Expression profiling of galactinol synthase genes in Coffea arabica L. in response to Hemileia vastatrix infection

doi:10.21203/rs.3.rs-4289467/v1

Download PDF

Research Article

Expression profiling of galactinol synthase genes in Coffea arabica L. in response to Hemileia vastatrix infection

https://doi.org/10.21203/rs.3.rs-4289467/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Galactinol synthase (GolS; EC 2.4.1.123) is an enzyme that plays crucial roles in various plant species under different stress conditions. Few studies have evaluated the expression of the galactinol synthase (GolS) gene under biotic stress conditions. Here, we report the transcriptional profiles of galactinol synthase genes (CaGolS) and RFOs (Raffinose Family of Oligosaccharides) abundance in two contrasting cultivars of Coffea arabica L. (IAPAR59, resistant and Catuaí Vermelho IAC 99, susceptible) infected with Hemileia vastatrix (coffee leaf rust), one of the most destructive fungal diseases in coffee crops worldwide. RT-qPCR results showed distinct transcriptional regulation of three CaGolS genes in leaves infected with H. vastatrix race II at 0, 12, 24, and 48 h post-inoculation. CaGolS1 was upregulated (12 and 24 h) in response to the pathogen infection in the susceptible genotype, while CaGolS2 was downregulated in both genotypes at all sampling times, notably in the susceptible one. CaGolS3 showed a very weak expression level in the leaves of the susceptible genotype. The findings of this study justify further research into the association of RFOs with the response of Arabica coffee plants to H. vastatrix infection using a large panel of resistant and susceptible genotypes.

Biotic stress

coffee leaf rust

pathogen

raffinose oligosaccharide family

Worldwide, Coffea arabica L. crops are affected by different diseases, such as cercospora leaf spot (Cercospora coffeicola Berk. & Cooke), phoma leaf spot (Phoma tarda (Stewart) Boerema & Bollen) and blister spot (Colletotrichum gloeosporioides Penz) (Pizza et al. 2010; Carvalho et al. 2017; Guerra-Guimarães et al. 2023). However, the most devastating and economically significant disease is coffee leaf rust (CLR), caused by Hemileia vastatrix Berk. & Br, which may cause losses of up to 50% in coffee bean yield (Zambolim 2016; Koutouleas et al. 2023). Hemileia vastatrix is an obligate pathogen, which establishes a biotrophic interaction with coffee plants (Azinheira et al. 2010; Silva et al. 2022). The primary strategy to control this disease in coffee-producing countries has been using resistant cultivars. However, the description of more than 50 physiological races described globally, from which 16 races of this pathogen have already been reported in Brazil (Zambolim 2016; Guerra-Guimarães et al. 2023), hinders the fast and timely release of new and improved cultivars. Therefore, developing new strategies to enhance the resistance of coffee plants to H. vastatrix is essential to its control.

It has been shown that the accumulation of osmolytes, such as mannitol, proline, and some soluble sugars from the raffinose family oligosaccharides (RFOs), play some role in abiotic stress tolerance in plants (Obata and Fernie 2012; dos Santos and Vieira 2020; Yan et al. 2022). The biosynthesis of RFOs comprises successive transfers of galactose moieties, donated by galactinol (α-ᴅ-galactopyranosyl-(1→1)-1 ʟ-myo-inositol), to sucrose, raffinose and stachyose producing an appropriate α-ᴅ-galactoside, i.e., raffinose, stachyose and verbascose, respectively (Pluskota et al. 2015; Sanyal et al. 2023). According with Nägele and Heyer (2013), the enzymes galactinol synthase (GolS, EC 2.4.1.123), raffinose synthase (RafS, EC 2.4.1.82) and stachyose synthase (StaS, EC 2.4.1.67) are found in the cytosol, while the RFOs can also be stored in vacuole and in the chloroplasts (reviewed by Van den Ende 2013; Sengupta et al. 2015; dos Santos and Vieira 2020). The GolS enzyme, responsible for galactinol production, is part of a fundamental step in RFOs biosynthesis (dos Santos and Vieira 2020) and is a member of the relatively small glycosyltransferase eight family (GTs; EC 2.4.x.y.) (Sengupta et al. 2012; Ao et al. 2022; Hoffmann et al. 2023).

Galactinol and raffinose may also act as signaling molecules that help the plants undertake the adaptive responses required for coping with biotic stresses (Wang et al. 2023; Chang et al. 2023). Results reported by Kim et al. (2008) showed evidence that galactinol and raffinose act on signaling during pathogen-induced systemic resistance in cucumber leaves. The increased CsGolS1 transcript levels coincided with galactitol accumulation in leaves of plants challenged with Pseudomonas chlororaphis O6 (Kim et al. 2008). A differential expression of galactinol synthase genes in response to pathogens was demonstrated by Chou et al. (2010), who reported that only the AtGolS1 isoform was induced upon infection with the fungal pathogen Botrytis cinerea in Arabidopsis thaliana. Aiming to demonstrate the role of GolS genes in Camellia sinensis under biotic stress conditions, Zhou et al. (2017) showed that the isoforms CsGolS2 and CsGolS3 were regulated by pest attack and phytohormones. Also, the up-regulation of a GolS gene in P. simiae strain AU-inoculated soybean plants indicates that the RFOs have essential functions in interacting with plant growth-promoting microorganisms (Vaishnav and Choudhary 2019). In mulberry MnGolS2 gene was highly expressed and triggered resistance to B. cinerea on transgenic plants cloned in A. thaliana (Wang et al. 2023).

Given the potential role of galactinol synthase genes in plant defense against biotic stress, the objective of this study was to evaluate the transcriptional profiles of three CaGolS genes and the accumulation of RFOs in response to H. vastatrix infection using two contrasting C. arabica L. genotypes, IAPAR59 (resistant) and Catuaí Vermelho IAC 99 (CV99) (susceptible) in the search for a more sustainable resistance against this pathogen.

Inoculation of coffee plants with H. vastatrix

Seedlings of two C. arabica L. genotypes IAPAR59 and CV99, considered resistant and susceptible to CLR, respectively (Sera et al. 2010; Del Grossi et al. 2013), were grown in a greenhouse (± 25 °C) at the Instituto de Desenvolvimento Rural do Paraná-IAPAR/EMATER (IDR-Paraná) in Londrina, Paraná state, Brazil. The plants were maintained in 4.5 L pots containing washed sterilized sand and irrigated weekly with nutrient solution adapted from Clark (1975) (see Baba et al. 2020). Plants were then transferred to the Coffee Research Center “Alcides Carvalho” (Instituto Agronômico de Campinas - Brazil) for H. vastatrix inoculation procedures as described by Barsalobres-Cavallari et al. (2009) and Baba et al. (2020). For this, fully young-expanded leaves of six-month-old plants were inoculated with a suspension of fresh uredospores of H. vastatrix race II (final concentration of 1 mg/mL^-1) using an air compressor. The inoculation was performed in 2 pairs of leaves per plant (first and second pair of each branch), totalizing 14 plants for each treatment. The inoculated plants were maintained for 24 h in a moist chamber in the dark at a mean temperature of 22 ºC in a greenhouse. Plants mock-inoculated with sterile distilled water were used as controls. The samples were collected at four-time points after inoculation (0, 12, 24, and 48 h), frozen in liquid nitrogen, and stored at −80 °C for further analysis. The experiment design was completely randomized, with three biological replicates per treatment represented by pools of leaves from seven plants of each treatment.

RNA isolation and cDNA synthesis

Total RNA was extracted from 100 mg of leaves as described by Korimbocus et al. (2002). To remove contaminant DNA, all samples were treated with DNase I (RNase-free, Invitrogen, Carlsbad, CA, USA), and the absence of genomic DNA contamination was verified by standard PCR using CaGAPDH primers (Table 1). RNA integrity and quality were assessed by ethidium bromide-stained 1% agarose gel, and 1.8 to 2.0 A260/A280 ratios were determined for samples using a Nanodrop™ 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Following the manufacturer's instructions, the first-strand cDNA synthesis was performed from 2 μg of total RNA using SuperScript III Reverse Transcriptase kit (Invitrogen). All the cDNA was diluted to 50 ng/µL^-1 for RT-qPCR analysis.

Real-time RT-PCR

Specific primers were designed based on the CaGolS1, 2, and 3 sequences (dos Santos et al. 2011; Ivamoto et al. 2017; Table 1) using Primer Express version 3.0 (Applied Biosystems, Foster City, CA, USA). Amplification efficiencies for each primer pair were calculated using LinRegPCR software (Ramakers et al. 2003). Relative quantification analysis was performed in optical 96-well plates using Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and SYBR Green Master Mix (Life Technologies) according to the manufacturer’s instructions. Each 10 μl reaction mixture contained 1 μl cDNA template, 5 μl of SYBR Green Master Mix (2x), 1 μl of each primer (10 μM) and 3 μl double-distilled water. Amplification occurred at cycling conditions of denaturation at 95 °C for 10 min, followed by 40 cycles of 30 s at 95 °C, then 1 min at 60 °C. All analyses were followed by a dissociation curve to verify amplification specificity. Ct values were normalized using the housekeeping gene CaGAPDH (Barsalobres-Cavallari et al. 2009; Cruz et al. 2009), and the relative gene expression values were determined with the 2^-^ΔΔ^Ct method (Livak and Schmittgen 2001) using mock inoculation at 0 h post-inoculation time for each genotype as the calibrator sample. Each measurement was made using three biological replicates with three technical repeats.

RFOs extraction and HPAEC-PAD analysis

The extraction of oligosaccharides was performed according to the methodology described by Albini et al. (1994). Approximately 0.5 g of macerated leaves was treated with chloroform and dried using filter paper to absorb solvent and pigments. The paper sheets were extracted with methanol: water (7:3) mixture for 16 h. The extract was separated by filtration on synthetic fabric and then dried on a rotary evaporator. Low-mass oligosaccharides were resolubilized in water and partitioned with ethyl acetate three times. The aqueous fraction was lyophilized, and the dry material was resolubilized with ultra-pure water. The extract was filtered through a 0.22 μm disposable filter and analyzed by anion exchange liquid chromatography with an amperometric pulse detector (HPAEC-PAD). For the quantification of the oligosaccharides, chromatography was carried out on Dionex ICS-5000 equipment (Dionex, CA, USA). The chromatography system was equipped with a CarboPac PA20 column using NaOH and sodium acetate gradient. Next, the oligosaccharides present in the samples were estimated by comparing the peak areas of the samples with calibration curves previously constructed for galactinol, raffinose and stachyose.

Statistical analysis

Data from RFOs quantification were submitted to analysis of variance (ANOVA) using a double factorial scheme in a completely randomized design to determine differences between treatments and post-inoculation time points. Statistical tests RT-qPCR were performed using SISVAR software (Ferreira 2011) and means were compared by the Tukey’s test at 5% significance.

Expression profile of CaGolS genes in coffee leaves inoculated with H. vastatrix

The transcription levels of the three coffee CaGolS genes (CaGolS1, 2, and 3) in C, arabica L. were differentially regulated according to the post-inoculation time points and genotypes evaluated (Fig. 1). In the susceptible genotype CV99, a transcriptional increase of the CaGolS1 gene was observed between 12 h and 24 h after inoculation. This level of transcription was maintained at 48 h when compared to the control (Fig. 1b). Constrasting, in the resistant IAPAR59 genotype, we observed that CaGolS1 expression was down-regulated at all sampling times after inoculation (Fig. 1a). Interestingly, under mock inoculation, the CaGolS1 mRNA level in the IAPAR59 genotype was up-regulated at the two last sampling time-points (Fig. 1a).

Compared with the other CaGolS genes, the CaGolS2 isoform was down-regulated after post-inoculation and under mock-inoculation in both genotypes (Fig. 1c and d). For the mock-inoculated CV99 genotype, a decreased expression of this gene was noted only after 24 h (Fig. 1d). In comparison, for IAPAR59, the decrease occurred already after 12 h (Fig. 1c). Also, we observed that the CaGolS3 mRNA levels were expressively down-regulated at all post-inoculation time-points in the CV99 genotype (Fig. 1f). Otherwise, in the IAPAR59 genotype, the mRNA levels of the CaGolS3 isoform increased with in time evaluations comparatively to the calibrator treatment (0 h and mock-inoculated) (Fig. 1e), but without differing to the mock-inoculated treatments at the same incubation period.

RFOs concentrations in coffee leaves in response to H. vastatrix infection

We measured the accumulation of galactinol, raffinose and stachyose in leaves inoculated with H. vastatrix at different post-inoculation time points:

Galactinol: In mock-inoculated IAPAR59 leaves, we observed a decrease in accumulation of this glycoside at 0, 12, and 24 h, followed by a higher concentration at 48 h. When rust-infested, this same cultivar showed the highest galactinol concentration at time 0, with a sharp decline at 12 h followed by a slow increase at 24 and 48 h. The mock-inoculated CV99 leaves showed the highest galactinol concentration at 24 h. A decline in the amounts of this glycoside was observed compared with the 0 h treatment when the leaves were infested. When comparing the galactinol concentrations between the different treatments within the same sampling time, the concentrations of this compound were similar at 0 h. At 12 h, the significant lowest amount was observed in H. vastatrix-inoculated IAPAR59. At 24 h, the leaves of the mock-inoculated CV99 had the highest concentration of galactinol. Finally, after 48 h, the highest concentration of galactinol was found in mock-inoculated.

Raffinose: Mock-treated IAPAR59 showed the highest amount of raffinose at the 48 h sampling time, while this peak was observed after 24 h when this genotype was rust-inoculated with H. vastatrix. Also, CLR-inoculated CV99 showed the highest concentration at 24 h. In general, the raffinose concentrations in the coffee leaves increased for all treatments at 24 h compared with the two initial sampling points (0 and 12 h), followed by a decline after 48 h, except for the mock-treated IAPAR59.

Stachyose: In H. vastatrix challenged treatments, the concentrations of this oligosaccharide were smaller in the resistant genotype (IAPAR59) compared with the susceptible one (CV99), mainly at 12 and 48 h. Within each sampling time, the highest amounts of raffinose were consistently observed in the mock-inoculated CV99 genotype.

Although biological functions of GolS genes were widely studied in several plant species under different conditions (Zhou et al. 2014; Himoru et al. 2014; Gu et al. 2016; Jang et al. 2018; Mukherjee et al. 2019; Liu et al. 2020; Jing et al. 2023), the role of GolS in plants during biotic stress conditions is poorly known. Here, we show the changes in the expression profiles of three C. arabica L. galactinol synthase genes (CaGolS1, 2, and 3 genes) and the galactinol, raffinose and stachyose contents in leaves infected with H. vastatrix comparatively with leaves mock-inoculated with distilled water.

Kim et al. (2008) reported that transgenic tobacco plants with CsGolS1 (Cucumis sativus L., cv. Baekseong) expression acquired resistance to B. cinerea. However, the accelerated accumulation of galactinol after the challenge inoculation diminished rapidly and fell back to basal levels within 12 h. These results imply that the accelerated accumulation of galactinol may function transiently as a signaling molecule during the initial interaction between primed plant leaves and fungal penetration. In a investigation with C. sinensis, gene regulation and the determination of RFOs revealed that CsGolS2 and CsGolS3 isoforms are related to in the biotic stress response (Zhou et al., 2017). La Mantia et al. (2018) also reported that the overexpression of AtGolS3 and CsRFS genes triggering the increased accumulation of galactinol and raffinose in the defense response to leaf rust in Populus alba × grandidentata. Our results showed that the three CaGolS isoforms showed differentiated transcriptional profiles but did not reflected in the RFOs production in the contrasting Arabica genotypes. Only the CaGolS1 isoform showed upregulated expression in response to the CLR in the susceptible genotype CV99, reaching an expression peak at 24 h and maintaining its transcript level up to 48 h post-inoculation. This may be related to the rapid accumulation of CaGolS1 gene for defense signaling pathways at early times of infection. It has been shown that the accumulation of galactinol constitutively represses defense signaling events (La Mantia et al. 2018). These authors showed that even low levels might also suppress some basal resistance toward poplar leaf rusts as inoculation of wild-type leaves reduced levels of galactinol and repressed transcript abundance of two endogenous GolS genes compared to un-inoculated leaves. We can speculate that this counter-effect in disease resistance can be observed here, as the CaGolS1 and CaGolS2 RNA levels were downregulated in the resistant genotype IAPAR59. RFO accumulation per se does not correspond with the expression level of CaGolS genes in coffee. Hence, we cannot rule out the hypothesis that the number of genes encoding GolS enzymes is variable between the plant species, and each allelic variant can perform several and different functions (Volk et al., 2003; Dos Santos and Vieira, 2020).

Regardless of the biotic stress period, there was an increase in galactinol biosynthesis. dos Santos et al. (2011, 2015) stated that the accumulation of galactinol did not regulate CaGolS isoforms and that other RFOs metabolic pathways were probably triggered. Our observations showed that gene expression levels did not necessarily reflect the levels of RFOs, probably due to known downstream regulatory mechanisms, such as phosphorylation feedback inhibition, among others. Also, other external stimuli may have co-occurred during the experiment, such as desiccation of the leaves in the incubation chamber. Interestingly, La Mantia et al. (2018) describe the existence of a possible reprogramming at the transcriptional level to suppress galactinol accumulation as part of plant defense response against biotic agents.

Considering the complexity and specificity of abiotic stress signaling, it is possible that RFOs participate in the osmoprotectant mechanisms (protecting/stabilizing cellular membranes/enzymes) in coffee plants under various abiotic and biotic constraints, corroborating with other reports available in the literature (ElSayed et al. 2014; Sengupta et al. 2015; Gangl and Tenhaken 2016). In this study, despite using genotypes with different response to coffee leaf rust (Sera et al. 2010; Del Grossi et al. 2013), it is still crucial to consider the high levels of genetic variability and plasticity that may exist between the cultivars. The RNA expression patterns observed in the three isoforms analyzed here and the results of the accumulation of oligosaccharides are opposed to the resistant response against the pathogen (Figs. 1 and 2).

This is the first study to verify the transcriptional levels of CaGolS genes in leaves of coffee cultivars with contrasting responses to H. vastatrix. Our data support the conclusion that the expression of GolS genes and the biosynthesis of RFOs in C. arabica L. are modulated differentially in response to the fungal infection depending on the genotype and the time of disease progress. This information indicates that CaGolSs genes should deserve a more detailed and in-depth evaluation of the response mechanism of Arabica coffee genotypes under biotic conditions.

RFOs Raffinose Family of Oligosaccharides

RafS Raffinose synthase

GolS Galactinol synthase

StaS Stachyose synthase

GTs Glycosyltransferase family

CLR Coffee leaf rust

Acknowledgements

Tiago Benedito dos Santos gratefully acknowledges the Araucária Foundation and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES) – Finance Code 001 for the scholarship. In addition, the authors would especially like to thank the Laboratório de Biotecnologia Vegetal (Instituto de Desenvolvimento Rural do Paraná-IAPAR/EMATER (IDR-Paraná), and the Instituto Agronômico de Campinas (IAC) for infrastructure and collaboration.

Author Contributions

Tiago Benedito dos Santos analyzed the data, performed the experiments, prepared figures and/or tables, and wrote the manuscript, Viviane Yumi Baba analyzed the data and wrote the manuscript, Fernanda Freitas de Oliveira analyzed the data and wrote the manuscript, Suzana Tiemi Ivamoto provided some primers and wrote the manuscript, Juarez Pires Tomaz assisted in analyzing the data and writing the manuscript, Carmen Lucia Oliveira Petkowicz performed the quantification of the oligonucleotides, Douglas Silva Domingues assisted in writing the manuscript, Luiz Filipe Protasio Pereira assisted in writing the manuscript, Masako Toma Braghini performed the experiments with H. vastatrix, Luiz Gonzaga Esteves Vieira reviewed the writing of the manuscript.

Conflicts of interest

Authors declare no conflicts of interest.

Albini FM, Murelli C, Patritti G, Rovati M, Zienna P and Finzi PV (1994) Low-molecular weight substances from the resurrection plant Sporobolus stapfianus. Phytochemistry 37:137–142. https://doi.org/10.1016/0031-9422(94)85013-5
Ao B, Han Y, Wang S, Wu F, Zhang J (2022) Genome-Wide analysis and profile of UDP-glycosyltransferases family in alfalfa (Medicago sativa L.) under drought stress. International Journal of Molecular Sciences 23(13):7243. https://doi.org/10.3390/ijms23137243
Azinheira HG, Silva MC, Talhinhas P, Medeira C, Maia I, Petitot AS, Fernandez D (2010) Non-host resistance responses of Arabidopsis thaliana to the coffee leaf rust fungus (Hemileia vastatrix). Botany 88:621–629. https://doi.org/10.1139/B10-039
Baba VY, Braghini MT, dos Santos TB, Carvalho Kd, Soares JDM, Ivamoto-Suzuki ST, Maluf MP, Padilha L, Paccola-Meirelles LD, Pereira LF, Domingues DS (2020) Transcriptional patterns of Coffea arabica L. nitrate reductase, glutamine and asparagine synthetase genes are modulated under nitrogen suppression and coffee leaf rust. PeerJ 8:e8320. https://doi.org/10.7717/peerj.8320
Barsalobres-Cavallari CF, Severino FE, Maluf MP, Maia IJ (2009) Identification of suitable internal control genes for expression studies in Coffea arabica under different experimental conditions. BMC Mol Biol 10(1):1–11. https://doi.org/10.1186/1471-2199-10-1
Carvalho AM, Cardoso DA, Carvalho GR, Carvalho VL, Pereira AA, Ferreira AD, Carneiro LF (2017) Comportamento de cultivares de cafeeiro sob a incidência das doenças da ferrugem e cercosporiose em dois ambientes de cultivo. CSci 12:100. http://www.sbicafe.ufv.br:80/handle/123456789/8266
Chang B, Zhao L, Feng Z, Wei F, Zhang Y, Zhang Y, Huo P, Cheng Y, Zhou J, Feng, H (2023) Galactosyltransferase GhRFS6 interacting with GhOPR9 involved in defense against verticillium wilt in cotton. Plant Science 328, 111582. https://doi.org/10.1016/j.plantsci.2022.111582
Cho SM, Kang EY, Kim MS, Yoo SJ, Im YJ, Kim YC, Yang KY, Kim KY, Kim KS, Choi YS, Cho BH (2010) Jasmonate-dependent expression of a galactinol synthase gene is involved in priming of systemic fungal resistance in Arabidopsis thaliana. Botany 88:452–461. https://doi.org/10.1139/B10-009
Cruz F, Kalaoun S, Nobile P, Colombo C, Almeida J, Barros LM, Alves-Ferreira M (2009) Evaluation of coffee reference genes for relative expression studies by quantitative real-time RT-PCR. Mol Breeding 23(4):607–616
Cuin TA, Shabala S (2008) Compatible solutes mitigate damaging effects of salt stress by reducing the impact of stress induced reactive oxygen species. Plant Signal Behav 3:207–218. https://doi.org/10.1007/s11032-009-9259-x
Del Grossi L, Sera T, Sera GH, Fonseca ICB, Ito DS, Shigueoka LH, Andrezi E, Carvalho FG (2013) Rust resistance in Arabic coffee cultivars in northern Paraná. Braz Arch Biol Techn 56(1):27–33. https://doi.org/10.1590/S1516-89132013000100004
dos Santos TB, Budzinski IG, Marur CJ, Petkowicz CL, Pereira LF and Vieira LG (2011) Expression of three galactinol synthase isoforms in Coffea arabica L. and accumulation of raffinose and stachyose in response to abiotic stresses. Plant Physiol Bioch 49:441–8. https://doi.org/10.1016/j.plaphy.2011.01.023
dos Santos TB, Lima RB, Nagashima GT, Petkowicz CL, Carpentieri-Pípolo V, Pereira LF, Domingues DS and Vieira LG (2015) Galactinol synthase transcriptional profile in two genotypes of Coffea canephora with contrasting tolerance to drought. Genet Mol Biol 38:182–190. https://doi.org/10.1590/S1415-475738220140171
dos Santos TB, Vieira LGE (2020) Involvement of the galactinol synthase gene in abiotic and biotic stress responses: A review on current knowledge. Plant Gene 24, 100258. https://doi.org/10.1016/j.plgene.2020.100258
Elsayed AI, Rafudeen MS and Golldack D (2014) Physiological aspects of raffinose family oligosaccharides in plants: protection against abiotic stress. Plant Biol 16:1–8. https://doi.org/10.1111/plb.12053
Gangl R, Tenhaken R, (2016) Raffinose family oligosaccharides act as galactose stores in seeds and are required for rapid germination of Arabidopsis in the dark. Front Plant Sci 7:1115. https://doi.org/10.3389/fpls.2016.01115
Guerra-Guimarães L, Diniz I, Azinheira HG, Loureiro A, Pereira AP, Tavares S, Batista D, Várzea V, Silva MCL (2023) Coffee Leaf Rust Resistance: An Overview. Mutation Breeding in Coffee with Special Reference to Leaf Rust: Protocols 19–38. https://doi.org/10.1007/978-3-662-67273-0
Himuro Y, Ishiyama K, Mori F, Gondo T, Takahashi F, Shinozaki K, Kobayashi M, Akashi R (2014) Arabidopsis galactinol synthase AtGolS2 improves drought tolerance in the monocot model Brachypodium distachyon. J Plant Physiol 171:1127–1131. https://doi.org/10.1016/j.jplph.2014.04.007
Hoffmann TD, Kurze E, Liao J, Hoffmann T, Song C, Schwab W (2023) Genome-wide identification of UDP-glycosyltransferases in the tea plant (Camellia sinensis) and their biochemical and physiological functions. Frontiers in Plant Science 14, 1191625. https://doi.org/10.3389/fpls.2023.1191625
Ivamoto ST, Reis O, Domingues DS, dos Santos TB, Oliveira FF, Pot D, Leroy T, Vieira LG, Carazzolle MF, Pereira GA, Pereira LF (2017) Transcriptome Analysis of Leaves, Flowers and Fruits Perisperm of Coffea arabica L. Reveals the Differential Expression of Genes Involved in Raffinose Biosynthesis. PloS One 12(1):e0169595. https://doi.org/10.1371/journal.pone.0169595
Jang JH, Shang Y, Kang HK, Kim SY, Kim BH, Nam KH (2018) Arabidopsis galactinol synthases 1 (AtGOLS1) negatively regulates seed germination. Plant Sci 267:94–101. https://doi.org/10.1016/j.plantsci.2017.11.010
Jing Q, Chen A, Lv Z, Dong Z, Wang L, Meng X, Feng Y, Wan Y, Su C, Cui Y, Xu W, Hou H, Zhu X (2023) Systematic Analysis of Galactinol Synthase and Raffinose Synthase Gene Families in Potato and Their Expression Patterns in Development and Abiotic Stress Responses. Genes 14(7):1344. https://doi.org/10.3390/genes14071344
Kim MS, Cho SM, Kang EY, Im YJ, Hwangbo H, Kim YC, Ryu CM, Yang KY, Chung GC, Cho BH (2008) Galactinol is a signaling component of the induced systemic resistance caused by Pseudomonas chlororaphis O6 root colonization. Mol Plant Microbe Interact 21:1643–1653. https://doi.org/10.1094/MPMI-21-12-1643
Korimbocus J, Coates D, Barker I, Boonham N (2002) Improved detection of Sugarcane yellow leaf virus using a real-time fluorescent (TaqMan) RT-PCR assay. J Virol Methods 103(2):109–120. https://doi.org/10.1016/S0166-0934(01)00406-2
Koutouleas A, Collinge DB, Boa E (2023) The coffee leaf rust pandemic: An ever‐present danger to coffee production. Plant Pathology 73(3):522–534. https://doi.org/10.1111/ppa.13846
La Mantia J, Unda F, Douglas CJ, Mansfield SD, Hamelin R (2018) Overexpression of AtGolS3 and CsRFS in poplar enhances ROS tolerance and represses defense response to leaf rust disease. Tree Physiol 38:457–470. https://doi.org/10.1093/treephys/tpx100
Liu Y, Zhang L, Meng S, Liu Y, Zhao X, Pang C, Zhang H, Xu T, He Y, Qi M, Li T (2020) Expression of galactinol synthase from Ammopiptanthus nanus in tomato improves tolerance to cold stress. J Exp Bot 71(1):435–449. https://doi.org/10.1093/jxb/erz450
Livak KJ, Schmittgen, TD (2001) Analysis of Relative Gene Expression Data Using RealTime Quantitative PCR and the 2-^ΔΔ^CT Method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262
Mukherjee S, Sengupta SD, Mukherjee A, Basak P, Majumder AL (2019) Abiotic stress regulates expression of galactinol synthase genes post-transcriptionally through intron retention in rice. Planta 249:891–912. https://doi.org/10.1007/s00425-018-3046-z
Nägele T, Heyer AG (2013) Approximating subcellular organization of carbohydrate metabolism during cold acclimation in different natural accessions of Arabidopsis thaliana. New Phytol 198:777–787. https://doi.org/10.1111/nph.12201
Obata T, Fernie AR (2012) The use of metabolomics to dissect plant responses to abiotic stresses. Cell Mol Life Sci 69:3225–3243. https://doi.org/10.1007/s00018-012-1091-5
Peterbauer T, Lahuta LB, Blöchl A, Mucha J, Jones DA, Hedley CL, Gòrecki RJ, Richter A (2001) Analysis of the raffinose family oligosaccharide pathway in pea seeds with contrasting carbohydrate composition. Plant Physiol 127:1764–1772. https://doi.org/10.1104/pp.010534
Peterbauer T, Richter A (2001) Biochemistry and physiology of raffinose family oligosaccharides and galactosyl cyclitols in seeds. Seed Sci Res 11:185–197. https://doi.org/10.1079/SSR200175
Pluskota WE, Szablińska J, Obendorf RL, Górecki RJ, Lahuta LB (2015) Osmotic stress induces genes, enzymes and accumulation of galactinol, raffinose and stachyose in seedlings of pea (Pisum sativum L.). Acta Physiol Plant 37:156. https://doi.org/10.1007/s11738-015-1905-9
Pozza EA, Carvalho LV, Chalfoun SM (2010) Sintomas e injúrias causadas por doenças em cafeeiro. GUIMARÃES, RJ; MENDES, AN G; BALIZA, DP Semiologia do cafeeiro: sintomas de desordens nutricionais, fitossanitárias e fisiológicas Lavras: UFLA:69–101.
Ramakers C, Ruijter JM, Deprez RHL, Moorman AFM (2003) Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339(1):62–66. https://doi.org/10.1016/S0304-3940(02)01423-4
Sanyal R, Kumar S, Pattanayak A, Kar A, Bishi SK (2023) Optimizing raffinose family oligosaccharides content in plants: A tightrope walk. Frontiers in Plant Science 14, 1134754. https://doi.org/10.3389/fpls.2023.1134754
Saravitz DM, Pharr DM, Carter TE (1987) Galactinol synthase activity and soluble sugars in developing seeds of four soybean genotypes. Plant Physiol 83:185–189. https://doi.org/10.1104/pp.83.1.185
Sengupta S, Mukherjee S, Basak P, Majumder AL (2015) Significance of galactinol and raffinose family oligosaccharide synthesis in plants. Front Plant Sci 6:1–11. https://doi.org/10.3389/fpls.2015.00656
Sengupta S, Mukherjee S, Parween S, Majumder AL (2012) Galactinol synthase across evolutionary diverse taxa: Functional preference for higher plants? FEBS Lett 586(10):1488–1496. https://doi.org/10.1016/j.febslet.2012.04.003
Sera GH, Sera T, Fonseca ICB, Ito DS (2010) Resistência à ferrugem alaranjada em cultivares de café. Coffee Scie 5(1):59–66. http://www.sbicafe.ufv.br:80/handle/123456789/3934
Silva MDC, Guerra-Guimarães L, Diniz I, Loureiro A, Azinheira H, Pereira AP, Tavares S, Batista D, Várzea V (2022) An overview of the mechanisms involved in Coffee-Hemileia vastatrix interactions: Plant and pathogen perspectives. Agronomy 12(2):326. https://doi.org/10.3390/agronomy12020326
Taji T, Ohsumi C, Iuchi S, Seki M, Kasuga M, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K (2002) Important roles of drought- and cold-inducible genes for galactinol synthase in stress tolerance in Arabidopsis thaliana. Plant J 29:417–26. https://doi.org/10.1046/j.0960-7412.2001.01227.x
Vaishnav A, Choudhary DK (2019) Regulation of drought-responsive gene expression in Glycine max l. Merrill is mediated through Pseudomonas simiae strain AU. J Plant Growth Regul 38:333–342. https://doi.org/10.1007/s00344-018-9846-3
Van den Ende, W (2013) Multifunctional fructans and raffinose family oligosaccharides. Front Plant Sci 4:247. https://doi.org/10.3389/fpls.2013.00247
Venables WN, Ripley BD (2002) Modern Applied Statistics with S. Fourth Edition. Springer, New York. ISBN 0-387-95457-0
Volk G, Haritatos E, Turgeon R (2003) Galactinol synthase gene expression in melon. J Am Soc Hort Sci 128:8–15
Wang D, Liu Z, Qin Y, Zhang S, Yang L, Shang Q, Ji X, Xin X, Li X (2023) Mulberry MnGolS2 Mediates Resistance to Botrytis cinerea on Transgenic Plants. Genes 14(10):1912. https://doi.org/10.3390/genes14101912
Yan S, Liu Q, Li W, Yan J, Fernie AR (2022) Raffinose family oligosaccharides: crucial regulators of plant development and stress responses. Critical Reviews in Plant Sciences 41(4):286–303. ttps://doi.org/10.1080/07352689.2022.2111756
Zambolim L (2016) Current status and management of coffee leaf rust in Brazil. Trop Plant Pathol 41:1–8. https://doi.org/10.1007/s40858-016-0065-9
Zhou J, Yang Y, Yu J, Wang L, Yu X, Ohtani M, Kusano M, Saito K, Demura T, Zhuge Q (2014) Responses of Populus trichocarpa galactinol synthase genes to abiotic stresses. J Plant Res 127:347–358. https://doi.org/10.1007/s10265-013-0597-8
Zhou Y, Liu Y, Wang S, Shi C, Zhang R. Rao J, Wang X, Gu X, Wang Y, Li D, Wei C (2017) Molecular cloning and characterization of galactinol synthases in Camellia sinensis with different responses to biotic and abiotic stressors. J Agric Food Chem 65:2751–2759. https://doi.org/10.1021/acs.jafc.7b00377

Table 1 Primer sequences used for RT-qPCR analysis.

Gene	Primer foward	Primer reverse	Average efficiency	Amplicon size
*CaGolS1	ATGGCCCCTCAAGAAGTA	AGCTAAAAATGTAACGTACGCTC	100%	102 bp
**CaGolS2	AGGGCGTTTGTGACATTCTTG	CCAGAGGGTAAGCGGTGTTG	98%	101 bp
*CaGolS3	ATGGCTCCTGATACCGTTAG	ACCGTTCCCTGCCAGAAAT	100%	102 bp
*CaGAPDH	AGGCTGTTGGGAAAGTTCTTC	ACTGTTGGAACTCGGAATGC	97%	100 bp

* Ivamoto et al. 2017; ** dos Santos et al. 2011.

Download PDF

Reviewers agreed at journal
26 Apr, 2024
Reviewers invited by journal
25 Apr, 2024
Editor invited by journal
24 Apr, 2024
Editor assigned by journal
22 Apr, 2024
First submitted to journal
18 Apr, 2024

You are reading this latest preprint version

Expression profiling of galactinol synthase genes in Coffea arabica L. in response to Hemileia vastatrix infection

Status:

Version 1

Abstract

Figures

Introduction

Material and methods

Results

Discussion

Conclusion

Abbreviations

Declaration

References

Table 1

Status:

Version 1