
CAGCAAACCATGCAGATGCTA
GCTAATGATAATCCACCAAATACAGTTG
|
100
|
Jing et al. 2022
Gao et al. 2022
|
coA -F
coA -R
|
CACAACCAGTTGCACAACCATTA
GGGACCTTGAACGATTTCACC
|
125
|
Matias 2015
|
Rot -F
Rot -R
|
ATTTTGCAATTAGAAACACTTTTGG
TCTTCTCTAGACATTTTGTATTCGCTTT
|
83
|
Cheung et al. 2011
|
mecA -F
mecA -R
|
TCCAGATTACAACTTCACCAGG
CCACTTCATATCTTGTAACG
|
162
|
Cheung et al. 2014
|
Antibacterial activity of Ch-AgNPs
Minimum Inhibitory Concentration (MIC) of Ch-AgNPs
The Resazurin Microtiter-Plate Assay (REMA) was performed as described by Coban (2012), with some modifications as follows: 100 µl of Muller-Hinton broth was added to each of the 96 wells of the microtiter plate. 100 µl of silver nanoparticles was added to the first row, then serial dilution was done by pipetting and transferring 100 µl from the first well to the others, respectively, except for the last row (control) to make decreasing concentrations (1/2, 1/4, 1/8, 1/16, 1/32, 1/64, and 1/128). 20 µl of overnight culture bacterial suspension was added to each well; for the control row, only the first four wells had bacterial suspension, while the others remained without. The microtiter plates were covered with a lid and wrapped in parafilm, then incubated for 24 hours at 37 °C. After incubation, 10 µl of Resazurin solution was added to each well, then re-incubated for 2 hours, and a color change was observed (purple and pink). The results were recorded by observing the color change; the MIC value was recorded for the well with the lowest concentration without changing the resazurin color.
Growth curve
The growth rate of S. aureus was measured according to Hall et al. (2013). In addition to the control, bacterial cultures were grown in flasks with nutrient broth and incubated overnight. The next day, two concentrations of silver nanoparticles (2.1 μg/mL and 1.05 μg/mL) were added to each flask except the control group and then incubated in a shaking incubator with adequate aeration for a specified time. After each interval, cultures were transferred to a sterile spectrophotometer cuvette to measure OD. The optical density was recorded over time and plotted to measure the growth rate.
Gene Expression by qRT-PCR
To study the effect of Ch-AgNPs on the expression of quorum sensing and virulence genes in S. aureus, the isolate was cultured on an LB medium with a sub-inhibitory concentration of Ch-AgNPs and incubated overnight at 37 °C.
RNA was extracted using the TransZol Up Kit (TRANS China). The EasyScript® One-Step GDNA Removal and cDNA Synthesis Super-Mix (Trans/China) kit was used. The reaction components of cDNA synthesis were 10µl of 2xEX reaction mix, 7µl of mRNA, 1µl RT enzyme, 1µl gDNA remover, 1µl random primer, 1µl Oligo (dT) primer, and 3µl RNase-free water. The PCR program for cDNA synthesis was at 25 °C for 10 min., 42 °C for 15 min., 85 °C for 5 sec., and 4 °C for holding, respectively.
The reaction components and volumes of RT-PCR were 10µl of 2xEasyScript PCR Super Mix, 2µl of cDNA, 2µl of (FandR) primers, and 6µl of Nuclease-free water. Each reaction for each gene was done with two replicates.
The program of Real-time PCR by the Rotor-Gene Q device was done in 35 cycles with three basic steps: firstly, denaturation at 94 °C for 10 sec., annealing at 58 °C for 15 sec., and eventually extension at 72 °C for 20 sec. The annealing temperature was set for each gene, as shown in Table 1. The housekeeping gene (gyrb) was used as an internal control. Relative changes in gene expression were analyzed using the gene expression fold (2ΔΔCt) method described in Livak and Schmittgen (2001).
Statistical analysis
The data was presented as mean ± standard deviation. A one-way ANOVA test was performed, considering p-values less than 0.05 as statistically significant. The SPSS software was utilized for data analysis.