2.1 Animal care and treatments
Eight-week-old male C57BL/6 mice were purchased from Qing Longshan Animal Breeding Field (Nanjing, China). All animal experiments were approved by the Ethics Review Board for Animal Studies of the Institute of Southeast University (Nanjing, China) and adhered to the established guidelines published by the US National Institutes of Health. Under standard environmental conditions, all animals were housed and had ad libitum access to food and water.
The mice were randomly divided into sham, 7dpmi (7-day post-MI), 14dpmi (14-day post-MI) and 28dpmi (28-day post-MI) groups (n = 6 per group) and underwent surgical induction of MI by permanent coronary ligation or sham operation. Briefly, the mice were anesthetized intraperitoneally with sodium pentobarbital (50 mg/kg, Merck, Germany). Following endotracheal intubation, they were placed on a ventilator, and a left lateral thoracotomy was performed to expose the left ventricle. The left coronary artery was ligated using an 8−0 silk suture. Successful ligation was confirmed by observing left ventricular pallor immediately after ligation. Mice in the sham group underwent similar surgery without ligation.
To investigate the role of METTL3 in vivo, AAV9 carrying a periostin promoter driving the expression of short hairpin RNA (shRNA) targeting METTL3 (AAV9-periostin promoter-eGFR-shMETTL3, AAV9-shMETTL3, TAATGTCCCATACGGTAGCTC) or a negative control (AAV9-periostin promoter-eGFR-shNC, AAV9-shNC, ACGTGACACGTTCGGAGAA) was constructed by Shanghai GeneChem Co. (Shanghai, China). Briefly, the mice were randomly divided into four groups: AAV9-shNC + sham (n = 6), AAV9-shNC +MI (n =6), AAV9-shMETTL3 +sham (n =6), and AAV9-shMETTL3+MI. At 3 days post MI or sham operation, each mouse was injected with AAV9-shMETTL3 or AAV9-shNC containing 2.5 × 1011 viral genome particles via the tail vein.
At 4 weeks post-treatment, the animals were sacrificed after excessive inhalation of CO2 and their hearts were harvested.
2.2 Cell culture and treatment
CFs were isolated from freshly euthanized C57BL/6 mice through enzymatic digestion, following a standard protocol[18]. Briefly, mouse hearts were rapidly excised, minced, and placed in cold phosphate buffered saline (PBS). The minced tissue was subsequently digested with a collagenase II (#V900892, Sigma-Aldrich, MO)/trypsin (Solarbio Life Sciences, Beijing) solution at 37℃ for 8 min. After six to seven digestion periods, the supernatants were centrifuged to collect the cells. Cells were resuspended in DMEM/F12 (#11320033, Gibco, MA) and incubated for 90 min to allow CFs to attach to the dishes. Subsequently, the cells in the medium were discarded. CFs were incubated at 37℃ in a humidified atmosphere of 5% CO2 and grown to 70–80% confluence. CFs were further cultured and passaged at a 1:3 dilution. Second- to fourth-passage CFs were used in the experiment.
2.3 Dot blot assay
RNA samples were isolated and purified using TRIzol reagent according to the standard protocol. After quantification and denaturation (95℃, 5 min), mRNA was loaded onto Amersham HyBond N+ membranes (Amersham, UK). Subsequently, the membrane was crosslinked with UV light for 5 min, followed by staining with 0.02% Methylene blue. Photographs were taken to determine the input RNA content. Subsequently, the membranes were washed with PBST and then blocked with 5% defatted milk for 1 h, followed by incubation with an m6A antibody (1:1000; Epigentek, #A-1801) at 4℃ overnight. Dotted blots were visualized after incubation with secondary antibodies.
2.4 m6A RNA methylation quantification
An EpiQuik m6A RNA methylation quantification kit (Epigentek Group Inc., Farmingdale, NY, USA, P-9005) was used to quantify N6-methyladenosine RNA methylation. Briefly, 300 ng of RNA was added to the wells, followed by the addition of capture antibody solution. Then, the detection antibody solution was added to the assay wells according to the manufacturer’s protocol. The m6A levels were quantified using colorimetry by reading the absorbance of each well at 450 nm.
2.5 Histology
The hearts were perfused with ice‐cold PBS to eliminate blood contamination and fixed in 4% paraformaldehyde overnight. Subsequently, they were embedded in paraffin and cut into sections of 5-μm thickness. Masson’s trichrome staining was performed according to standard methods.
2.6 MeRIP-qPCR
The m6A immunoprecipitation (MeRIP) procedure was performed using the MeRIP™ m6A kit (17-10499, Magna) according to the manufacturer's published instructions. Briefly, mRNA was fragmented and immunoprecipitated with Protein A beads pre-incubated with the anti-m6A antibody (ab208577, Abcam) in IP buffer. After elution, qPCR was performed to determine the mRNA levels. MeRIP-qPCR was performed in triplicates. The primer sequences used are listed as Table 1.
2.7 Western blot analysis
Proteins were extracted using a Protein Extraction kit (KeyGEN Biotech, #KGB5303-100), and their concentrations were determined using the BCA Protein Assay Kit (KeyGEN Biotech, #KGB2101-1000). Subsequently, the proteins were separated by SDS-PAGE and transferred onto PVDF membranes, which were then blocked with TBST containing 5% skimmed milk powder. Following blocking, the membranes were incubated overnight at 4℃ with specific primary antibodies and subsequently detected using an ECL protocol with horseradish peroxidase-conjugated IgG as the secondary antibody. Primary antibodies were utilized according to the manufacturer’s instructions (Table 2).
2.8 Echocardiography
Echocardiography was performed using a Visual Sonics Vevo3100 small-animal ultrasound scanner (FUJIFILM Visual Sonics, Inc) to assess cardiac function. Mice were anesthetized with 1.5% isoflurane and put in a supine position. Data from three consecutive cardiac cycles were analyzed for each measurement. Left ventricular systolic dimension (LVDs), left ventricular diastolic dimension (LVDd), and the thickness of the septal and posterior wall thicknesses were measured. LV systolic volume (LV Vol s), LV diastolic volume (LV Vol d), LV ejection fraction (LVEF), and fractional shortening (FS) were calculated from these measurements.
2.9 Cell transfection
Specific shRNAs against METTL3/SMOC2 and control shRNAs were synthesized by Shanghai GeneChem Co. (Shanghai, China). CFs were transfected with either shMETTL3/shSMOC2 or shRNA using Lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, USA). Relative shRNA sequences were as Table 3.
2.10 Cell counting kit‐8 assay
CFs were inoculated in 96 well plates and transfected with shNC or shMETTL3 under normoxic or hypoxic conditions for 48 h. Thereafter, 10 μL of CCK‐8 solution was added to each well and incubated for 2 h. The absorbance of each well was measured at 450 nm using a microplate reader (ELx800, Bio-tech, Germany). Viability = (absorbance of sample)/ (absorbance of control).
2.11 5‐Ethynyl‐2′‐deoxyuridine (EdU) incorporation assay
The EdU assay was procured from Donghuan (Shanghai, China). Initially, cells were treated with shNC, shMETTL3, or shSMOC2 under normoxic or hypoxic conditions for 48 h. Subsequently, the cells were incubated with 10 μM EdU solution for an additional 2 h. After fixation with 4% formaldehyde and the addition of 150 μL glycine, the cells were incubated with 0.5% Triton X‐100. Apollo reaction reagent (1×) was introduced, and then the cells were stained with 300 μL Hoechst (5 μg/mL) in darkness. EdU-labeled and unlabeled cells were then counted under a microscope (TE2000‐U; Nikon), and pictures were taken.
2.12 Immunofluorescence of tissue sections
Paraffin-embedded heart tissue sections were rehydrated in a series of graded ethanol solutions, followed by heating in ethylenediaminetetraacetic acid (EDTA) antigen retrieval buffer (ShareBio, SB-MY001) at a low boiling point for 15 min. Subsequently, the sections were blocked with 1 % BSA for 1 h. Primary antibodies against METTL3 and SMOC2 were incubated overnight, followed by a 2-h incubation with secondary antibodies. Nuclear staining was performed using DAPI stain. Images were captured using a Picture Scanner (Pannoramic MIDI, 3DHISTECH, Hungary) and analyzed by lmage Auto Analysis System (C.V.2.4, Servicebio, China).
2.13 Bioinformatic analysis
2.13.1 scRNA-seq analysis
The scRNA-seq dataset GSE145154 of MI was retrieved from the GEO database (https://www.ncbi.nlm.nih.gov/), comprising scRNA-seq data from left ventricle tissues of three infarcted myocardium and one healthy person. Large gene expression matrices were created using the “merge” function. Cells with >500 genes, <5,000 genes and <20% mitochondrial genes were retained. Gene expression lists were normalized using the “Normalize Data” function and further scaled. The samples were integrated using the anchors method in the R package "Seurat", and core cells were obtained by filtering scRNA-seq. Principal component analysis (PCA) was performed on single-cell samples, and 20 PCs were selected for UMAP algorithm analysis. Using the R package "Harmony,” 10 cell clusters were classified using the “FindClusters” function, and each cluster was manually annotated by the CellMarker database. Differential analysis was performed by using the “limma” package. P-value <0.05 and |Log2FC| >1 was designated as differentially expressed genes (DEGs). The "ggplot2" package was used to show the localization of genes.
2.13.2 MeRIP-seq analysis
The MeRIP-seq dataset GSE131296 of MI was retrieved from the GEO database (https://www.ncbi.nlm.nih.gov/) and contained four ischemic group samples and 10 normal group samples. The R package “DESeq2” was used for differential analysis; P-value < 0.05 and |Log2FC|> 1 were designated as DEGs. The “pheatmap” package was used to depict the top DEGs. Then, GO and KEGG enrichment analyses were performed using the “clusterprofile” function.
2.13.3 Protein-ligand interaction analysis
Obtain the METTL3 protein structure from the Uniprot database and model SMOC2 mRNA using the Build and Edit Hucleic Acid module in Discovery Studio 2019 Client software. Conduct protein-nucleic acid docking through HDOCK server. Use the PLIP interaction analysis platform to comprehensively describe and systematically analyze the binding sites.
2.14 mRNA stability analysis
Following transfection, CFs were incubated with actinomycin D (2 mg/mL; Sigma-Aldrich) for 0, 3, and 6 h, and SMOC2 expression was examined using RT-qPCR.
2.15 Statistical analyses
Quantitative data were expressed as the mean ± standard deviation. All data were analyzed using IBM SPSS Statistics for Windows version 26.0 (IBM Corp., Armonk, N.Y., USA). Student’s t-test was employed to determine the statistical significance between the two groups, while one-way analysis of variance (ANOVA) was used for comparisons of data among multiple groups. Bioinformatic analyses were conducted using R language (Version 4.0.3). A significance level of p< 0.05 was regarded as a statistically significant difference, while p < 0.01 indicated a high statistically significant difference.