Human iPSCs
The SYT13+/- hiPSCs were generated starting from the commercially-available PGP1 (GM23338) line. Guide RNA with the sequence GUGCAUGUGCCGACACAGGC and Cas9 were delivered to the cells by electroporation. Cells were then let recover in culture for 2 days before assessing the genome editing by Sanger sequencing after PCR amplification using the primers CAAAGATCCACGACCGCCT (forward) and AGCCTCCTCTGACGTCCTC (reverse). Single cells were then seeded for clonal expansion.
To minimize the possibility that the observed changes in SYT13+/- hiPSCs might arise from the procedure of genetic engineering, the parental line PGP1 was also mock-transfected with Cas9 (referred to as WT or SYT13+/+ in the manuscript) following the same protocol.
HiPSCs were cultured on Matrigel®-coated (Corning, 354,277) 6-well plates at 37 °C (5% CO2, 5% O2) using mTeSR plus medium (Stem Cell Technologies, 100-0274). After reaching around 80% confluence, the colonies were detached using Dispase (Stem Cell Technologies, 07923) and passaged in a 1:3 or 1:6 split ratio. Potential mycoplasma contamination was regularly checked using the MycoStrip™ Mycoplasma Detection Kit (Invivogen, rep-mysnc-50; every second week) and MycoAlert® Mycoplasma Detection Kit (Lonza, LT07-318; once a month).
Differentiation of hiPSC into spinal motor neurons
We differentiated MNs from hiPSCs using a previously-described protocol 18. Briefly, hiPSC colonies were detached using Dispase (Stem Cell Technologies, 07923) and cultured in suspension in ultra-low attachment flasks T75 for 3 days for the formation of embryoid bodies (EBs) in hESC medium (DMEM/F12 + 20% knockout serum replacement + 1% NEAA + 1% β-mercaptoethanol + 1% antibiotic–antimycotic + SB-431542 10 µM + Dorsomorphin 1 µM + CHIR 99021 3 µM + Purmorphamine 1 µM + Ascorbic Acid 200 ng/µL + 1% B27 + 0.5% N2). On the fourth day, the medium was switched to MN Medium (DMEM/F12 + 24 nM sodium selenite + 16 nM progesterone + 0.08 mg/mL apotransferrin + 0.02 mg/mL insulin + 7.72 μg/mL putrescine + 1% NEAA, 1% antibiotic–antimycotic + 50 mg/mL heparin + 10 μg/mL of the neurotrophic factors BDNF, GDNF, and IGF-1, SB-431542 10 µM, Dorsomorphin 1 µM, CHIR 99021 3 µM, Purmorphamine 1 µM, Ascorbic Acid 200 ng/µL, Retinoic Acid 1 µM, cAMP 1 µM, 1% B27, 0.5% N2). After 5 further days of cultivation EBs were dissociated into single cells with Accutase (Sigma Aldrich) for 10min and plated onto μDishes, 24-well μPlates (Ibidi) or 6-well plates (Corning) pre-coated with Growth Factor Reduced Matrigel (Corning).
RNA sequencing
Messenger RNA was purified from total RNA using poly-T oligo-attached magnetic beads. After fragmentation, the first strand cDNA was synthesized using random hexamer primers, followed by the second strand cDNA synthesis using either dUTP. Library was ready after end repair, A-tailing, adapter ligation, size selection, USER enzyme digestion, amplification, and purification. The library was checked with Qubit and real-time PCR for quantification and bioanalyzer for size distribution detection. Quantified libraries will be pooled and sequenced on Illumina platforms, according to effective library concentration and data amount. Raw data (raw reads) in fastq format was firstly processed through in-house perl scripts. In this step, clean data (clean reads) was obtained by removing reads containing adapter, reads containing ploy-N and low-quality reads from raw data. At the same time, Q20, Q30 and GC content were calculated. All the downstream analyses were based on clean data with high quality. Reference genome and gene model annotation files were downloaded from genome website directly. Index of the reference genome was built using Hisat2 v2.0.5 and paired-end clean reads were aligned to the reference genome using Hisat2 v2.0.5. FeatureCounts v1.5.0-p3 was used to count the reads numbers mapped to each gene, followed by FPKM calculation of each gene.
Western blot
Western blot experiments were performed by loading 10 μg of protein (determined by Bradford Assay) on 4–15% Mini-PROTEAN® TGX™ Precast Protein Gels, 15-well, 15 µl(Bio Rad #4561086), which were then transferred to a nitrocellulose membrane using a Trans-Blot Turbo device (BioRad, USA). To block non-specific binding sites, the membranes were incubated with a 5% BSA solution (diluted in TBS pH 7.5 + 0.2% TWEEN) for 2h and incubated with the primary antibody overnight at 4 °C. Afterwards, blots were washed 3 times for 10min with TBS + 0.2% TWEEN, incubated with HRP-conjugated secondary Ab for 2 h, and again washed 3 times for 10min. Chemiluminescent signal was detected using the ECL detection kit (ThermoFisher Scientific, 32,106) and a MicroChemi 4.2 device (DNR Bio Imaging System). For quantification, Gel-analyzer Software 2010a was used.
Immunocytochemistry
Immunostainings were performed as previously described 13. Cells were fixed with 4% paraformaldehyde (containing 10% sucrose) for 7 minutes and incubated for two hours using a blocking solution (PBS + 10% Goat Serum + 0.2% Triton X‐100). The same solution was used for the incubation with primary antibodies for 24h at 4°C. After incubation with primary antibodies, three washes with PBS were performed before incubating the cells with secondary antibodies (diluted 1:1,000 in PBS) for two hours at room temperature. Afterward, cells were washed three times again and mounted with ProLongTM Gold Antifade Mountant with DAPI (Thermo Fisher Scientific, P36935) or with ibidi Mounting Medium (Ibidi, 50001).
Microscopy and image analysis
Fluorescence microscopy was performed with a Thunder imaging system (Leica) equipped with a DFC9000 sCMOS camera, an HC PL Fluotar 20X air (N.A. 0.4) objective and using the LasX software (Leica).
Confocal microscopy was performed by using a laser-scanning microscope (Leica DMi8) equipped with an ACS APO 63X oil DIC immersion objective. Images were acquired using the LasX software (Leica), with a resolution of 1024 × 1024 pixels and a number of Z-stacks (step size of 0.3 μm).
Images were analyzed by using the ImageJ 2.14.0 software. To analyze the intensity levels of nuclear phospho-c-JunSer63 in immunostaining, the Z-stack was collapsed with the maximum intensity projection tool of ImageJ. A region of interest (ROI) was drawn using the MAP2 and DAPI channels as a reference to the nucleus and the mean intensity of phospho-c-JunSer63 signal was measured.
To analyze the intensity of P62/SQSTM1, the Z-stack was collapsed, and a region of interest (ROI) was drawn around the cell soma using the MAP2 channel as a reference and the mean intensity was measured.
Aggresomes were detected using the PROTEOSTAT® Aggresome detection kit (Enzo, ENZ-51035-0025). To analyze the somatic aggresome area, the Z-stacks were also collapsed, and also a ROI was drawn around the cell soma using the MAP2 channel as a reference. Afterwards a threshold was set for the PROTEOSTAT®/aggresome and the area above the threshold was measured.
To analyze the size of MN somata, a ROI was drawn around the soma using the MAP2 channel as a reference. The area of the ROI was then converted into µm2. Primary dendrites were counted manually in the MAP2 channel.
To analyze the intensity of HOMER and Bassoon, the Z-stacks were also collapsed and a ROI was drawn around the primary dendrites, approximately 20µm far from the soma, using the polygon selection of ImageJ. The MAP2 channel was used as a reference.
To identify synaptic contacts, colocalization between HOMER (postsynaptic marker) and Bassoon (presynaptic marker) was performed using Imaris 9.7.0 (Bitplane). At first the MAP2 channel was used to draw a surface od reference with the Surface tool. Afterward, the puncta for HOMER and Bassoon were detected semi-automatically in the respective channel (with the Spots tool). Between HOMER and Bassoon a minimum distance of 0.8 μm between the center of the respective spots and a maximum distance of 1 μm from the dendrite was accepted as an interaction, which could be interpreted as a synapse.
The same computational parameters and post-acquisition adjustments were used to analyze images from the same differentiation and to image display within the figures.
Antibody list
The primary antibodies used in experiments with hiPSC-derived MNs were: anti-MAP2 (Encor, CPCA-MAP2; diluted 1:1000), Proteostat® aggresome detection kit (Enzo, ENZ-51035-0025; diluted 1:5000), anti-phospho-c-Jun (Ser63) (Cell Signaling, 91,952; diluted 1:1000), anti-phospho SQSTM1/p62 (Abcam, 56416; diluted 1:1000), anti-Homer1 (Synaptic Systems, 160 003; diluted 1:500), anti‐Bassoon (Enzo, ADI‐VAM‐PS003‐D; diluted 1:500), anti-Neurofilamet heavy (Abcam, 8135, diluted 1:10000) and anti-β-Actin (Sigma-Aldrich, A5316, diluted 1:25000).
For immunostainings, the following secondary antibodies from Thermo Fisher Scientific were used at 1:1000 dilution: anti-Chicken Alexa Fluor® 488 (A-11039), goat anti-Rabbit Alexa Fluor® 568 (A-11036), goat anti-Guinea Pig Alexa Fluor® 568 (A-11075), goat anti-Mouse Alexa Fluor® 647 (A-21235).
For Western blot experiments, the secondary HRP-conjugated anti-Mouse (1:3000 dilution) and anti-Rabbit (1:1000 dilution) antibodies from DAKO were used.
qRT-PCR
Total RNA from hiPSC-derived MN was extracted using the RNeasy Mini kit (Qiagen, 74104) following the instructions from Qiagen. First-strand synthesis and quantitative real-time-PCR amplification were performed in a one-step using the QuantiFast™ SYBR Green RT-PCR kit (Qiagen, 208054) in a total volume of 20 µl. The primers used for qRT-PCR were purchased (Qiagen QuantiTect Primer Assays, Qiagen—validated primers without sequence information). The following settings were used: 10 min at 55 °C and 5 min at 95 °C, followed by 40 cycles of PCR for 5 s at 95 °C for denaturation and 10 s at 60 °C for annealing and elongation (one-step). The SYBR Green I reporter dye signal was measured against the internal passive reference dye (ROX) to normalize non-PCR-related fluctuations. The Rotor-Gene Q software (version 2.0.2) was used to calculate the cycle threshold values. GAPDH expression levels were used to normalize resulting data.
Laser microdissection of FF MNs
Mice were anesthetized with 1 mg/kg body weight ketamine chlorhydrate and 0.5 mg/kg xylazine. Once deep anesthesia was confirmed by the absence of a toe-pinch response, the chest cavity was carefully exposed and a precise incision was made in the right atrium using sharp forceps. Subsequently, the left ventricle was gently infused with ice-cold phosphate-buffered saline (PBS) at a controlled flow rate of 5-7 ml/min over a period of 2 minutes using a peristaltic pump. Finally, spinal cord samples were quickly dissected, embedded in OCT (TissueTek) and stored at -80°C.
After sterilizing all the necessary equipment under UV light, 12 μm-thick cryosections were cut at -20°C and mounted on RNase-free Polyethylene naphtalate (PEN) membrane slides. Sections were fixed in 70% ethanol diluted in DEPC-H2O at -20°C and stained with 1% cresyl violet in 50% ethanol/DEPC-H2O for 1 minute each. Then, slides were incubated for 1 min in 70% and 100% ethanol at +4°C. Then, 30 ventrolateral motoneurons per experimental group were microdissected and captured using the Laser Microdissection System (Palm MicroBeam, Zeiss) on a 500 µL clear adhesive cap (Carl Zeiss).
Cells were lysed by adding 21 µl 1× SuperScript III first-strand RT buffer (Invitrogen) containing 1% NP40 at 42°C for 20 min. Reverse transcription was carried out using the SuperScript III First-Strand Synthesis System for RT-PCR kit (Invitrogen). Briefly, 50 ng/µL random hexamers and 10 mM dNTP mix were added and incubated at 65°C for 5 min. Then, the cDNA synthesis mix (10X RT buffer, 25mM MgCl2, 0.1M DTT, RNaseOUT 40 U/µl, SuperScriptIII RT 200 U/µl) was added and incubated 10 minutes at 25°C followed by 50 minutes at 50°C. The reaction was terminated at 85°C for 5 minutes. To remove excess RNA, RNase H was mixed to the solution and incubated for 20 minutes at 37°C.
RNA fluorescent in situ hybridization (FISH)
To investigate the expression of SYT13 in the murine spinal cord, we used tissue samples from 3-month-old WT mice. Afterward RNAscope in situ hybridization was performed using the RNAscope® Multiplex Fluorescent Reagent Kit v2 (ACD‐BIO, 323100).
Briefly, slides were incubated in H2O2 for 10 min at RT. Afterward, they were washed with distilled water 5 times. The Target Retrieval was brought to boiling (at 100°C) using a Thermoblock. The slices were now placed in a container at 100°C and incubated for 15min with the boiling Target Retrival. Now the slides were transferred to 100% Ethanol for 3min. Afterwards, they were left to dry at RT (approx. 5-10min). To create a hydrophobic barrier a ImmEdge® Hydrophobic Barrier PAP Pen (Vector Laboratories, H-4000) was used, and left to dry overnight or RT. The dried slides were loaded into the ACD EZ Batch Slide holder, and 5 drops of Protease III were added to each section and incubated in a HybEZTM II Oven at 40°C for 30min. At this point, cells were hybridized with pre‐warmed RNAscope™ Probe- Mm-Syt13 (ACD‐BIO, 582091) in the HybEZTM II Oven at 40°C for 4,5 h. After hybridization, slides were incubated with the amplification buffers AMP1 for 30min at 40°C, AMP2 for 30min at 40°C, and AMP3 for 15min at 40°C.
Between each incubation step, the slides were washed twice for 5 min at room temperature with the 1x Wash Buffer provided with the kit. Afterwards, the slides were treated with HRP-C1 for 15min at 40°C and washed again 3 times for 5min at room temperature with the 1x Wash Buffer. Now a treatment with Opal 570 reagent (SKU FP1488001KT diluted 1:2000 in TSA buffer) for 30 min at 40°C was performed. Samples were then washed three times with Wash Buffer, incubated with HRP‐Blocker reagent for 15 min at 40°C, washed again twice at room temperature with the 1x Wash Buffer for 5min, and processed for immunostaining as described above.
Images were acquired by confocal microscopy and were quantified as described above.
For these experiments, MN were identified by using the neuronal markers NeuN (Synaptic Systems 173 004) and CHAT (abcam rb181023). The Z-stacks were collapsed, and a region of interest (ROI) was drawn around the cell soma. To quantify the SYT13 RNA foci, the FindFoci plugin of ImageJ was used. The diameter of the MN was determined by using the measurement tool of ImageJ.
Data analysis
Differential expression analysis of the RNAseq data was performed using the DESeq2R package (1.20.0). The resulting P-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate. Genes with an adjusted P-value <0.05 found by DESeq2 were assigned as differentially expressed. For Gene Set Enrichment Analysis (GSEA), genes were ranked according to the degree of differential expression in the different samples, and then the predefined Gene Set were tested to see if they were enriched at the top or bottom of the list.
The prediction of the transcription factors controlling the expression of the genes commonly altered in the SYT13+/- transcriptome and ALS spinal cord samples was performed with the TTRUST (version2) database 46.
The correlation of SYT13+/- and gene expression signatures was performed with the SigCom LINCS tool developed by the Ma´ayan Laboratory 47 by searching for SYT13 (Figure 4G and H) and uploading the up- and down-regulated transcripts in SYT13+/- vs SYT13+/+ cultures (Figure 4I).
To compare two independent groups (genotypes) in western blot, immunocytochemistry and qPCR, unpaired t test with Welch correction in the case of normally distributed data and a nonparametric Mann–Whitney test for non-normal distribution were used (GraphPad Prism, Version 10.1.1).
Generalized linear modeling and Machine learning analysis of Answer ALS data set
RNA-seq data used in the preparation of this article were obtained from the ANSWER ALS Data Portal (AALS-01184) 48. For up-to-date information on the study, visit https://dataportal.answerals.org. We included expression data from 122 female ALS patients, 50 female controls, 218 male ALS patients, and 51 male controls, totaling 441 samples. The dependent class variables of ALS were set to 0, and controls were set to 1. A generalized linear model was created using glm(Class ~ SYT13 + Sex + SYT13:Sex, data = df1, family = binomial), which determined a significant interaction between SYT13 and Sex. Several machine learning models were tested using the automated STREAMLINE package 49 on the same cohort of female and male ALS and control patient data. All SYT gene homologues as well as sex were input features. The sex class variables of female were set to 0, and male were set to 1. Briefly, the default settings for STREAMLINE were run: Phase 1: Exploratory Analysis and Phase 2: Data Preprocessing to count instances, determine missing data, cleaning, feature engineering, and partitioning of training and test data sets; Phase 3: Feature Importance (FI) Evaluation using MultiSURF to determine feature interaction, Phase 4: Feature Selection based on FI, Phase 5: Modeling with all available algorithms, Phase 6: Statistics Summary and Figure Generation to evaluate average cross-validation and statistical comparisons of each algorithm performance.
Next Generation Sequencing
The used samples were analyzed using Next generation sequencing (Illumina: TruRisk™ Panel). The sequencing was performed using NextSeq High Output Kit v2.5 (300Cycles). The data was analyzed using the Software Varvis version 1.25.0 (Limbus Medical Technologies GmbH, Rostock) and filtered for the gene TP53 (NM_000546.6). The sequence data was evaluated in comparison to the respective reference sequence (hg19, NCBI). Identified variants were compared against different databases and filtered based on allele frequency (MAF<1%).
Multiplex Ligation-dependent Probe amplification (MLPA)
To assess possible deletions or duplications within the gene TP53 the used samples were analyzed using the MPLPA-Kit P056-D1 from MRC-Holland according to the manufacturing protocol. The result was compared to three different control samples. The data was analyzed using the Software Sequence Pilot from JSI medical systems
Ethics approval
All procedures with hiPSCs were approved by the Ethic Committee of the Ulm University (ethical approvals Nr. 0148/2009 and 265/12) and performed within the German Network for Motor Neuron Diseases (MND-NET) in compliance with the guidelines of the Federal Government of Germany.
Experiments with animal models were performed according to the ethical approvals Nr. o.103-17 and o.217-9.
Data availability
The RNAseq data are available at Gene Expression Omnibus (GEO) under the accession number GSE261848.