The aim of the present investigation was to standardize the conditions of batch fermentation for the production of a commercially significant alkaline protease from Bacillus amyloliquefaciens TAS-2. The B. amyloliquefaciens TAS-2 exhibited a distinct zone of clearance on the skim milk agar medium and demonstrated an enzyme activity of 38.6 U/mL after 24 hours of incubation at a pH of 7 and a temperature of 37°C. B. amyloliquefaciens TAS-2 was identified through genotypic analysis using 16S rRNA sequencing. The highest protease activity was obtained after 24 hours of incubation time, at pH 9, and temperature of 40°C. Similarly, maximum activity was observed with an agitation speed of 150 rpm, an inoculum age of 24 hours, an inoculum volume of 3% v/v, a substrate concentration of 3%, and a flask capacity of 250 mL. The activity was positively enhanced with addition of various nitrogen and carbon sources. Similarly, the presence of amino acids and metal ions induced protease production. However, the addition of Fe2 + and Zn2 + ions at specific concentrations in the medium was found to be inhibitory. Conversely, the addition of Mg2 + and Ca2 + ions had a stimulating effect on protease production. All the optimized parameters were incorporated into the basal medium, and fermentation was conducted under optimal conditions. The precipitation of the maximum amount of protein was achieved at 70–80% saturation of ammonium sulfate. The protease activity was 1.56 time higher for the partially purified protease compared to the crude supernatant. The partially purified protease exhibited optimum activity at a temperature of 55°C and a pH of 9. At 5 mM, PMSF significantly suppressed enzyme activity, whereas Triton X-100 and CTAB increased enzyme activity. Among the different metal ions tested, Ca2+ (5 mM), Mg2+ (5 mM), and Mn2+ (5 mM) stimulated enzyme activity, while Zn2 + and Fe2 + decreased protease activity. The enzyme demonstrated remarkable stability, retaining its activity even after being heated to 60°C for 60 minutes and remaining stable within a pH range of 8 to 11. The study suggests that the alkaline protease of B. amyloliquefaciens TAS-2 that is thermotolerant and surfactant stable can have potential applications across different industries due to its ability to improve yield and properties.
Research Article
Production of Alkaline protease from Bacillus amyloliquefaciens TAS-2 and Optimizing fermentation conditions
https://doi.org/10.21203/rs.3.rs-4296273/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this latest preprint version
Enzyme
protease
Bacillus
fermentation
activity
carbon
substrate
Proteases are a distinct group of enzymes that are frequently used in a series of industries, containing food, detergent, clothing, and pharmaceutical. Because of their rapid growth and high capacity for protein production, microorganisms such as Bacillus sp. are the main sources of proteases [1]. Due to the increasing demand for proteases for varied applications, there is a continuous need to discover new versions of these industrially important enzymes [2]. Thermophilic microorganisms are known to be excellent sources of thermostable proteases [3]. Enzymes from thermophilic microorganisms exhibit faster reaction rates at high operating temperatures and are noticeably more stable than similar enzymes from mesophilic species [4].
Microbial proteases are a significant group of hydrolytic enzymes that have been widely studied since the emergence of enzymology. Each enzyme has unique performance characteristics that make it suitable for various applications [3]. Initially, alkaline proteases were introduced into the market for their application in detergents. The demand for these industrial enzymes experienced significant growth during the 1960s. They continue to be extensively researched because of their diverse range of applications in several sectors, including the detergent, textile, leather, and food industries [5]. Bacillus species are the primary microbial strains used for enzyme synthesis, particularly for the generation of alkaline serine proteases and neutral proteases [6]. Bacillus amyloliquefaciens, a type of bacterium, has been extensively researched for its ability to produce proteases [7]. Studies have shown that Bacillus amyloliquefaciens can generate proteases with diverse characteristics, including alkaline proteases. These enzymes are effective in a wide range of applications due to their robustness and functionality in alkaline environments. Several thermophilic Bacillus strains, such as Bacillus subtilis, B. stearothermophilus, and B. pumilus, have been explored for protease production [8].
In order to produce large quantities of proteases, it is essential to optimize fermentation conditions [9]. The production of proteases is significantly affected by various factors during fermentation, such as temperature, pH, impeller speed, and nutritional supplements. It is critical to optimize the fermentation medium to obtain protease yields that are economically viable [10]. In solid-state fermentation, pH and temperature may impact the production of proteases when certain microbes are used. Additionally, modeling and controlling fermentation parameters can enhance the ability of specific bacterial strains to generate alkaline protease. To maximize protease synthesis, it is necessary to determine the ideal growth conditions, including viable cell numbers, pH levels, and protease activity [9, 11].
In this research, we conducted a screening process to identify a new bacterial strain that produces protease enzymes. During the screening process, we discovered Bacillus amyloliquefaciens TAS-2, which was found to produce an alkaline protease. This particular strain was selected for further analysis and characterization. We conducted several tests and experiments to optimize the production of the protease enzyme by altering various physical and nutritional parameters. Furthermore, we carried out a biochemical analysis to determine the metal cofactor, amino acid requirements, and resistance to detergents and organic solvents of the protease.
Organic food waste stream sample was collected from local food street rich with food waste materials. For further analysis, the samples were transported to the laboratory in a sterile container. The collected samples were diluted in sterile 0.9 g/L saline solution of 100 mL in 250 mL conical flask and agitated at 150 rpm for 30 min in a water bath shaker at 37oC. One mL of dilution was plated onto nutrient agar plates. The inoculated plates were then incubated at 37o C for 48 h. The colonies were isolated from nutrient agar plates and streaked in fresh plates until single uniform colonies were obtained.
Screening of proteolytic bacteria
Skim milk agar medium [10.0g/L Skim milk, 1.0g/L Peptone, 5.0g/L NaCl and 20.0g/L agar] [pH 7.0] was prepared and sterilized at 121°C for 15 minutes. TAS-2 colonies were picked from nutrient agar plate and streaked the Skim milk agar Petri plates. The inoculated plates were incubated at 37°C for 72 hours at static chamber. A clear zone on skim milk agar plates were examined for qualitative detection of proteolytic activities exhibited by the TAS-2. TAS-2 isolate was biochemically characterized using standard procedure and protocols of Bergey's Manual of Determinative Bacteriology [12]. The TAS-2 colony was tested for gram staining, spore staining, catalase test, methyl red test, indole test, ogesproskauer test, citrate utilization test, nitrate test, urease test, and hydrolysis of casein. Approximately 6 mL of sterile nutrient agar was placed in a sterile test tube and placed on an inclined level to solidify at room temperature. A sterile loop was used to transfer TAS-2 colonies in test tubes, and then incubated at a temperature of 37 °C for 24 h and stored in a refrigerator at a temperature of 4 °C for subsequent experiments.
Selection and molecular identification of target strain
To find out the strain that releases protease, 50 ml of nutrient broth [pH 7.0] was inoculated with TAS-2 and incubated at 37°C for 24 hours in shaking incubator set at 150 rpm. After that, the culture broth was centrifuged for 10 minutes at 4°C at 10,000 rpm. Pure genomic DNA was isolated from 24h old TAS-2 culture cells. Polymerase chain reaction [PCR] was performed for 16S rRNA genes with the following universal
Table 1: Polymerase chain reaction [PCR] reaction and cycle conditions
|
Primer F1 |
[5’AGAGTTTGATCCTGGCTCAG3’] |
|
Primer R1 |
[5’ACGG(H)TACCTTGTTACGACTT3’] |
|
Initial denaturation |
95°C for 5 minutes |
|
Cycle denaturation |
95°C for 30 sec |
|
Cycle annealing |
52°C for 30 sec |
|
Cycle extension |
72°C for 30 sec |
|
Finale extension |
72°C for 5 minutes |
|
Total cycles |
30 |
After completion of PCR, 2 μL reaction was loaded on to the 1% electrophoresis gel to confirm PCR band. The amplified 16 sDNA sequence was sequenced by Automated DNA sequencing method. The obtained sequence was analyzed using the BLAST resource website from NCBI, and similar species sequences were used for construction on Neighbor joining trees [13].
Production of alkaline protease
For protease production, a colony of TAS-2 from stored slant was transferred into 100 mL of TSB [1.7% tryptone, 0.3 % peptone, 0.25% glucose, 0.5% NaCl] under Laminar airflow aseptic condition. Prior to sterilization at 121°C for 15 minutes, the medium's pH was adjusted to 7.0± 0.2. In a water bath shaker, the inoculated broth was kept for 24 hours at 37°C at 150 rpm. Subsequently, 1% (v/v) of this inoculum was used to inoculate a 250 mL flask containing sterile 100 mL of basal medium [pH 7.0± 0.2] [1.0g/L K2HPO4, 1.0g/L MgSO4.7H2O, 5.0g/L NaCl, 1.0g/L Peptone, 1.0g/L Yeast extract]. The medium was incubated at 37°C in water bath shaker at 150 rpm for 120h. At the harvesting points, the fermented broth was centrifuged at 10000 rpm at 4oC for 10min. The supernatant was used for protease activity.
Protease assay
Protease was assayed as previously described. Protease activity mixture contains 0.5 mL of 0.5% casein, and 1 mL culture-free filtrate. Following ten minutes of incubation at 37°C, 5 mL of 100 mmol/l trichloroacetic acid (TCA) was added to the reaction mixture in order to stop the enzyme reaction. The supernatant was collected after the reaction mixture was centrifuged for 20 minutes at 10000 rpm. To 2 millilitres of the supernatant, add 5 millilitres of an alkaline solution (500 mmol/l Na2CO3) and 1 millilitre of a 25% Folin phenol reagent at room temperature. Protease activity was measured spectrophotometrically at 660 nm after 30 minutes. Control sample reaction comprise of 1 mL heat-inactivated enzyme, and 0.5 mL of 0.5% casein. The amount of enzyme needed to release one 1 µmol of tyrosine per millilitre per minute is known as one unit of protease activity. BSA was used as a standard to calculate the samples' total protein content using the methodology outlined by Lowry [14].
Protease activity was calculated from the formula.
The calculation of the sample's specific activity involved dividing the enzyme units (U) by the amount of protein present.
TE= total enzyme, TP= total proteins
This is the percentage of the activity of a sample relative to the sample in which the maximum activity was obtained.
AS= activity of sample in [u], MEA= maximum enzyme activity [u]
This represents the percentage of an enzyme's activity in a sample compared to the activity of the control (the sample that was not treated).
AS= activity of sample in [u], AC= activity of control [u]
Factors optimization for protease expression
Various parameters influencing enzyme production during submerged fermentation were optimized. The strategy was to optimize each parameter individually and subsequently combine the optimal conditions to obtain an increase in the yield. Various parameters optimized for maximal enzyme production, in sequential order are as follows: incubation period, pH, temperature, agitation speed, size and age of inoculum, substrate concentration, fermentor volume, different nitrogen sources, and different carbon sources.
Incubation time
A 250 ml conical flask containing 100 mL of TSB [17 g/L tryptone, 3 g/L soy peptone, 2.5 g/L glucose, 5 g/L NaCl, and 2.5 g/L K2HPO4] was used to investigate the impact of incubation period on protease production. All the flasks were autoclaved at 121 °C and 15 lb pressure for 20 min. The media were cooled down and then evenly distributed inoculums were added. The incubation period was set at 37 ± 1°C for 24, 48, 72, 96, and 120 hours. Afterward, the culture filtrate was collected, and the enzyme activity was assessed.
pH
To observe the effect of pH on enzyme production, 100 mL of TSB was taken in 250 ml conical flask. The initial pH of the medium was adjusted to 6-11 before autoclaving at 121°C for 15 min. All the flasks were inoculated with equal quantity of fresh inoculum and incubated at 37o C. At the harvesting points, the fermented broth was centrifuged at 10,000 rpm at 4oC for 10min.The protease activity was measured using cell free filtrate.
Temperature
Equal amounts of culture were added to a series of 250 ml conical flasks containing 100 ml of TSB in order to find out the effect of temperature on protease production. To find the ideal temperature for protease production, each flask was incubated at 30, 40, 45, 50, 55, 60, and 70°C.
Agitation
To examine the impact of speed on protease synthesis, different agitation speeds (100, 125, 150, 175 and 200 rpm) were used during flask fermentation. In the harvesting points, the fermented broth was centrifuged for ten minutes at 4°C at 10,000 rpm. A cell-free filtrate was used to measure protease activity.
Substrate Concentrations and Nitrogen Sources
A range of casein concentrations (1-5% w/v) was used to examine the impact of substrate concentration on protease generation. Several nitrogen sources were added to the medium, including peptone, beef extract, meat extract, casein, gelatin, urea, sodium nitrate, and ammonium chloride at a concentration of 1% (w/v). After that, the mixture was incubated. Upon completion of fermentation, enzyme activity was determined.
Carbon Sources
To determine the effect of various carbon sources on protease production by TAS-2, the production medium was enriched with different carbon sources such as glucose, lactose, fructose, sucrose, xylose, maltose, raffinose, and starch. These sources were added at a concentration of 0.5% (w/v), and incubated. The enzyme activity was then measured at the end of the fermentation process. After that, the ideal carbon source for maximum enzyme production was identified by modifying its concentration to 0.5%, 1%, 1.5%, 2%, and 2.5% (w/v).
Protease Purification
The 500 mL basic culture medium [1.0g/L K2HPO4, 1.0g/L MgSO4·.7H2O, 5.0g/L NaCl] was combined with all the ideal parameters in a 1000 mL vessel, and the mixture was fermented for 72 hours under ideal conditions. A cell-free filtrate was used to measure the enzyme activity of the fermentation broth containing crude TAS-2 protease at harvest time. The broth was centrifuged at 10,000 rpm for 10 min at 4°C.Centrifugation was used to separate the culture supernatant from the growth medium, and then ammonium sulfate precipitation (at 60,70 and 80% saturation) was used. The precipitate was obtained by centrifuging it at 7500 rpm for 20 minutes at 4°C, and the pellet that was produced was then resuspended in Tris-HCl (0.1M, pH 8.0). By dialyzing against a Tris-HCl (0.1M, pH 8.0), the ammonium sulfate was eliminated. A DEAE-cellulose column from Sigma-Aldrich in Missouri, USA, was used to bind the dialyzed product, and a solution of 0.5 M NaCl and Tris-HCl (0.1M, pH 8.0), was used to elute the protease at a flow rate of 0.8 mL/min. Using the Bradford assay technique, the protein concentration was determined [15]. The samples having the highest protease activity were combined and applied at a flow rate of 0.5 mL/min to a Sephadex G-200 column (Sigma-Aldrich) that had been pre-equilibrated with Tris-HCl (0.1M, pH 8.0) [14].
Enzyme Characterization
The physico-chemical characteristics of the partially purified protease were assessed.
Effect of Temperature on Protease Activity
The study aimed to evaluate the effect of temperature on the activity of proteases. The reaction mixtures were exposed to different temperatures, ranging from 25 to 60ºC, in Tris-HCl buffer. The substrate used was casein (1%), and the relative activity was measured under standard assay conditions.
Effect of pH on Protease Activity
For pH effect on protease activity, the pH levels were adjusted from 4.0 to 11.0 using different buffers, including sodium acetate (pH 4.0-5.5), sodium phosphate (pH 6.5-7.5), Tris–HCl (pH 7.2-9.0), and glycine-NaOH (pH 8.6-11.0). The reaction mixture contained 1% casein substrate and was incubated at 37 degrees Celsius for 30 minutes. After incubation, the relative activity of the enzyme was assessed.
Effect of Inhibitors on Enzyme Activity
To test effect of inhibitors on the partly purified enzyme, at optimum conditions, the partly purified protease was first pre-incubated and then incubated with different inhibitors, such as PMSF, EDTA, and DTT, at a final concentration of 5 mM for 60 minutes at 60 degrees Celsius. The residual activity of the enzyme was then measured and compared to the control group (without inhibitors).
Effect of Surfactants on Enzyme Activity
The experiment aimed to examine the effect of different surfactants, such as SDS, Triton X-100, CTAB, and Tween-60, on enzyme activity. The enzyme was pre-incubated with each surfactant separately at a final concentration of 5 mM for 1 hour at 60°C. After that, the residual activity of the enzyme was measured, and compared to the enzyme's activity without any surfactants, which was considered 100%.
Effect of Metal ions on Enzyme Activity
The effects of metal ions such as Ca2+, Mn2+, Fe2+, Zn2+, and Mg2+ on enzyme stability at the final concentration of 5mMwere investigated. The enzyme was pre-incubated with different metal ions at 5mM concentration for 1h at 60o C and then the residual activities were measured and compared with the control (without metal ions).
Effect of Temperature on Protease Stability
To determine the thermal stability of the partially purified enzyme, its residual activity was measured every 30 minutes under standard assay conditions. The enzyme was pre-incubated for 1 hour at different temperatures ranging from 55 to 70 degrees Celsius. A control group with 100% enzyme activity was used for comparison, which consisted of the enzyme that was not subjected to any heat treatment.
Effect of pH on Protease Stability
To study the effect of pH on protease stability, the partially purified protease's activities was evaluated under different pH conditions (ranging from 7 to 12) by pre-incubating it at 45°C for an hour in buffers of varying pH levels (0.1M). The buffers used included Dipotassium hydrogen phosphate [K2HPO4] (pH 6.0-7.5), Tris-HCl (pH 8.0-9.0), and Glycine-NaOH (pH 9.0-12.0). We measured the residual activity of the enzyme under standard assay conditions, with the enzyme's pre-incubation activity (100%) serving as the control.
In order to find strains with alkaline proteases, three bacterial strains were isolated from an organic food waste stream. To identify potential proteolytic enzymes, the isolated bacterial strains were cultured on nutrient agar plates and tested on skim milk agar plate (see Figure 1). Only one isolate, cultured at pH 7, demonstrated clear zones of removing on 1.0 percent skim milk agar media, indicating the presence of proteolytic enzymes [Fig.1B].
The strain TAS-2 was grown in 100 mL of medium at 37°C and 150 rpm for 120 hours under submerged fermentation conditions with a pH of 7.0 to identify it for protease production. Samples were collected at different time intervals and then centrifuged at 10,000 rpm for 10 minutes at 4°C. The enzyme activity was measured after the supernatant was collected (see Figure 2). The TAS-2 cells grew exponentially at a rapid pace for 24 hours and then steadily for another 120 hours. The maximal biomass concentration of 1.712 mg/mL was achieved after 24 hours (Fig. 2A). After 24 hours of incubation at 37°C and pH 7.0, TAS-2 showed enzyme activity (38.6 U/mL) (Fig. 2B). The enzyme activity of the cell-free culture supernatant was also measured. Enzyme secretion was observed to start in the early stages of the exponential growth phase, but it did not reach significant levels until the end of this phase. Some bacilli, such as B. subtilis and B. licheniformis, are known to produce proteases during the sporulation stage. However, other research indicates that little to no enzyme synthesis occurs during the exponential growth phase. Nevertheless, bacterial enzyme synthesis during the mid-exponential period is associated with growth, and often, as the culture reaches its peak enzyme activity, a quick auto-deactivation mechanism is observed.
Bergey's Manual of Determinative Bacteriology procedures [12] were followed for the morphological and biochemical characterization of this strain. Morphological and biochemical studies revealed that the isolate TAS-2 forms pale yellow, and circular colonies. The strain was aerobic, rod-shaped, gram-positive, motile and can produces spores. The isolate was positive for casein hydrolysis, and negative for catalase, Voges proskaur, methyl red, indole and nitrate reduction tests. The cultural, morphological and physiological characteristics of TAS-2 are shown in Table 2.
Table 2: Morphological and biochemical characterization of colony of the TAS-2
|
Test |
Isolate features |
|
Colony morphology and characteristics |
Single, circular, convex, yellow |
|
Gram’s Reaction |
Positive |
|
Cell shape |
Rods shape |
|
Spores |
Positive |
|
Respiration |
Aerobic |
|
Citrate test |
Negative |
|
Methyl red test |
Negative |
|
Urease test |
Negative |
|
Indole test |
Negative |
|
Nitrate reduction test |
Negative |
|
Voges Proskauer test |
Negative |
|
Casein hydrolysis |
Positive |
|
Motility |
Positive |
|
Glucose fermentation |
Positive |
|
Sucrose fermentation |
Positive |
|
Lactose fermentation |
Positive |
|
Starch hydrolysis |
Positive |
Biochemical and morphological characteristics only provide a systematic (phenotypic) identification. But the only method that can truly identify the isolated organism is through molecular (genotypic) research. To identify an industrially significant bacterium like TAS-2, the 16S rRNA sequencing approach should be used. The genotype of TAS-2 was identified using 16S rRNA sequencing. To determine the maximum degree of similarity, the partial 16S rRNA sequence of TAS-2 was compared to those of other bacterial strains using the similarity matrix. Based on further characterisation tests and 16S rRNA sequencing. The derived partial 16S rRNA sequence of TSA-2 was added to GenBank with accession number [OR984183]. A phylogenetic tree (Figure 3) was constructed based on the partial 16S rRNA sequence. It revealed that the strain is closely related to Bacillus. Amlyoliquefaciens strains (99.9%), Bacillus vallismortis (99.0%), Bacillus subtilis [99.0%], Bacillus Valezensis (99.0%) and other bacillus species in the National Center for Biotechnology Information (NCBI) GenBank.
Screening for Optimum conditions
Various parameters influencing enzyme production during submerged fermentation were optimized. The strategy was to optimize each parameter individually and subsequently combine the optimal conditions to obtain an increase in the yield. Various parameters optimized for maximal enzyme production, in sequential order are as follows. The study on incubation period revealed that the organism is capable of producing maximum level of protease at 24 h. When the organism entered the stationary phase, the enzyme yields dramatically decreased. This could be due to nutrient depletion in the production media. In the assay of different pH (6.0-11.0) on protease production [Figure 4], the The pH level ranging from 8 to 9 was found to exhibit the highest level of protease activity. However, a significant drop in activity was observed as soon as the medium pH was increased to 10. It was discovered that the presence of alkaline conditions facilitated the growth of bacteria and the production of protease. It is possible that the reason for this observation is due to the self-digestion of protease at higher pH levels.
Fermentation is affected by various factors, with temperature playing a crucial role in the process. Temperature affects several aspects of fermentation, such as extracellular enzyme secretion, energy metabolism, and enzyme synthesis. Based on the data regarding TAS-2 protease production, it was observed that temperature played a crucial role in enzyme activity. The enzyme activity was maximum of (40.1 U/mL) at temperature 40°C. Therefore, the ideal temperature range for the production of alkaline protease by TAS-2 bacteria was found to be 40-45°C. The activity gradually decreases further beyond 50°C. It was also revealed that the agitation speed of the media has an impact on the nutrients required by the microbe to produce protease. The optimal agitation speed for protease production was found to be 150 rpm and the activity was (39.85 U/mL) [as shown in Figure 5]. The findings showed that agitation speeds had a more significant effect on protease synthesis and cell proliferation. Lower or higher agitation rates caused inadequate mixing and stress on the microorganisms, resulting in decreased cell growth and protease synthesis.
To achieve a high protease output via TAS-2, the age of the inoculum was adjusted [as shown in Figure 6A]. The inoculum that was 24 hours’ old showed the highest protease activity of (35.2 U/mL). As the inoculum's age increased further, enzyme production decreased.
The size of the inoculum significantly impacted the growth. The duration of the initial developmental stages depended on the cell density of the culture used to inoculate the fermentation medium. Enzyme synthesis and cell proliferation were also influenced by the inoculum size. A very low density of inoculum [as shown in Fig.6B] may indicate longer lag and log-phases, which would negatively impact the output. However, a very high inoculum density may cause growth inhibition due to the presence of toxic, inhibitory metabolic chemicals in excess amounts. The maximal protease production of (35.2 U/mL) was noted for 2% inoculum size, as shown in [Fig.6B].
The effect of substrate concentration on protease production was analyzed [Figure 7A]. The casein concentration of 3.0% showed maximal of (35.2 U/mL) production. The effect of fermentor capacity was tested for maximum protease production. Highest level of protease of (41.1 U/mL) production was observed [Fig.7B] with fermentor (flask) of 250ml capacity of the production media.
Most bacteria can digest both organic and inorganic nitrogen to create proteins, nucleic acids, amino acids, and components of cell walls. Nitrogen makes up 15.6% of alkaline protease, and the enzyme needs a medium that can provide carbon and nitrogen to produce its product. The synthesis of alkaline protease usually requires complex nitrogen sources. However, studies have shown that the effects of a particular nitrogen supplement on protease production vary from one organism to another. Different nitrogen sources, such as peptone, beef extract, meat extract, casein, gelatin, urea, sodium nitrate, ammonium chloride was supplemented (1%) to the growth medium and the enzyme activity was measured. Organic nitrogen source at initial concentration of 1% (w/v) significantly enhanced the alkaline protease production (Figure 8A). Ammonium chloride, casein and beef extract showed higher enzyme activities, although, the concentration of best nitrogen source was varied to determine the optimum value. The type of carbon source used as a nutrient has a significant impact on protease synthesis in the microbial culture medium. In the present study, bacterial culture was supplemented with various carbon sources. The result explains the requirement of carbon source for efficient production of protease, as there is no major variation in the enzyme activity with different carbon sources, and mostly carbon sources enhanced enzyme activities. The best of them are starch and xylose for inducing protease production and turned out to be the effective carbon source (Figure 8B).
Effect of various amino acids on protease production was also determined. Increase in protease production was observed media was amended with arginine and valine respectively. Similarly, glutamic acid and glycine showed inducible and positive effect on protease production. Effect of various metal ions on protease production was also tested. From the results, it was observed that Fe2+ and Zn2+ions were inhibitory at given concentration while Mg2+, Mn2+ and Ca2+ showed a stimulatory effect on protease production.
Enzyme Purification
All the optimized parameters were incorporated in to the reference medium and fermentation was carried out under optimal conditions. At the harvesting point, fermented broth was centrifuged at 10,000rpm for 10 min at 4oC and the enzyme activity was measured using cell free filtrate. The protease activity was increased 2.1 fold in the synthetic medium when compared to that of complex media. Among the complex media, the foxtail millet medium showed higher protease activity. Protease was partially purified from cell free filtrate of Bacillus amyloliquefaciens TSA-2 cultured by employing ammonium sulphate precipitation followed by dialysis. Maximum amount of protein was precipitated at 70-80% saturation of ammonium sulphate. The outcome of ammonium sulphate precipitation was 1.56- fold increase in purity and 80.5% yield of protease. When the precipitated protein was dialysed, the purification was further increased to 1.35 fold with 71.3% yield [Table 3].
Table 3: Purification scheme of alkaline protease
|
Purification steps |
Protein concentration (mg) |
Protease activity (U/mL) |
Specific activity (U/mg) |
Fold of Purification |
Yield [%]
|
|
Crude enzyme |
2.5 |
60.2 |
38.5 |
- |
- |
|
After salt precipitation |
1.32 |
66.2 |
52.0 |
1.56 |
80.5 |
|
After dialysis |
1.11 |
59.9 |
56.5 |
1.35 |
71.3 |
Enzyme Characterization
Figure 10 illustrates the relative activity of the partly purified enzyme that uses casein as a substrate at different temperatures. The optimal temperature for protease activity is 50°C. Beyond 55°C, the enzyme activity decreases steadily. Another group of researchers reported a similar outcome, where an alkaline protease from a Bacillus sp. strain reached a maximum temperature of 50°C. Protease relative activity is high [80-85%] at the 45–55°C temperature range, which is vital for the detergent industry's use of alkaline protease. Figure 10 demonstrates the relative activity at various pH levels. The enzyme's activity increases proportionately with increasing pH from 6 to 9. The ideal pH for protease action is pH 9. The protease retained more than 75-80% of its initial activity between pH 7 and 11, proving its stability across a wide pH range. Raising the pH beyond the optimal range can affect the enzyme's amino acid composition, resulting in a rapid decrease in enzyme activity. Therefore, the enzyme was identified as a common alkaline protease.
Effect of Inhibitors, surfactant, osmolytes and metal ions on Protease
The effect of different inhibitors (PMSF, EDTA, and DTT at 5mM concentration) on the activity of a partially purified protease enzyme was evaluated. The results showed that PMSF caused substantial inhibition of enzyme activity, up to 83%. This indicates the presence of an active serine residue at the enzyme's active site. On the other hand, DTT did not have any effect on enzyme activity, while EDTA caused moderate inhibition of up to 62% [Fig11.A].
After pre-incubating the enzyme at 60°C for one hour, the enzyme's stability was tested in the presence of various surfactants like SDS, Triton X-100, CTAB, and Tween-80 (5mM). The residual activity was measured and compared to the control, which was considered as 100% activity in the absence of any surfactant. Among the surfactants studied, Triton X-100 showed a 150% increase in proteolytic activity, while CTAB showed 80 % increase. The enzyme retained 100% activity in the presence of both SDS (anionic detergent) and Tween-80 [Fig11.B].
The study also evaluates how different osmolytes (10% w/v) affect the stability of an enzyme after being preincubated at 60°C for an hour. The residual activity was measured, and the enzyme's activity without any osmolytes was considered as 100% (control). Among the osmolytes tested, the enzyme's activity increased by 100% with the addition of sucrose, and by 80% with the addition of KCl [Fig11.C].
Divalent cations, including Mg2+, Fe2+, Zn2+, and Mn2+, or a combination of these cations, are crucial for the optimum functioning of alkaline protease. It has been found that these cations enhance the thermal stability of alkaline protease. Cations play a vital role in maintaining the enzyme's active structure at higher temperatures and safeguarding it against thermal denaturation. In order to identify the catalysts and inhibitors of the catalytic process, different metal ions were examined in a study. The findings revealed that Ca2+ at a concentration of 5 mM improved enzyme activity by up to 43%. However, residual activity increased by only 25% with Mg2+ (5 mM) and 8% with Mn2+ (5 mM). On the other hand, Zn2+ (20%) and Fe2+ (50%) reduced residual activity [Fig11.D].
The stability of protease under different temperature was determined. The enzyme maintained its activity even after heating to 55oC for 60 min. After an incubation period of 60 minutes at 70°C, there was a 50% reduction in enzyme activity. The enzyme was also tested to temperatures of 60°, and 65° for 60 min, resulting in 18%, and 30% loss of enzyme activity, respectively [Fig.12A]. The stability of the protease enzyme was tested in buffers with varying pH levels. The enzyme remained stable between pH 8 and 11 and retained 80% of its initial activity, as shown in [Fig.12B]. However, at pH 12, the enzyme lost 35-40% of its activity.
Microorganisms produce various metabolites, including enzymes, during their development stages [16]. Proteases are produced by all microorganisms, including many types of bacteria [17]. Plate assays can be used to screen for protease-producing microbes, although some species may require further research if they produce narrow zones of hydrolysis. The physiological, metabolic, biochemical, molecular, and enzyme production characteristics of every microbial strain are unique. The Bacillus genus, which belongs to the Bacillaceae family, is made up of gram-positive rods. The chosen strain has been identified as a member of the Bacillus species within the Bacillaceae family using motility assays, which showed diffuse growth. For identification purposes, molecular investigations employed 16S rDNA gene sequences as genetic markers. According to blast investigations, the 16S rDNA sequence has a similarity of 93.0–99.0% with several Bacillus species [5]. Many commercially available proteases have limited applications due to the harsh environmental conditions. These conditions, such as extremes in pH, temperature, and salinity, can hamper the effectiveness of the enzymes [8]. In the current study, a bacterium called B. amyloliquefaciens TSA-2 was isolated from food waste stream. It was found that waste sites may have higher pH levels due to the detergent rich organic matter. This organic matter accelerates the rate of exchangeable cations and mineralization. One possible reason for the high pH levels could be that it contains a large amount of exchangeable sodium cation, and the microorganisms adapt to extreme environmental conditions and survive [5, 18]. During the initial screening, it was observed that certain bacterial strains produced halo zones on skim milk agar plates, indicating that they carried out a proteolytic process with the help of extracellular proteases. It was also discovered that these bacterial strains had the highest protease synthesis in the pH range of neutral to alkaline. Among these strains, B. amyloliquefaciens TSA-2 showed maximum protease activity at pH 9, which indicated that it could be producing alkaline proteases. Similar observations were made in previous studies on Bacillus species, which also showed peak protease production at pH 8 and 9 [14]. Furthermore, B. amyloliquefaciens TSA-2 produced the most protease at a temperature of 40–45°C, suggesting that these bacteria were mesophilic. However, an increase in temperature beyond this range resulted in a reduction in protease synthesis, indicating that high temperatures disrupted the molecular structure of the bacteria, causing them to stop producing proteases. Other studies have suggested that the ideal temperature for protease generation in Bacillus subtilis is 37°C [14]. In the case of B. amyloliquefaciens TSA-2, a 24-hour incubation period was found to be ideal for maximum protease synthesis.
It was also observed that the maximum synthesis of extracellular proteases occurs during the late logarithmic and early stationary phase, when bacteria begin secreting proteases to break down complex nutrients in the absence of carbon and nitrogen sources [19]. According to previous reports, the ideal pH range for Bacillus species proteases is 6–10, and their stability values span a wide pH and temperature range (37–60°C) [14]. After optimization, the protease production for B. amyloliquefaciens increased from 38 U/mL to 60.8 U/mL, suggesting that these bacteria could potentially generate proteases that are highly halotolerant [20]. However, it was noted that high ionic strength could disrupt the enzyme structures of these bacteria, leading to a subsequent decrease in protease synthesis. This finding suggests that the protease produced by B. amyloliquefaciens TSA-2 is highly halo-tolerant and could be used in a variety of high-salinity industries[14]. The partial purified proteases from strain was found to be highly alkali-tolerant, which means they can tolerate a broad pH range of 8 to 11. This is their most important feature [21]. Specifically, at pH 9, the protease of B. amyloliquefaciens TSA-2 exhibits its optimum activity. It is known that several commercially significant proteases have their maximal activity in a wide range of pH values between 8 and 11 [1]. The detergent industry can benefit from this enzyme's strong protease activity throughout a broad pH range, as many commercially significant proteases are utilized in this sector and function best at pH values between 7 and 11 [21]. This protease can also be used to make protein hydrolysates, employed as an addition in dishwashing and cleaning detergents, and utilized in the dehairing and bating operations of the leather industry [22]. The proteases' thermotolerant character is shown by the fact that B. amyloliquefaciens TSA-2 showed the highest protease activity at 40°C and 60°C, respectively. An investigation indicating peak protease activity up to 60°C lends more credence to this [23]. Therefore, it can be concluded that these proteases are both alkaline and thermotolerant. Proteases have thermostable activity at optimal temperature ranges of up to 60°C, making them a perfect fit for the detergent industry. Such thermostable proteases can also be utilized to reduce the chance of contamination by using procedures that are inappropriate for mesophilic microbes [24]. Proteases are useful in the detergent industries as they are stable in surfactants [21]. Both of these proteases demonstrated activity in the presence of non-ionic surfactants like Tween 80 and Triton X-100, as well as ionic surfactants like SDS. The proteases' tolerance towards SDS is a critical component of their utilization in the detergent industry, given SDS's widespread use as a detergent ingredient. Moreover, a large number of SDS-stable proteases derived from Bacillus species have been discovered [25]. Microbe-produced alkaline proteases are also frequently utilized in the leather industry. These proteases are particularly helpful in removing undesired pigments for the purpose of dehairing [26]. Bacillus species are also known to be appropriate for several other sectors [27]. Proteases derived from the Bacillus species have wide-ranging applications in various industries due to their ability to function at a broad pH and temperature range, their stability, and their resistance to alkaline and toxic substances [28]. These enzymes are important in the production of detergents, food products, leather, and agrochemicals. It is important to optimize the fermentation conditions for protease production, considering factors such as temperature, pH, and medium composition [29]. This study isolated B. amyloliquefaciens TAS-2 strain, and the results show that the enzyme has promising industrial potential due to its ability to withstand high pH and temperature conditions. According to these findings, B. amyloliquefaciens TSA-2 's extracellular alkaline proteinases might be a good fit for a variety of commercial uses, including food, detergents, leather goods, textiles, and pharmacy products. The use of alkaline bacterial proteases is expected to rise in the future due to their critical significance in several sectors. Future research of modifying genome of the strain might increase further the yield of proteases from B. amyloliquefaciens TSA-2 for use in various industrial applications.
In this study, the bacterial strain Bacillus amyloliquefaciens TSA-2, isolated from food waste stream was capable of producing protease. The optimal conditions for the productivity of Bacillus amyloliquefaciens TSA-2 protease were found to be pH 9, 40°C, 24 hours, 150 rpm, and 3% (w/v) casein. The protease from B. amyloliquefaciens TSA-2 was found to have a maximum activity of 59.9 U/mL when partially purified. The enzyme activity and stability of B. amyloliquefaciens TSA-2 protease were maintained at their maximum upto 60°C and pH 9, and were found to be stable in the presence of surfactants. The extracellular proteases displayed by these bacterial isolates could have potential applications as catalysts in the food, textile, and pharmaceutical industries, as well as a possible ingredient in detergent formulations. These uses would allow for better yield and properties. Due to their thermostable enzymes and tolerance to alkaline pH, these bacterial isolates have greater potential as biocatalysts and can be beneficial for the regional industrial sector. Overall, the study's findings suggest that the alkaline protease produced by B. amyloliquefaciens TSA-2 is thermotolerant, surfactant stable, and may have potential use in various industries.
Author Contributions: TAS did research, methodology, data curation, writing. HMA, ZL, AZ, and MB review and editing, ZL, and AMS, provide resources and funding acquisition. All authors have read and agreed to the published version of the manuscript.
Funding: This research received no external funding.
Data Availability Statement: All data is included in the manuscript
Acknowledgments: The authors extend their appreciation to the Researchers Supporting Project number (RSP2024R197), King Saud University, Riyadh, Saudi Arabia.
Conflicts of Interest: The authors declare no conflict of interest
- Rao, M. B., Tanksale, A. M., Ghatge, M. S., & Deshpande, V. V. (1998). Molecular and biotechnological aspects of microbial proteases. Microbiology And Molecular Biology Reviews, 62, 597–635.
- Umar, M., Rehman, A., Khan, I., Hayat, P., Hayat, A., Rehman, M. U., et al. (2023). Screening and optimization of extracellular pectinase produced by Bacillus thuringiensis SH7. Open Chem, 21, 20220358.
- Pravin, D., Sunil, B., Anjana, G., & Bhatt, S. (2014). Isolation, characterization and investing the industrial applications of thermostable and solvent tolerant serine protease from hot spring isolated thermophililic Bacillus licheniformis U1. Int J Appl Biol Sci, 2, 75–82.
- Farhan, B. A., Zhihe, L., Ali, S., Shah, T. A., Zhiyu, L., Zhang, A., et al. (2023). Multiple strategies for the development of multienzyme complex for one-pot reactions. Environmental Science And Pollution Research, 30, 64904–64931.
- Contesini, F. J., de Melo, R. R., & Sato, H. H. (2018). An overview of Bacillus proteases: from production to application. Critical Reviews In Biotechnology, 38, 321–334.
- Afzal, A., Shah, T. A., Saleem, M., & Tabassum, R. Characterization of extracellular protease from Bacillus licheniformis. Int J Biosci 11: 228–236.
- Afzal, A., Shah, T. A., Saleem, M., & Tabassum, R. (2018). Characterization of extracellular protease from Bacillus licheniformis. Int J Biosci, 11, 228–236.
- Sookkheo, B., Sinchaikul, S., Phutrakul, S., & Chen, S. T. (2000). Purification and characterization of the highly thermostable proteases from Bacillus stearothermophilus TLS33. Protein Expr Purif, 20, 142–151.
- Uyar, F., & Baysal, Z. (2004). Production and optimization of process parameters for alkaline protease production by a newly isolated Bacillus sp. under solid state fermentation. Process Biochemistry, 39, 1893–1898.
- Shah, T. A., Majeed, T., Rahman, S., ur, Ihsan, T., Aziz, T., Alharbi, M. (2023). Synergistic treatment of crude enzymes from Bacillus sp. strains to boost anaerobic fermentation of rice straw. Biomass Convers Biorefinery 1–11.
- Bhunia, B., Basak, B., & Dey, A. (2012). A review on production of serine alkaline protease by Bacillus spp. J Biochem Technol, 3, 448–457.
- Buchanan, R. E., Gibbons, N. E., & Cowan, S. (1974). Bergey’s manual of determinative bacteriology. No Title.
- Shah, T. A., Lee, C. C., Orts, W. J., & Tabassum, R. (2019). Biological pretreatment of rice straw by ligninolytic Bacillus sp. strains for enhancing biogas production. Environmental Progress & Sustainable Energy, 38, e13036.
- Hashmi, S., Iqbal, S., Ahmed, I., & Janjua, H. A. (2022). Production, optimization, and partial purification of alkali-thermotolerant proteases from newly isolated Bacillus subtilis S1 and Bacillus amyloliquefaciens KSM12. Processes 10: 1050.
- Bradford, M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, 72, 248–254.
- Shah, T. A., Zhihe, L., Zhiyu, L., & Zhang, A. (2023). New Development in Renewable Energy Research. Advanced Technology for Smart Environment and Energy (pp. 269–285). Springer.
- Umar, M., Rehman, A., Khan, I., Hayat, P., Hayat, A., Rehman, M. U., et al. (2023). Screening and optimization of extracellular pectinase produced by Bacillus thuringiensis SH7. Open Chem, 21, 20220358.
- Gençkal, H., & Tari, C. (2006). Alkaline protease production from alkalophilic Bacillus sp. isolated from natural habitats. Enyzme And Microbial Technology, 39, 703–710.
- Lakshmi, B., Sri, P., Devi, K. A., & Hemalatha, K. (2014). Media optimization of protease production by Bacillus licheniformis and partial characterization of Alkaline protease. Int J Curr Microbiol App Sci, 3, 650–659.
- Karray, A., Alonazi, M., Horchani, H., & Ben Bacha, A. (2021). A novel thermostable and alkaline protease produced from Bacillus stearothermophilus isolated from olive oil mill sols suitable to industrial biotechnology. Molecules, 26, 1139.
- Ramkumar, A., Sivakumar, N., Gujarathi, A. M., & Victor, R. (2018). Production of thermotolerant, detergent stable alkaline protease using the gut waste of Sardinella longiceps as a substrate: Optimization and characterization. Scientific Reports, 8, 12442.
- Beg, Q. K., Sahai, V., & Gupta, R. (2003). Statistical media optimization and alkaline protease production from Bacillus mojavensis in a bioreactor. Process Biochemistry, 39, 203–209.
- Ramkumar, A., Sivakumar, N., Gujarathi, A. M., & Victor, R. (2018). Production of thermotolerant, detergent stable alkaline protease using the gut waste of Sardinella longiceps as a substrate: Optimization and characterization. Scientific Reports, 8, 12442.
- Saleem Aimen, Hafiz Umar, T. A., Shah, R., & Tabassum (2020). Fermentation of simple and complex substrates to biohydrogen using pure Bacillus cereus strains. Environ Technol Innov 100704.
- Karlsson, A., & Arvidson, S. (2002). Variation in extracellular protease production among clinical isolates of Staphylococcus aureus due to different levels of expression of the protease repressor sarA. Infection And Immunity, 70, 4239–4246.
- Sawant, R., & Nagendran, S. (2014). Protease: An enzyme with multiple industrial applications. World J Pharm Pharm Sci, 3, 568–579.
- Hammami, A., Fakhfakh, N., Abdelhedi, O., Nasri, M., & Bayoudh, A. (2018). Proteolytic and amylolytic enzymes from a newly isolated Bacillus mojavensis SA: characterization and applications as laundry detergent additive and in leather processing. International Journal Of Biological Macromolecules, 108, 56–68.
- Rehman, A., Saeed, A., Asad, W., Khan, I., Hayat, A., Rehman, M. U., et al. (2023). Eco-friendly textile desizing with indigenously produced amylase from Bacillus cereus AS2. Scientific Reports, 13, 11991.
- Shah, T. A., Favaro, L., Alibardi, L., Cagnin, L., Sandon, A., Cossu, R., et al. (2016). Bacillus sp. strains to produce bio-hydrogen from the organic fraction of municipal solid waste. Applied Energy, 176, 116–124.