NHEJ and HDR occurring simultaneously during gene integration into the genome of Aspergillus niger

doi:10.21203/rs.3.rs-4313903/v1

Download PDF

Research Article

NHEJ and HDR occurring simultaneously during gene integration into the genome of Aspergillus niger

https://doi.org/10.21203/rs.3.rs-4313903/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 05 Aug, 2024

Read the published version in Fungal Biology and Biotechnology →

You are reading this latest preprint version

Non-homologous end joining (NHEJ) and homology-directed repair (HDR) are two mechanisms in filamentous fungi to repair DNA damages. NHEJ is the dominant response pathway to rapidly join DNA double-strand breaks, but often leads to insertions or deletions. On the other hand, HDR is more precise and utilizes a homologous DNA template to restore the damaged sequence. Both types are exploited in genetic engineering approaches ranging from knock-out mutations to precise sequence modifications.

In this study, we evaluated the efficiency of a HDR based gene integration system designed for the pyrG locus of Aspergillus niger. While gene integration was achieved at a rate of 91.4%, we also discovered a mixed-type repair (MTR) mechanism with simultaneous repair of a Cas9-mediated double-strand break by both NHEJ and HDR. In 20.3% of the analyzed transformants the donor DNA was integrated by NHEJ at the 3’ end and by HDR at the 5’ end of the double-strand break. Furthermore, sequencing of the locus revealed different DNA repair mechanisms at the site of the NHEJ event.

Together, the results support the applicability of the genome integration system and a novel DNA repair type with implication on the diversity of genetic modifications in filamentous fungi.

DNA repair

CRISPR/Cas9-mediated genome editing

DNA modification

homology-directed repair

non-homologous end joining

self-replicating plasmid

palindrome

The filamentous fungus Aspergillus niger is an important cell factory in the biotech industry, which is used to produce organic acids such as citric and gluconic acid, as well as proteins, like glucoamylase or phytase [1, 2]. Genetic engineering offers a powerful approach to enhance filamentous fungi in terms of their productivity as well as to minimize undesirable traits like side-product formation. These engineering approaches started in fungi by transforming plasmid [3, 4] or cosmid DNA [5], which was introduced into the genome, relying on ectopic genome integration through non-homologous end joining (NHEJ). Additionally, homology-directed repair (HDR) using typically linear expression cassettes with homologous 5´and 3 ´ flanking regions were employed for genome deletions [6]. In Saccharomyces cerevisiae, DNA double-strand break repair is facilitated primarily via HR [7] and is mediated by the RAD52 epistasis group: RAD50, RAD51, RAD52, RAD54, RAD55, RAD57, RAD59, RFA1, MRE11, XRS2, and RDH54/TID1. This group of genes is highly conserved amongst eukaryotes, including A. niger [4, 8, 9]. However, the occurrence of HR events in A. niger was found to be low, standing at 1.78–7%, with NHEJ appearing to be the primary DNA repair mechanism [4, 9, 10]. The introduction of specific genetic modifications in A. niger is a challenging task due to this factor. Upon the deletion of NHEJ factors Ku70 (kusA in A. niger) and Ku80 (kusB in A. niger), the occurrence of HR significantly increased (65 ->80%) [9, 10]. Through this, site-specific gene editing became more accessible and NHEJ deficient strains are thus used by many groups as a tool to enable targeted gene engineering. However, it needs to be considered that NHEJ deficient strains have a slightly higher mutation rate than wild type strains which is relevant if a strain is frequently passaged or kept in a continuous culture [11].

A homologous transformation system for A. niger based on the pyrG gene was described by van Hartingsveldt et al., 1987 [12]. It was found that the transformation frequency based on the pyrG gene was at least tenfold higher than the heterologous transformation system for A. niger using the amdS gene and argB gene of Aspergillus nidulans, and the pyr4 gene of Neurospora crassa [12–14].

Nødvig et al., 2015 [15] were the first to apply CRISPR/Cas9 [16] to several species of Aspergillus including A. niger. Since then, the usage of this system has been adapted and improved, for example, by finding suitable promoters for guide RNA expression based on 5S RNA [17] or tRNA promoters [18] and the topic was well reviewed [19, 20].

In addition to CRISPR/Cas9 systems, alternative gene editing and integration tools for filamentous fungi are available. These include systems based on the Cre-loxP system involving site-specific recombination events [21–23] and the FLP/FRT system, which, similar to the Cre-loxP system, relies on site-specific recombination events [24]. Both strategies are recognized as efficient genetic engineering tools. However, the insertion of specific recombination sites into the genome is necessary and therefore, not scarless.

In 2015 we proposed a toolkit for metabolic pathway construction and genetic engineering in A. niger [25]. This system consists of a modular vector construction system called GoldenMOCS, based on the Golden Gate cloning approach [26], and a gene integration system for A. niger using CRISPR/Cas9 and self-replicating plasmids. The GoldenMOCS platform enables the versatile integration of host-specific parts such as promoters, terminators and resistance cassettes, replication origins or genome integration loci to customize the plasmid to the needs of the experiment and the host cell to be modified. Parts libraries for other organisms like Pichia pastoris and Yarrowia lipolytica are available [27, 28]. The fungal gene integration system uses a pyrG split-marker approach in combination with a transient Cas9 expression to enable selection on the integration event. For this approach, two plasmids are used that can be constructed with the GoldenMOCS pipeline: a Cas9/sgRNA-containing plasmid and a plasmid containing the integration cassette. The plasmids are co-transfomed into A. niger and can be transiently maintained in the fungal host using a size-reduced AMA1 version, which is readily lost after hygromycin selection is stopped. A special feature of the system is that the linear integration cassette can be released from the integration plasmid in vivo by Cas9 thereby the same gRNA/Cas9 complex is used to cut the plasmid and the genomic pyrG locus.

Upon successful homologous recombination of the pyrG split-marker, uridine prototrophy is restored, which is exploited as a selection marker for the integration event. Due to the modular character of the GoldenMOCS system up to eight different expression cassettes can be integrated into the pyrG locus using this strategy. The strains obtained in this way most likely have the cassette correctly integrated into the pyrG locus, with a minimal screening effort [29].

In this study, we evaluate this integration system and its HDR efficiency at the targeted pyrG locus of A. niger and can confirm the previously reported high targeting efficiency of the system. In addition, we observed a novel mixed-type repair mechanism in which the double-strand break mediated by CRISPR/Cas9 was simultaneously repaired by HDR and on the other side of the integration cassette by NHEJ.

Strains

A. niger strains ATCC 1015 [30] and the derivative industrial strain ACIB1 were used as parental strains for genomic integration studies. Parental strains were transformed with pCAS_gpyrG1 according to the protocol of Sarkari et al., 2017 [25] to obtain A. niger strains ATCC 1015 pyrG^m1 and ACIB1 pyrG^m1, respectively.

Plasmid construction and proliferation in E. coli

The Golden Gate cloning system [31] was employed for plasmid construction. Vectors for gene integration at the pyrG locus (Additional File 1: Table S1) were assembled following the protocol outlined by Sarkari et al., 2017 [25] and harbored the integration cassettes with the sequences listed in Additional File 1: Text S1. Plasmid proliferation was performed in E. coli Top10, with transformants cultivated on LB agar supplemented with 50 µg/mL kanamycin, 100 µg/mL ampicillin, or 100 µg/mL hygromycin B.

Transformation in A. niger and PCR verification

Protoplast transformations of A. niger strains was conducted as previously described [32] using 0,4 mg/mL VinoTaste (Novozymes, Bagsværd, Denmark) in SMC as lysing enzymes. Transformants were selected on minimal medium plates containing 200 µg/mL hygromycin B. Purification of transformants involved three rounds of single colony isolation on selection medium: one round with hygromycin B (100 µg/mL) and two rounds on minimal medium alone. To verify the resulting transformants, three PCRs were performed on the genomic DNA using Q5 Polymerase (New England Biolabs, Ipswich, Massachusetts, USA). The Primers used for the verification PCRs are shown in Table 2.

Sequence analysis

PCR products from gDNA were purified from a gel using HiYield^®PCR Clean-up/Gel Extraction Kit following the manufacture’s protocol. Sanger sequencing was performed by Microsynth, Balgach, Switzerland, using primers listed in Table 1. For PCR verification primers of sets A – E were selected depending on the integrated cassette and are assigned in Additional File 2: Table S2. Sequence analysis was performed using QIAGEN CLC Main Workbench 21.

Table 1

Primer sequences for PCR verification of targeted genomic integration
Purpose	Primer name	Sequence (5’-3’)
PCR1 Set A	pyrG_5’ out_fwd	TTTTGGTTAGCACCTACGCTAGTCTATCAG
PCR1 Set A	cexA_rev	GGAAGTCGGGGTGTGATTTCAG
PCR1 Set B	pyrG_5’ out_fwd	TTTTGGTTAGCACCTACGCTAGTCTATCAG
PCR1 Set B	Tet-on_TcrgA_rev	CGCGGCCGCATGATTCATGACGTATAT
PCR1 Set C	pyrG_5’ out_fwd	TTTTGGTTAGCACCTACGCTAGTCTATCAG
PCR1 Set C	phkA_rev	ATACGTCAACCGGTGAATAAGCCAC
PCR1 Set D	pyrG_5’ out_fwd	TTTTGGTTAGCACCTACGCTAGTCTATCAG
PCR1 Set D	phkB_rev	GTCTCGTGAGTAGTGGGGGTAG
PCR1 Set E	pyrG_5’ out_fwd	TTTTGGTTAGCACCTACGCTAGTCTATCAG
PCR1 Set E	Xfspk_rev	GGTGTTTCTGGTGCAAAATGAGATG
PCR2 Set A	cexA_fwd	CTAGGCAATGGCTTTGGATGTATGTC
PCR2 Set A	pyrG_3’ out_rev	CATCGGAAGCACAATGAGGCGAGTTT
PCR2 Set B	tetO7_fwd	AAAAGTGAAAGTCGAGTTTACCACTCCCTATC
PCR2 Set B	pyrG_3’ out_rev	CATCGGAAGCACAATGAGGCGAGTTT
PCR2 Set C	trpC_fwd	CCATGCATGGTTGCCTAGTGAATGC
PCR2 Set C	pyrG_3’ out_rev	CATCGGAAGCACAATGAGGCGAGTTT
PCR3	pyrG_5’ out_fwd	TTTTGGTTAGCACCTACGCTAGTCTATCAG
PCR3	pyrG_3’ out_rev	CATCGGAAGCACAATGAGGCGAGTTT
Sequencing	pyrG_5’_seq_fwd	TCAAGCTCTTATTGTGTCGTTCAAGATTTGTTCGTATG
	pyrG_5’_seq_fwd2	GACTAATTCTCCGGATGTT
	PgpdA_seq_rev	GCTTCACATTCTCCTTCGCTTACTG

To evaluate the genomic integration efficiency of the system introduced by Sarkari et al., 2017 [25], 33 different integration cassettes with sizes from 3556 to 8898 bp were transformed. The cassettes differed in promoter and coding sequences while the terminator sequence, the homologous arms for HDR of the targeted pyrG locus, and the transformation vector remained the same (Additional File 2: Table S2).

In total, the integration profile at the pyrG locus of 140 transformants was analyzed by three PCR reactions: PCR1 amplified the fragment from the pyrG 5’ region to the integration cassette. With PCR2, a fragment ranging from the integration cassette to the pyrG 3’ region was obtained and PCR3 covered the entire pyrG locus. Table 2 provides a classification of the integration events based on the PCR results. In summary, in 128 of 140 tested transformants the genomic integration of the cassette was confirmed. Twelve potential transformants were excluded from the analysis as five were found to contain a heterokaryon, for three strains it was not possible to obtain all test PCRs and four strains showed the wild-type PCR fragments. Probably due to contamination with uridine prototrophic wild-type strains. Overall, an integration efficiency of 91.4% could be achieved.

Interestingly, transformants with cassette integration could be divided into two groups depending on the PCR result: In 102 transformants, the fragment length after PCRs of the integration site was as expected, indicating targeted HDR on both sites of the cassette. However, in 26 cases (20.3%) PCR1 and PCR3 showed fragments longer than expected. While PCR2 showed the expected amplicon length in all 26 cases, indicating correct HDR on the 5’ end of the double-strand break.

Table 2

Genomic integration efficiency of *A. niger* strains
PCR verification result	Number of transformants	%
Transformants screened	140	100
Cassette integration at pyrG locus	128	91.4
Heterokaryotic	5	3.6
Non-conclusive PCR result	3	2.1
No cassette integration	4	2.9

To explain the unexpected mutation outcome, the DNA profile at the 3’ end of the CRISPR/Cas9 mediated double-strand break was analyzed by Sanger sequencing.

Simultaneous repair of a double-strand break by both, non-homologous end joining and homologous recombination

Analysis of the genome integration site revealed two distinct integration events of the cassettes during repair of the double-strand break, as shown in Fig. 1. Initially, the Cas9-sgRNA complex facilitated a cut at the pyrG gene upstream from the nonsense mutation (Fig. 1A). The co-transformed donor DNA was flanked with homologous arms on both sites of the integration cassette (Fig. 1B). In one class of analyzed transformants, the homologous arms flanking the DNA fragment facilitated the expected HDR of the lesion by a double cross-over event. In the second class representing 20.3% of the transformants, the DNA fragment was inserted by a distinct repair mechanism at each site of the double-strand break: At the 5' end, the DNA fragment was introduced as expected by homologous recombination, thus the INDEL mutation was repaired resulting in uridine prototrophy. However, the 5’-flanking sequence of the DNA fragment was inserted by NHEJ (Fig. 1C). Because of the simultaneous occurrence of both repair mechanisms, NHEJ and HDR, we refer to a mixed-type repair (MTR) mechanism in the following.

A detailed description of mixed-type repair (MTR) is provided for the integration of an inducible expression cassette at the pyrG locus of A. niger ATCC 1015. The core of the integration construct consists of a tet-on promoter [33] and the heterologous coding sequence of Xfspk, a phosphoketolase from Bifidobacterium longum [34], that is followed by the trpC terminator. Upstream, the cassette is flanked with the homologous sequence of the pyrG promoter region (ASPNIDRAFT2_1163268) and 119 bp and 73 bp of its 5’ and 3’ region, respectively. Downstream of the cassette, the sequence is a truncated version of the pyrG gene (pyrG^m2,trunc, 679 bp) under the control of the coxA promoter. PyrG^m2,trunc is homologous to the genomic sequence after where the Cas9 has facilitated the double-strand break [16]. The integration system is designed to facilitate a double-strand break after the seventh base pair of the startcodon ATG of the pyrG gene. Notably, the 3’ end of the genomic dsDNA ends with the nucleotides 5’-TCCTCCA (Fig. 2A).

Three individual clones transformed with the expression cassette tet-on:xfspk:trpC were analyzed: In the first case, the integration cassette recombined with the genomic DNA by the expected double cross-over event, thus restoring the uridine prototrophy. The successful integration was verified by three PCRs. PCR1-1 amplified 3793 bp upstream of the homologous region to the terminator crgA of the tet-on transactivator rtTA2S-M2. PCR2 covered 6841 bp from the tetO7 promoter to the region downstream of PyrG^m2,trunc. PCR3-1 covered the entire integration cassette, including the respective up- and downstream regions (Fig. 2B), which are 10692 bp.

In the second case the expression cassette was integrated by MTR with two observed variations (Fig. 2C). Both showed insertion of the cassette by homologous recombination of pyrG^m2,trunc at the 5’ end of the double-strand break. The 3’ end, however, was repaired by end joining mechanisms:

In clone 1, ending nucleotides of the additionally integrated 5’ homologous arm were 5’-TGGAGGA. This forms a palindromic sequence with 5’-TCCTCCA that are ending nucleotides at the double-strand break mediated by Cas9. Sequences are joined, and the amplicon of PCR1 is 1292 bp longer compared to the region after repair by homologous recombination.

In clone 2, the 5’ end of the flanking arm of the donor DNA was shortened by 111 bp, and the ending nucleotides were 5’-ATACCGCCTAGTCAT. The double-strand break in the genome at the 3’ end was then repaired by NHEJ of the donor sequence. PCR1 thus amplified a fragment that is 1181 bp longer compared to the locus after HDR.

Next, the hypothesis that occurrence of the mixed-type repair mechanism is dependent on the size of the construct was tested. All integration cassettes used for the transformation of A. niger strains were created with identical homologous flanking regions but inserts ranged from 3592 to 8898 bp. Therefore, a weighted linear regression analysis was performed (Additional File 3: Figure S1). Varying numbers of transformants were PCR analyzed for the respective construct sizes. Notably, 37 transformants with a 3592 bp cassette were investigated and 18.9% showed MTR. On the other hand, two transformants with integration of the longest construct of 8898 bp were tested and both showed MTR (100%). The weighted analysis shows a positive correlation between cassette length and the occurrence of MTR, however, this is not significant.

In the filamentous fungus A. niger NHEJ and HDR are two major mechanisms for rejoining double-strand breaks. HDR leads to accurate repair of DNA damages by end resection to generate single-stranded DNA overhangs for the recombination event. The NHEJ pathway, however, suppresses end resection and promotes ligation of DNA strands. It is often accompanied by insertions or deletions (INDEL) at the repair site and it is the predominant fungal DNA damage response pathway [35, 36]. In genetic engineering, HDR enables the introduction of precise genetic changes by the insertion of desired DNA sequences. NHEJ, on the other hand, allows efficient gene deactivations by the introduction of random mutations. So far, it is known that either NHEJ or HDR facilitates the repair of a DNA double-strand break in the genome. However, there is evidence that both pathways are activated concomitantly to provide genome integrity [37].

Over time, various genome-editing methods have been described and the advancement of CRISPR/Cas based systems has profoundly influenced modern genome engineering. The technology has been constantly developed and provides a tool base for enabling precise changes of DNA at a specific locus. On the other hand, the availability of various DNA repair mechanisms to the organisms and unknown molecular interaction has triggered unintended DNA modifications [38]. In filamentous fungi, these unexpected outcomes were reported as large deletions of off-target genes [39] or the action of multiple DNA repair pathways on the targeted locus [40].

Here, we report the discovery of a DNA repair mechanism initiated by a CRISPR/Cas9 integration tool that is linked to a selection system. The concept requires targeted repair of one end of the double-strand break but eventually allows other repair pathways on the second end of the DNA lesion. We observe a novel mixed-type repair (MTR) mechanism and describe the simultaneous DNA damage response of NHEJ and HDR, each acting on one particular end of a double-strand break. The 5’ end was always repaird by HDR which is enforced by the selection system for uridine prototrophy. In contrast, the 3’ end in 20.3% of observed integration events was repaired by NHEJ. We further demonstrate that DNA strands were either directly joined together or that the respective integration cassette was shortened prior to integration.

Generally, Cas9 generates blunt ends at the cutting site [16, 41, 42] that is not only on the specific locus in the genome but also on the integrating plasmid. This facilitates the release of the integration cassette as a linearized DNA fragment after transformation. Because Cas9 cuts 3 nucleotides upstream of the PAM site 5’-AGG, these six nucleotides form the 3’ end of the double-strand break in the genome. In fact, the same nucleotides in an inverted manner remain also at the 5’ end of the homologous arm of the cassette released from the integrating plasmid. Consequently, a palindrome, where the sequence on the one strand is the reverse complement of the sequence on the other strand, is formed after the respective strands are joined (Fig. 3A). Presumably, the end joining was mediated by the palindrome sequence itself. The double-strands of each DNA end separate and respective inverted repeats bind and convert to a four-way branch structure as shown in Fig. 3B.

In A. fumigatus it is reported that microhomology-mediated end joining (MMEJ), that employs microhomologous ends flanking the integration cassette, is a highly efficient repair mechanism of CRISPR/Cas9 mediated mutagenesis [43]. Our findings suggest that the utilization of flanks forming a palindrome to the ends of a double-strand break could therefore also enhance DNA integration. A similar mechanism proposed as an intermolecular model of palindrome formation was demonstrated in S. cerevisiae. Evidence was reported that an in vivo expressed endonuclease releases linear DNA fragments from two transformed plasmids harboring identical short inverted repeats of 42 bp near the cutting site. The findings suggest a 5′ to 3′ resection of DNA ends resulting in 3’ single overhangs that include the respective short inverted repeats. A homologous recombination event then mediates the ligation of the DNA strands [44]. In contrast, our system already generates DNA strands with the inverted repeats at the blunt ends that are joined without previous end resection and therefore suggests NHEJ as the acting mechanism, possibly mediated by the present palidrome. Our second analyzed case supports this outcome where the 5’ homologous arm of the integration cassette was shortened as a result of the NHEJ pathway and subsequently integrated into the genome.

Overall, it still needs to be elucidated why NHEJ was favored over a HDR at this site. One possible explanation is the simultaneous activation of the HDR and NHEJ pathway and the design of the pyrG repair fragment. The crossing-over event with the truncated version of the pyrG (pyrG^m2,trunc) simultaneously integrates the pcoxA promoter and ensures growth without uridine after this DNA damage response. The precise DNA repair on the 3’ end of the double-strand-break, which is the promoter region of pyrG, is however, not essential for growth. Therefore, NHEJ, the predominant form of double-strand break repair, can compete with HDR on this side of the DNA lesion.

In conclusion, the evaluation of the transformation system by Sarkari et al., 2017 confirmed that this integration pipeline enables efficient and flexible introduction of different expression cassettes at the pyrG locus of A. niger strains. It was also observed that the CRISPR/Cas9-mediated double-strand break can be repaired with a template DNA simultaneously by NHEJ and HDR pathways which is referred to as mixed-type repair (MTR). The MTR mechanism allows for an additional damage response through NHEJ, ensuring the stabilization of the double-strand break, while HDR, operating in parallel, provides the accuracy to repair the mutated pyrG gene. The results emphasize the need to further understand factors influencing the mixed-type DNA repair, especially the impact of the palindrome on the genome repair mechanism.

Availability of data and materials

All data generated or analysed during this study are included in this published article and its supplementary information files. The industrial strain ACIB1 is not publicly available.

Ethics declarations

Competing interests

The authors declare that they have no competing interests.

Funding

The COMET center: acib: Next Generation Bioproduction is funded by BMK, BMDW, SFG,

Standortagentur Tirol, Government of Lower Austria und Vienna Business Agency in the framework of COMET - Competence Centers for Excellent Technologies. The COMET Funding Program is managed by the Austrian Research Promotion Agency FFG.

Authors' contributions

MGS initiated this study which was jointly designed with SF. SF and FF performed cloning, transformation and PCR experiments with support from AR. Analysis of PCRs and sequences was done by SF with support from FF. Discussion of results was done by MFS, SF and AR. SF wrote the manuscript and prepared the figures with support of AR. MGS provided guidance and input throughout the preparation of the manuscript. All authors read, edited, and approved the manuscript before submission.

Acknowledgements

The authors want to thank Henrich Novotný and Nina Filmonova for their support in the lab. We also acknowledge Andreas Holzer for providing PCR data of transformants. Figures were created with BioRender.com. Figure 1 was adapted from “CRISPR/Cas9 Gene Editing”, by BioRender.com (2024). Retrieved from https://app.biorender.com/biorender-templates.

Cairns TC, Barthel L, Meyer V. Something old, something new: Challenges and developments in Aspergillus niger biotechnology. Essays Biochem. 2021;65:213–24.
Karaffa L, Kubicek CP. Aspergillus niger citric acid accumulation: Do we understand this well working black box? Appl Microbiol Biotechnol. 2003;61:189–96.
Punt PJ, Oliver RP, Dingemanse MA, Pouwels PH, van den Hondel CAMJJ. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene. 1987;56:117–24.
Krappmann S. Gene targeting in filamentous fungi: the benefits of impaired repair. Fungal Biol Rev. 2007;21:25–9.
Yelton MM, Timberlake WE, Van den Hondel CAMJJ. A cosmid for selecting genes by complementation in Aspergillus nidulans: Selection of the developmentally regulated yA locus. Proc Natl Acad Sci U S A. 1985;82:834–8.
Timberlake WE. Molecular genetics of Aspergillus developement. Annu Rev Genet. 1990;24:5–36.
Boiteux S, Jinks-Robertson S. DNA repair mechanisms and the bypass of DNA damage in Saccharomyces cerevisiae. Genetics. 2013;193:1025–64.
Symington LS. Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair . Microbiol Mol Biol Rev. 2002;66:630–70.
Meyer V, Arentshorst M, El-Ghezal A, Drews AC, Kooistra R, van den Hondel CAMJJ, et al. Highly efficient gene targeting in the Aspergillus niger kusA mutant. J Biotechnol. 2007;128:770–5.
Zhang J, Mao Z, Xue W, Li Y, Tang G, Wang A, et al. Ku80 gene is related to non-homologous end-joining and genome stability in Aspergillus niger. Curr Microbiol. 2011;62:1342–6.
Álvarez-Escribano I, Sasse C, Bok JW, Na H, Amirebrahimi M, Lipzen A, et al. Genome sequencing of evolved aspergilli populations reveals robust genomes, transversions in A. flavus, and sexual aberrancy in non-homologous end-joining mutants. BMC Biol. 2019;17:1–17.
van Hartingsveldt W, Mattern IE, van Zeijl CMJ, Pouwels PH, van den Hondel CAMJJ. Development of a homologous transformation system for Aspergillus niger based on the pyrG gene. MGG Mol Gen Genet. 1987;206:71–5.
Kelly JM, Hynes MJ. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. EMBO J. 1985;4:475–9.
Buxton FP, Gwynne DI, Davies RW. Transformation of Aspergillus niger using the argB gene of Aspergillus nidulans. Gene. 1985;37:207–14.
Nødvig CS, Nielsen JB, Kogle ME, Mortensen UH. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS One. 2015;10:1–18.
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A Programmable Dual-RNA-guided DNA Endonuclease in Adaptive Bacterial Immunity. Science. 2012;337:816–22.
Zheng X, Zheng P, Zhang K, Cairns TC, Meyer V, Sun J, et al. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger. ACS Synth Biol. 2018;8:1568–74.
Song L, Ouedraogo J, Kolbusz M, Truc T, Nguyen M, Tsang A. Efficient genome editing using tRNA promoter-driven CRISP /Cas9 gRNA in Aspergillus niger. 2018;1–17.
Schuster M, Kahmann R. CRISPR-Cas9 genome editing approaches in filamentous fungi and oomycetes. Fungal Genet Biol. 2019;130:43–53. https://doi.org/10.1016/j.fgb.2019.04.016
Shen J-Y, Zhao Q, He Q-L. Application of CRISPR in Filamentous Fungi and Macrofungi: from Component Function to Development Potentiality. Acs Synth Biol. 2023;12:1908–23.
Xu Y, Shan L, Zhou Y, Xie Z, Ball AS, Cao W, et al. Development of a Cre-loxP-based genetic system in Aspergillus niger ATCC1015 and its application to construction of efficient organic acid-producing cell factories. Appl Microbiol Biotechnol. 2019;103:8105–14.
Mizutani O, Masaki K, Gomi K, Iefuji H. Modified cre-loxp recombination in Aspergillus oryzae by direct introduction of Cre recombinase for marker gene rescue. Appl Environ Microbiol. 2012;78:4126–33.
Zhang S, Ban A, Ebara N, Mizutani O, Tanaka M, Shintani T, et al. Self-excising Cre/mutant lox marker recycling system for multiple gene integrations and consecutive gene deletions in Aspergillus oryzae. J Biosci Bioeng. 2017;123:403–11.
Kopke K, Hoff B, Kuck U. Application of the saccharomyces cerevisiae FLP/FRT recombination system in filamentous fungi for marker recycling and construction of knockout strains devoid of heterologous genes. Appl Environ Microbiol. 2010;76:4664–74.
Sarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Bioresour Technol. 2017;245:1327–33. https://doi.org/10.1016/j.biortech.2017.05.004
Engler C, Kandzia R, Marillonnet S. A one pot, one step, precision cloning method with high throughput capability. PLoS One. 2008;3:e3647.
Prielhofer R, Barrero JJ, Steuer S, Gassler T, Zahrl R, Baumann K, et al. GoldenPiCS: A Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris. BMC Syst Biol. 2017;11:1–14.
Egermeier M, Sauer M, Marx H. Golden Gate-based metabolic engineering strategy for wild-type strains of Yarrowia lipolytica. FEMS Microbiol Lett. 2019;366:1–9.
Steiger MG, Rassinger A, Mattanovich D, Sauer M. Engineering of the citrate exporter protein enables high citric acid production in Aspergillus niger. Metab Eng. 2019;52:224–31. https://doi.org/10.1016/j.ymben.2018.12.004
Andersen MR, Salazar MP, Schaap PJ, van de Vondervoort PJI, Culley D, Thykaer J, et al. Comparative genomics of citric-acid-producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88. Genome Res. 2011;21:885–97.
Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS One. 2009;4:e5553. https://doi.org/10.1371/journal.pone.0005553
Arentshorst M, Lagendijk EL, Ram AF. A new vector for efficient gene targeting to the pyrG locus in Aspergillus niger. Fungal Biol Biotechnol. 2015;2:2–6.
Meyer V, Wanka F, van Gent J, Arentshorst M, van den Hondel CAMJJ, Ram AFJ. Fungal gene expression on demand: An inducible, tunable, and metabolism-independent expression system for Aspergillus niger. Appl Environ Microbiol. 2011;77:2975–83.
Hellgren J, Godina A, Nielsen J, Siewers V. Promiscuous phosphoketolase and metabolic rewiring enables novel non-oxidative glycolysis in yeast for high-yield production of acetyl-CoA derived products. Metab Eng. 2020;62:150–60. https://doi.org/10.1016/j.ymben.2020.09.003
Villalba F, Collemare J, Landraud P, Lambou K, Brozek V, Cirer B, et al. Improved gene targeting in Magnaporthe grisea by inactivation of MgKU80 required for non-homologous end joining. Fungal Genet Biol. 2008;45:68–75.
Ninomiya Y, Suzuki K, Ishii C, Inoue H. Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining. Proc Natl Acad Sci U S A. 2004;101:12248–53.
Kass EM, Jasin M. Collaboration and competition between DNA double-strand break repair pathways. FEBS Lett. 2010;584:3703–8. http://dx.doi.org/10.1016/j.febslet.2010.07.057
Huang J, Cook DE. The contribution of DNA repair pathways to genome editing and evolution in filamentous pathogens. FEMS Microbiol Rev. 2022;46:1–21.
Foster AJ, Johnstone E, Saunders A, Colic E, Lassel N, Holmes J. Unanticipated Large-Scale Deletion in Fusarium graminearum Genome Using CRISPR/Cas9 and Its Impact on Growth and Virulence. J Fungi. 2023;9.
Huang J, Rowe D, Subedi P, Zhang W, Suelter T, Valent B, et al. CRISPR-Cas12a induced DNA double-strand breaks are repaired by multiple pathways with different mutation profiles in Magnaporthe oryzae. Nat Commun. 2022;13:19–21.
Sansbury BM, Hewes AM, Kmiec EB. Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair. Commun Biol. 2019;2:1–10.
Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, et al. Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell. 2015;163:759–71.
Zhang C, Meng X, Wei X, Lu L. Highly efficient CRISPR mutagenesis by microhomology-mediated end joining in Aspergillus fumigatus. Fungal Genet Biol. ;86:47–57. http://dx.doi.org/10.1016/j.fgb.2015.12.007
Butler DK, Gillespie D, Steele B. Formation of large palindromic DNA by homologous recombination of short inverted repeat sequences in Saccharomyces cerevisiae. Genetics. 2002;161:1065–75.

No competing interests reported.

Download PDF

Journal Publication

published 05 Aug, 2024

Read the published version in Fungal Biology and Biotechnology →

Editorial decision: Revision requested
14 Jun, 2024
Reviews received at journal
08 Jun, 2024
Reviews received at journal
27 May, 2024
Reviews received at journal
23 May, 2024
Reviewers agreed at journal
07 May, 2024
Reviewers agreed at journal
06 May, 2024
Reviewers agreed at journal
03 May, 2024
Reviewers invited by journal
03 May, 2024
Submission checks completed at journal
02 May, 2024
Editor assigned by journal
02 May, 2024
First submitted to journal
23 Apr, 2024

You are reading this latest preprint version

NHEJ and HDR occurring simultaneously during gene integration into the genome of Aspergillus niger

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and Methods

Sequence analysis

Results

Simultaneous repair of a double-strand break by both, non-homologous end joining and homologous recombination

Discussion

Conclusion and outlook

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1