Bacterial strains, cell lines, plasmids, and cultivation
M. synoviae strain WVU1853 was obtained from the China Veterinary Conservation Centre (CVCC, Beijing, China) and cultured in Mycoplasma medium base (Haibo, Qingdao, China) supplemented with 0.01% NAD (Roche, Shanghai, China), 1% L-cysteine (Solarbio, Beijing, China), 80,000 units of penicillin, and 10% swine serum (Minhai, Lanzhou, China) at 37°C in 5% atmospheric CO2. DF-1, a continuous cell line of chicken embryo fibroblasts, was obtained from Procell (Wuhan, China) and cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco, NY, USA). The cultured DF-1 was then supplemented with 10% fetal bovine serum (FBS; Biological Industries, Israel) at 37°C in 5% atmospheric CO2. Escherichia coli (E. coli) strains DH5α and BL21 (DE3) were cultured in Luria–Bertani (LB) broth or on solid media with 1.5% agarose, both of which were supplemented with 30 µg/mL kanamycin. pET-28a (+) expression vectors were obtained from Novagen (Germany).
Cloning, expression, and purification of EF-Ts
The M. synoviae strain WVU1853 was collected at the logarithmic growth stage, and the whole genome was extracted with a bacterial genomic DNA extraction kit (Tiangen, Beijing, China). According to the GenBank database (GenBank accession no. CP011096.1, Mycoplasma synoviae ATCC 25204), there are two tryptophan (TGA) codons in the CDS of M. synoviae EF-Ts that play a role in terminating expression in E. coli. Therefore, in this study, we designed three pairs of specific primers (Table 1), amplified the full-length sequence of M. synoviae EF-Ts by overlapping PCR to mutate the TGA point to TGG, and added the BamHI and XhoI restriction enzyme cleavage sites at both ends. The optimized M. synoviae EF-Ts gene was cloned and inserted into the pET-28a (+) expression vector and transfected into E. coli BL21 (DE3) cells by heat excitation. The expression of recombinant M. synoviae EF-Ts was induced by isopropyl-β-D-thiogalactopyranoside (IPTG; Solarbio, Beijing, China) at a final concentration of 1 mM at 16°C overnight, and the fusion proteins were obtained by Ni-NTA His-Tag purification Agarose (HY-K0210, MCE). The purified proteins were assayed for protein quantity using the BCA Protein Assay Kit (Beyotime, Shanghai, China), and the recombinant proteins were identified by 10% SDS‒PAGE with Coomassie blue staining.
Table 1
Primers used in this study
Primer | Sequence (5’-3’) | Localization |
EF-Ts-F1 | GGAGGATCC1ATGTCACAAAACAAACTAGAAT | 1–132 |
EF-Ts-R1 | GCGCTCGAG1TTATTTTGTCATTGAAGCAACT | |
EF-Ts-F2 | GCAATTAAATGG2TTAAAAGAAAAC | 109–696 |
EF-Ts-R2 | GTTTTCTTTTAAC2CATTTAATTGC | |
EF-Ts-F3 | TCAGGATGG2CTTGAC | 682–879 |
EF-Ts-R3 | GTCAAGC2CATCCTGA | |
1 Limitations of the endonuclease BamHI and XhoI checkpoints GGATCC and CTCGAG are shown in underlined italics. |
2 Nucleotide point mutation site. |
EF-TS polyclonal antiserum preparation and immunogenicity characterization
Polyclonal antibodies against M. synoviae EF-Ts protein were obtained by immunization of one-month-old New Zealand White rabbits with purified recombinant EF-Ts protein. Purified rEF-Ts proteins were emulsified with complete (first immunization; 800 µg of protein) or incomplete (second to fourth immunizations; 400 µg of protein) Fuchs adjuvant (1:1, v/v). The second immunization was performed two weeks after the first immunization; subsequent immunizations were given at one-week intervals for four immunizations total. The serum was collected 3 days after the fourth immunization and analyzed by enzyme-linked immunosorbent assay (ELISA) to determine the antibody titer. Briefly, 96-well plates were coated with 5 µg/mL rEF-Ts protein for 2 h at 37°C. After sealing with 5% skim milk powder, rEF-Ts antisera and preimmune serum were added to the wells in serial multiplicities and incubated for 1 h at 37°C, followed by incubation with a 1:5,000 dilution of goat anti-rabbit IgG-HRP. After termination of 3,3´,5,5´-tetramethylbenzidine (TMB) color development with H2SO4, the optical density (OD) was read at 450 nm, and the maximum dilution titer satisfying the criterion (OD positive/OD negative > 2.1) was recorded as the antibody titer. The specificity of the resulting polyclonal antibodies was verified using western blotting.
Analysis of complement-dependent killing of M. synoviae
Complement-dependent killing of M. synoviae was assessed as previously described with slight modifications [15]. Briefly, 2 ml of logarithmic growth phase M.synoviae in broth was collected, and the precipitate was obtained by centrifugation at 8,000 r/min for 10 min and resuspended in 1 ml of sterile PBS. The M. synoviae-immunized, rEF-Ts-immunized, and nonimmunized sera were inactivated at 56°C for 30 min. Sixty microliters of each inactivated serum sample was mixed with 180 µl of resuspended bacterial solution, then incubated at 37°C for 30 min, supplemented with 60 µl of complement, and mixed well. After incubation 1 hour, a 10-fold dilution was made, and three gradients, 10− 3, 10− 4, and 10− 5, were used to coat 60 mm solid media (100 µl/well). Each gradient was used for three parallel replicates. Colonies were counted after incubation at 37°C in 5% atmospheric CO2 for 3–5 days. Anti-M. synoviae serum, anti-rEF-Ts serum, nonimmunized serum, and a blank control (60 µl of PBS instead of serum) were used for the experiment, and the experiment was repeated 3 times. The bactericidal rate was calculated according to the following formula: [(CFU from nonimmunized serum treatment - CFU from antiserum treatment)/CFU from nonimmunized serum treatment) × 100%].
EF-Ts localization analysis of Mycoplasma synoviae
One hundred milliliters of M.synoviae cultured to the logarithmic growth stage was collected and resuspended in 1 ml of 1× PBS, after which the appropriate amount of M.synoviae was collected as whole bacterial protein. PMSF solution at a final concentration of 1 mmol/L and Triton X-114 at a final concentration of 1% were added to the remaining bacterial solution. After incubation on a shaking table at 4°C for 2 h, the supernatant was collected by centrifugation and incubated in a water bath at 37°C for 10 min, followed by centrifugation at 12,000 r/min at 4°C for 10 min. The upper aqueous and lower oil phases were separated, formaldehyde/chloroform (4/1) was added to the precipitated proteins, the mixture was centrifuged at 10,000 r/min for 10 min, an equal volume of 8 M urea was added to dissolve the proteins. The mixture was then stored at − 20°C after quantification using the BCA Protein Assay Kit. The distribution of the M. synoviae EF-Ts protein was determined using western blotting and ELISA.
Suspension immunofluorescence assay
The presence or absence of EF-Ts in the cell membrane was determined using the suspension immunofluorescence technique as previously described, with modifications [15]. Two milliliters of logarithmic growth phase M. synoviae strain WVU1853 was collected by centrifugation and resuspended in 1 ml of PBS. Then, 100 µl of the mixture was used to coat the slides, which were fixed with 4% paraformaldehyde for 15 min and blocked with 5% skim milk solution at room temperature for 1 h. After incubation with rabbit anti-EF-Ts or preimmune serum (1:200) for 1.5 h at 37°C, the cells were incubated with goat anti-rabbit IgG H&L/FITC secondary antibody (bs-0295G-FITC, Bioss, China) for 1 h and washed with PBST. Coverslips were added, and the samples were examined using a Zeiss Observer A1 inverted fluorescence microscope.
Analysis of EF-Ts binding to DF-1 cells
Membrane proteins were extracted from DF-1 cells using a Membrane Protein Extraction Kit (Solarbio, Beijing, China). ELISA was performed as previously described [14]: 500 ng of cell membrane proteins were encapsulated in each well of the ELISA plate, which was blocked using 5% skim milk. rEF-Ts and anti-rEF-Ts serum pretreated with rEF-Ts were added to the wells. Rabbit anti-rEF-Ts serum was used as the primary antibody, and goat anti-rabbit IgG H&L/HRP (bs-0295G-HRP) was used as the secondary antibody.
Cell immunofluorescence was used to determine protein adhesion as previously described [14]. DF-1 cells were incubated overnight in 12-well plates, the original medium was removed, and the cells were washed with PBS, fixed with 4% paraformaldehyde for 15 min at room temperature, and blocked with 5% BSA. The plates were incubated with 10 µg of rEF-Ts or BSA at 37°C for 2 h. Anti-EF-T serum was used as the primary antibody, goat anti-rabbit IgG H&L/FITC was used as the secondary antibody, DiI was used to mark the cell membranes, and DIPA was used to mark the nucleus. Following washing, the cells were observed using a Leica Deltavision Ultra Acquire Ultra microscope.
Adhesion inhibition analysis of anti-EF-Ts serum
The adhesion inhibition assay was performed as previously described with slight modifications. The rEF-Ts and M. synoviae were pretreated with rabbit anti-rEF-Ts serum or nonimmunized rabbit serum (1:50) for 1 h at 37°C and added to the cells. After 2 h of incubation, washing, and fixation, the cells were stained with antibodies and observed under a Leica Deltavision Ultra Acquire Ultra microscope.
The ability of rabbit anti-rEF-Ts serum to inhibit M. synoviae adhesion was examined by colony counting assay as previously described with some modifications [27]. Briefly, M. synoviae was pretreated with rabbit anti-rEF-Ts serum, rabbit anti-M.synoviae serum, or nonimmunized rabbit serum for 1 h at 37°C. DF-1 cells were pretreated with M.synoviae from each group at a multiplicity of infection (MOI) of 500 and incubated for 2 h at 37°C. Nonadherent Mycoplasma was then removed by washing three times with sterile PBS. The cells were lysed in 1 ml of pure water and resuspended in serial 10-fold dilutions. One hundred microliters of each dilution were spread on a Mycoplasma agar plate for colony counting. Three independent experiments were performed in triplicate.
EF-Ts binding to chicken Plg (cPlg) and human Fn (hFn)
The binding activities of EF-Ts to cPlg and hFn were determined by ELISA and dot blot analysis [28]. For the dot blot analysis, cPlg and hFn (5.0–0.3125 µg) were added dropwise in serial twofold dilutions to nitrocellulose filter membranes (NCs), with BSA as the negative control. The NC membranes were dried at 37°C for 2 h and then blocked with 5% skim milk powder for 1 h at room temperature. The NC membranes were conjugated with 10 µg of rEF-Ts overnight at 4°C. The membranes were washed with PBST, rabbit anti-rEF-T serum was used as the primary antibody, and goat anti-rabbit IgG H&L/HRP was used as the secondary antibody. Finally, membrane signals were detected using enhanced chemiluminescence (ECL) as described above.
For the ELISA, 96-well enzyme-labeled plates were coated with cPlg or hFn (1 µg/well) at 4°C and incubated overnight. After blocking with 5% skim milk powder, serially diluted EF-Ts or BSA were bound to the plates at 37°C for 2 h. The samples were washed with PBST, and the absorbance was measured at 450 nm using rabbit anti-rEF-Ts serum as the primary antibody and goat anti-rabbit IgG H&L/HRP antibody as the secondary.
rEF-Ts endocytosis pathway studies
For the colocalization studies, 20 µg of rEF-T protein was incubated with DF-1 cells at 37°C for 2 h, after which anti-rEF-T serum, Cav-1 monoclonal antibody (66067-1-Ig, Proteintech), and CLTC monoclonal antibody (66487-1-Ig, Proteintech) were used as primary antibodies, and goat anti-mouse IgG H&L/Cy3 antibody (bs-0296G-Cy3, Bioss, China) and goat anti-rabbit IgG H&L/FITC antibody were used as secondary antibodies. The colocalization of rEF-Ts with caveolin and clathrin was examined using laser confocal microscopy. The endocytosis inhibition assay was modified as previously described to detect the endocytosis pathway of rEF-Ts using two specific inhibitors [29, 30]. Pitstop-2 (HY-115604, MCE) is an inhibitor of clathrin protein-mediated endocytosis, and simvastatin (HY-17502, MCE) is an inhibitor of caveolin protein pathway-mediated endocytosis. DF-1 cells were treated with 25 µM simvastatin or 20 µM Pitstop-2 for 30 min and incubated with rEF-T proteins for 2 h at 37°C and 5% CO2. The cytoskeleton was labeled with Actin-Tracker Red-555 (Beyotime, Shanghai, China) and analyzed using a Leica Deltavision Ultra Acquire Ultra microscope.
Cell Counting Kit-8 (CCK-8) analysis
DF-1 cell proliferation was assayed using CCK-8 (Beyotime, Shanghai, China), and the results were analyzed according to the manufacturer's instructions. DF-1 cells (4 × 103) were inoculated into 96-well plates and cultured overnight. The medium was changed to DMEM supplemented with 2% FBS, different concentrations of rEF-Ts protein were added to the wells, and the cells were incubated for 24 h, 48 h, or 72 h. Then, CCK-8 solution (10 µl) was added to each well, the plates were incubated for 2 h, and the OD was detected at 450 nm.
Statistical analysis
All statistical analyses were performed using GraphPad Prism version 9.0. Student's t-test or ANOVA was used for multiple comparisons. *p < 0.5, **p < 0.01, ***p < 0.001, ****p < 0.0001. ns, no significant difference (p ≥ 0.5).