1. Patients with MF-related anemia have higher expression of PDE6G in bone marrow cells compared to patients with Philadelphia chromosome-negative MPN without anemia
To explore the role of PDE6G in MF-related anemia, we detected the PDE6G expression levels in nucleated cells from 10 Philadelphia chromosome-negative MPN bone marrow samples without anemia and 10 MF anemia bone marrow samples. Using RT-qPCR, we found that the PDE6G expression level was significantly higher in anemia samples than in non-anemia samples (Figure 1-A). Furthermore, Western blot (WB) analysis also showed that the PDE6G expression level was significantly higher in anemia samples than in non-anemia samples (Figure 1-B). Our data suggest that overexpression of PDE6G has an important impact on MF-related anemia.
2. In HEL cells,knockout of PDE6G promotes CD71 expression
We constructed a cell model with PDE6G gene deletion in HEL cells harboring the JAK2V617F homozygous mutation (Figure 1-A), and then used flow cytometry to detect erythroid differentiation markers (CD71 and CD235a). To determine whether the effect of PDE6G knockout on CD71 and CD235a promoted differentiation, 40 μmol/L of chlorinated hyperheme (Hemin) was added to the cells for 3 days to accelerate differentiation.Results showed that compared with control cells, PDE6G gene deleted cells had significantly increased cell surface marker CD71 (Figure 1-C), and slightly increased CD235a (Figure 1-D). After adding hemin to accelerate differentiation, it was found that compared with control cells, PDE6G gene deleted cells had significantly decreased CD71 and increased CD235a. CD71 and CD235a are usually used as markers of erythroid differentiation, and their expression changes can reflect different stages of erythroid differentiation. CD71 begins to be expressed in BFU-E, reaches its highest level in primitive red blood cells, then gradually decreases, and disappears in mature red blood cells. CD235a starts to be expressed in CFU-E and then gradually increases to reach its highest level in mature red blood cells (Figure 1-B). This suggests that after PDE6G gene deletion, erythroid progenitor cell maturation is promoted, which proves that PDE6G has a role in inhibiting erythroid progenitor cell differentiation and maturity. After PDE6G deletion, the surface CD71 of erythroid progenitor cells was significantly increased while CD235a was slightly increased, indicating that PDE6G may inhibit erythroid progenitor cell differentiation by inhibiting CD71 expression.
3. In HEL cells, miR-144-3p Inhibits CD71 expression
In order to investigate how PDE6G inhibits CD71 expression, whole transcriptome sequencing was performed on control and knock-out groups of HEL cells, showing no significant difference in CD71 mRNA levels between the two groups (Figure 3-A). Considered the possibility of posttranscriptional modification of CD71 mRNA. In the transcriptome sequencing results, the expression level of miR-144-3p in the knockdown group of PDE6G was significantly lower than the control group (Figure 3-B). Further, HEL cell lines were constructed for miR-144-3p knockdown (Figure 3-C) and overexpression (Figure 3-D) models. Subsequently, WB assays were used to detect the effect of miR-144-3p knockdown and overexpression on CD71 expression in HEL cell lines (Figure 3-E-G). The results showed that knockdown of miR-144-3p in HEL cells upregulated CD71 expression, whereas overexpression of miR-144-3p downregulated CD71 expression.
4. BHLHE40 Inpresses the transcription function of the promoter of miR-144-3p
The BHLHE40 overexpressed 293T cell model was constructed (Figure 4-A), followed by obtaining the DNA segment from the TransmiR database (5’-GGCCTCTGGCCAGGGGTGGGGATTGCTGTGAGTAGGGTGTGGGTTGGAGGAGAGTCTGGGCCTGGGAGGGATAGTCAGGGGGCCCTGATAAGCAGACATTGGGCTATCAGGGTGGGGGCCCAGCAGCCTTCTGTTTATCAGGAGCCAACACGGGCCAAAGCAGGGCTGAGGCGCTTCCCGCCCAGGGCTGTTTTCCTGGATATTTGTTCTTCCATTCCTCTGCC-3’), which could bind to BHLHE40 protein and be located in the promoter region of miR-144-3p, Inserting this fragment into the fluorescence reporter gene fragment before PGL4.10 plasmid to construct the target plasmid, then transfecting the PGL4.10 empty vector and target plasmid separately into BHLHE40 overexpressed 293T cells and control 293T cells, setting up four cell groups, and then detecting fluorescence reporter activity. The results showed that the fluorescence reporter enzyme activity of the transfected target plasmid group was significantly higher than that of the transfected empty plasmid group in both BHLHE40 overexpression and control groups (Figure 4-B), indicating that this DNA segment is the promoter, and BHLHE40 is the transcriptional factor of miR-144-3p. In the transfected target plasmid group, the fluorescence reporter enzyme activity of the BHLHE40 overexpression group was significantly weaker than that of the control group (Figure 4-B), indicating that BHLHE40 is a negative regulatory transcriptional factor for miR-144-3p.
5. In HEL cells, BHLHE40 downregulated the expression of miR-144-3p and upregulated the expression of CD71, PDE6G upregulated the expression of miR-144-3p and downregulated the expression of CD71
Four cell models including NC group, PDE6G overexpression group, BHLHE40 overexpression group, and BHLHE40+PDE6G overexpression group were constructed using HEL cell lines, and the CD71 expression levels of these four groups were detected by WB (Figure 5-A). The results showed that the expression level of CD71 decreased in the PDE6G overexpression group, increased in the BHLHE40 overexpression group, and had no significant change but was slightly lower than the BHLHE40 overexpression group in the BHLHE4+PDE6G overexpression group. This indicates that PDE6G can inhibit CD71 expression, while BHLHE40 can promote CD71 expression. qPCR was used to determine the expression level of miR-144-3p in the NC group,the PDE6G overexpression group, the BHLHE0 overexpression group, and the BHLHE40+PDE6G overexpression group (Figure 5-B). results showed that the expression level of miR-14-3p increased in the PDE6G overexpression group, decreased the BHLHE40 overexpression group, and had no change in the BHLHE40+PDE6G overexpression group. It indicates that BHLHE40 a negative regulatory transcriptional factor for miR-144-and that BHLHE40 downregulates the expression miR-144-3p to upregulate CD71 expression,while PDE6G upregulates the expression miR-144-3p to downregulate CD71 expression.
6. In HEL cells, PDE6G is directly bound to the BHLHE40 within the nucleus
After using BHLHE40 antibody for co-immunoprecipitation in HEL cells, the presence of PDE6G protein was detected in the protein sample, while no PDE6G protein was detected in the protein sample after using IgG antibody as a negative control (Figure 6-A), indicating that there is a mutual interaction between BHLHE40 and PDE6G. Purified PDE6G, GST, and GST-BHLHE40 proteins from Escherichia coli were used for a GST pull-down experiment to detect whether the interaction between PDE6G and BHLHE40 is direct (Figure 6-B). The results showed that there is no direct interaction between PDE6G and GST, but an interaction between PDE6G and GST-BHLHE40 fusion protein, indicating that there is a direct interaction between PDE6G and BHLHE40. Immunofluorescence experiments in HEL cells were used to detect the location of the interaction between PDE6G and BHLHE40 (Figure 6-C). The results showed that the interaction between PDE6G and BHLHE40 occurs in the nucleus. Overall, we believe that PDE6G directly binds to transcription factor BHLHE40 in the nucleus and inhibits its negative regulation of miR-144 expression, resulting in upregulation of miR-144 expression. MiR-144 targets the mRNA of CD71 and inhibits its translation, ultimately leading to a decrease in CD71 expression.
7. Patients with MF-related anemia have higher expression of miR-144-3p and lower expression of CD71 in bone marrow cells compared to patients with Philadelphia chromosome-negative MPN without anemia
RT-qPCR assays were used to detect the expression levels of miR-144-3p in bone marrow specimens from 10 MF anemia patients and 10 Philadelphia chromosome-negative MPN patients without anemia (Figure 7-A). The results showed that the expression level of miR-144-3p was significantly higher in MF-related anemia patients than in Philadelphia chromosome-negative MPN patients without anemia. Flow cytometry assays were used to detect the percentage of CD71 positive cells in bone marrow specimens from 10 MF anemia patients and 10 Philadelphia chromosome-negative MPN patients without anemia (Figure 7-B). The results showed that the percentage of CD71 positive cells was significantly lower in MF-related anemia patients than in Philadelphia chromosome-negative MPN patients without anemia.