The Possible Involvement of KATP Channels in Cholestatic Pruritus in Mice

doi:10.21203/rs.3.rs-4321566/v1

Download PDF

Research Article

The Possible Involvement of KATP Channels in Cholestatic Pruritus in Mice

https://doi.org/10.21203/rs.3.rs-4321566/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Cholestatic itch dramatically impairs the quality of life of affected patients; however, the therapeutic choices are limited and far from sufficient. ATP-sensitive potassium channels (K_ATP channels) contribute to transmitting signals, including itch. Taking together the modulatory effects of K_ATP channels on neural excitation and the neurogenic origin of cholestatic itch, we investigated the role of these channels in cholestatic pruritus in mice induced by bile duct ligation.

Results

We detected increased scratching responses in cholestatic mice regarding intradermal vehicle injection, representing cholestatic pruritus. K_ATP channel openers, diazoxide (10 mg/kg, intraperitoneal), and minoxidil (10 mg/kg, intraperitoneal) attenuated scratching responses in the bile duct ligated mice. On the other hand, K_ATP channel blocker glibenclamide (3 mg/kg intraperitoneal) intensified the scratching behavior. Moreover, pre-treatment with the sub-effective dose of glibenclamide (1 mg/kg, intraperitoneal) reversed the anti-pruritic effects of diazoxide (10 mg/kg, intraperitoneal) and minoxidil (10 mg/kg intraperitoneal). The open-field test revealed that the scratching behavior was not affected by locomotor activity. Our finding of Quantitative reverse transcription-polymerase chain reaction analysis also showed an increase in the expression of Kcnj11 in bile-duct ligated mice.

Conclusions

We conclude that ATP-sensitive potassium channels are possibly involved in cholestatic itch. Further studies are needed to elucidate the other associations between cholestasis and itch.

Cholestasis

Itch

KATP channels

Mice

Medical literature defines itch as a deliberating somatic sensation arising from a desire to scratch [1]. Chronic itch reduces the patient’s life quality. Several dermatologic diseases and systemic disorders, including chronic kidney failure, infections, and hematologic and chronic liver diseases, such as cholestasis, are associated with chronic pruritus [2, 3].

Cholestasis indicates impaired delivery of bile into the intestine resulting from a functional defect of hepatocytes or an obstruction in the bile duct. Various causes occasion cholestasis, including intrahepatic cholestasis of pregnancy (ICP), primary biliary cirrhosis (PBC), primary sclerosing cholangitis, infections, drugs, and autoimmune and metabolic diseases [4, 5]. The prevalence of chronic itch in hepatic diseases ranges from 15–100%, while 80–100% of cholestatic patients experience itching. In these cases, scratching has limited effects while it evokes an itch-scratch defective cycle. Likewise, treatments such as antihistamines often fail to relieve pruritus due to limited data in this regard. Cholestatic itch is a neurogenic type of itch, and the pathologic stimulation of the nervous system is a crucial element in its development [6]. Several itch mediators directly activate neurons, for instance, bile acids, bilirubin, serotonin, histamine, endogenous opioids, lysophosphatidic acid (LPA) [7], and bovine adrenal medulla (BAM) 8–22 [8] accumulate in the serum and skin in the cholestatic state, and they seem to associate with itch directly or indirectly. The imbalance of the endogenous opioid system characterized by enhanced activation of mu-opioid receptors and deactivation of kappa-opioid receptors implies potentiated itch sensation. Additionally, several novel receptors are expressed in the neural system, including TGR5, a G protein-coupled receptor to which bile acids and neurosteroids bind in the peripheral and central nervous system. Transient receptor potential vanilloid (TRPV) 1, TRP ankyrin 1, and gastrin-releasing peptide are itch mediators in TRG5⁺ neurons. Recently, bile acids have been found to activate human MRGPRX4 and the homologous mouse receptor, Mrgpra1, on the small-diameter sensory neurons to induce cholestatic itch [9–11]. LPA receptor type 5, transient receptor potential cation channel, subfamily A (TRPA) 1 [12], the mas-related family of G protein-coupled receptor X1 (MRGPRX1, the receptor for BAM8-22) [8], and protease-activated receptor (PAR) 2 [13] are other mediators and receptors involved in cholestatic pruritus.

The ion channels on neurons are also capable of modulating neural excitability. The ATP-sensitive K+ (KATP) channels are expressed in the central and peripheral nervous systems [14]. However, their involvement in itch needs to be better understood. The functional channel consists of a Kir6 channel and a SUR (Sulfonylurea Receptor) subunit. K_ATP channel opening leads to K + efflux, consequent neural hyperpolarization, and itch suppression [15, 16]. K_ATP channel openers, minoxidil, and diazoxide have anti-pruritic effects on chloroquine (CQ)-induced itch in mice, which is reversed by pre-treatment with a K_ATP channel blocker, glibenclamide [17].

The systemic administration of the K_ATP channel openers also inhibits compound 48/80-induced scratching behavior in mice by affecting the K_ATP channels [16]. Interestingly, sodium hydrosulfide (NaHS) exerts its anti-pruritic properties by hyperpolarizing the neurons following the K_ATP channels opening [18].

Considering the modulatory effects of K_ATP channels on neural excitability and the neurogenic nature of cholestatic itch, we investigated whether K_ATP channel openers or blockers affect the scratching behavior in the bile duct ligation (BDL)-induced cholestasis in mice.

2.1. Animals and housing

We purchased male NMRI mice (25–30 gr, 5–6 weeks old) from Pasteur Institute, Tehran, Iran, and housed them in a controlled temperature (23–25°C), lighting (12 h light/dark cycle), and humidity (60%) conditions with free access to food and water [19]. We divided the mice randomly into groups of 8 into two main groups: (1) sham-operated controls (Sham); and (2) bile duct ligated (BDL). Our BDL group consisted of three subgroups according to the employment of K_ATP channel openers (diazoxide and minoxidil) and blockers (glibenclamide). We used each animal once and sacrificed them under general anesthesia. Rostral skin samples were isolated and quickly dipped in liquid nitrogen for further RT-qPCR assessment.

2.2. Chemicals

Diazoxide (PubChem CID 3019), minoxidil (PubChem CID 4201), and glibenclamide (PubChem CID 3488) were purchased from Sigma chemicals St. Louis, MO, USA. All drugs were prepared freshly for injection by dissolving in normal saline with 10% Tween 80. The route of administration was intradermal (i.d.) for vehicle and intraperitoneal (i.p.) for diazoxide, minoxidil, and glibenclamide.

2.3. Induction of cholestasis

Bile duct ligation (BDL) was established under general anesthesia via ketamine (50 mg/kg, i.p.) and xylazine (10 mg/kg, i.p.). A midsection laparotomy was performed, and the bile duct was exposed and double-ligated in the BDL group. The bile duct was left in place in the Sham group after handling with forceps [20]. The values of alanine aminotransferase (ALT) and aspartate transaminase (AST) were checked a week after surgery to confirm the hepatic injury.

2.4. Open-field locomotor activity

The open-field test was performed to rule out the probable ambulatory behavior following treatments with diazoxide (10 mg/kg, i.p.), minoxidil (10 mg/kg, i.p.), and glibenclamide (3 mg/kg, i.p.) [21]. The open-field apparatus is a wooden arena with walls to inhibit escape (40× 60 × 50 cm). The bottom floor of the arena is divided into 12 equal squares. The animals were gently positioned in the center of the arena, and the number of squares crossed with all paws (crossing) was evaluated during a 6-minute session [22].

2.5. Rostral back model of acute itch

After performing the open-field test, the mice’s scratching behavior alteration was assessed on the 7th day following the BDL surgery. A hair removal cream (Veet, Reckitt Benckiser, England) was used to remove the hair of the rostral back two days before the experiments. Mice were examined for any visible dermatological disorder before testing. All animals were accustomed to the room before the experiment in the following manner. They were placed in separate acrylic boxes (10×10×13 cm) with a small amount of bedding at the bottom of each chamber for 60 minutes before conducting the behavioral experiment [23]. On the experiment day, an intradermal injection of the vehicle was administered to the shaved area in a 50 µl/site volume with a 25G insulin syringe. To evaluate the underlying role of K_ATP channels, diazoxide (10 mg/kg, i.p.), minoxidil (10 mg/kg, i.p.), and glibenclamide (3 mg/kg, i.p.) was administered via intraperitoneal route 30 minutes before intradermal injection. Besides, to evaluate whether concurrent treatment of K_ATP channel openers and blockers has any significant impact on the BDL-induced itch, a sub-effective dose of glibenclamide (1 mg/kg, i.p.) was administered with diazoxide (10 mg/kg, i.p.) and minoxidil (10 mg/kg, i.p.). The experiments were recorded for one hour with a digital camera mounted on a camera stand to maximize stabilization and minimize distraction. The recorded films were analyzed, estimating the number of scratching behaviors. A total number of scratching behavior is quantified as lifting the hind paw to scratch the injection site and returning the foot to the ground or the mouth [24].

2.6. Quantitative reverse transcription-polymerase chain reaction (RT-qPCR)

RiboEx Total RNA (Gene All Biotechnology, Seoul, Korea) was utilized to harvest total RNA from the skin samples. The RNA quantification was assessed using Nanodrop ND-1000 (Nanodrop Technologies). Changes in mRNA expression of Kcnj8 and Kcnj11 were determined by quantitative reverse transcription-polymerase chain reaction (RT-qPCR) after reverse transcription of 1 µg of RNA from each sample with Prime Script RT reagent kit (Takara) according to the manufacturer’s description. PCR reactions were executed in a volume of 20 µl containing 1× PCR buffer (TaKaRa), 0.25 mM dNTP, 1 µM of each primer, and 2.5 U of Taq polymerase (TaKaRa) at 94° C for 3 min, 35 cycles at 94° C for 30 s, 60° C for 30 s, and 72° C for 30 s. The primers used are in Table 1. β-actin (encoded by Actb) was used as the loading control [25].

Table 1

Nucleotide sequences of the primers used for RT-qPCR
Gene	Accession	Forward Primer	Reverse Primer	Amplicon
Kcnj8	NM_008428	GTGCACTATGGATCGCACCT	CGTCCTCCTAGAAGACTCGG	175
Kcnj11	NM_010602	GGCCAGGGAAAGGGAGTTAG	CATTGCTTACTGAGCCCCCA	91
Actb	NM_007393	AGATCAAGATCATTGCTCCTCCT	ACGCAGCTCAGTAACAGTCC	174

2.7. Statistical analysis

All values are expressed as mean ± standard deviation (SD). The normal distribution of the data was assessed via the Shapiro-Wilk test. Group differences regarding the number of scratching were analyzed using a one-way analysis of variance (ANOVA) test followed by Tukey’s post hoc test. The mRNA expression level of Kcnj8 and Kcnj11 were processed using an independent t-test. P-value < 0.05 was considered the significance level between experimental groups (n = 8). All statistical analyses were performed using GraphPad Prism version 8.0 software .

3.1. The effect of BDL on the scratching behavior

In the BDL group, the number of scratching behavior following an intradermal vehicle injection on day 7 significantly increased compared to the BDL mice on day 1 (F (3, 28) = 13.84, P < 0.001) (Fig. 1A). However, in the Sham group, the surgery did not significantly impact the scratching behavior (F (3, 28) = 13.84, P > 0.05) (Fig. 1A).

The open-field test revealed no significant difference in scratching behavior between the BDL and sham-operated groups. Therefore, the BDL surgery did not impact locomotor activity (F (3, 28) = 1.918, P > 0.05) (Fig. 1B).

3.2. The effect of the K_ATP channel openers on the scratching behavior

Administration of diazoxide (3 and 10 mg/kg) or minoxidil (3 and 10 mg/kg) in the Sham animals did not alter the scratching responses compared to the vehicle (F (4, 35) = 0.3426, P > 0.05) (Fig. 2A). However, administration of the effective dose of diazoxide (10 mg/kg, i.p.) and minoxidil (10 mg/kg, i.p.) in the BDL mice significantly reduced the scratching behavior compared to the vehicle. (F (4, 35) = 17.90, P < 0.001) (Fig. 2B).

3.3. The effect of the K_ATP channel blocker on the scratching behavior

Intraperitoneal injection of glibenclamide (1 and 3 mg/kg) in the Sham animals did not change the scratching bouts compared to the vehicle (F (3, 28) = 5.749, P > 0.05). At the same time, administering glibenclamide (10 mg/kg) in the Sham animals increased the scratching bouts compared to the vehicle (F (3, 28) = 5.749, P < 0.01) (Fig. 3A). On the other hand, administration of the effective dose of glibenclamide (3 and 10 mg/kg, i.p.) remarkably increased the scratching behavior induced by the BDL surgery compared to the vehicle (F (3, 28) = 6.552, P < 0.05 and P < 0.01 respectively) (Fig. 3B).

3.4. The effect of K_ATP channel openers and blockers on the scratching behavior

In the concurrent administration of K_ATP channel openers and blockers, pre-treatment with the sub-effective dose of glibenclamide (1 mg/kg, i.p.) notably reversed the anti-scratching effect of diazoxide (10 mg/kg, i.p.) and minoxidil (10 mg/kg, i.p.). Animals that received glibenclamide + diazoxide or minoxidil showed an intensification in the scratching behavior compared to the corresponding animals that received diazoxide or minoxidil alone. (F (5, 42) = 30.81, P < 0.001 and P < 0.01 respectively) (Fig. 4).

3.5. The mRNA expression of Kcnj8 and Kcnj11

Biochemical assessment through RT-qPCR uncovered that the mRNA expression of Kcnj11 significantly increased in the BDL mice (t = 4.542, df = 4, P < 0.05) (Fig. 5A). However, the mRNA expression of Kcnj8 did not alter significantly (t = 2.563, df = 4, P > 0.05) (Fig. 5B)

Disorders with cholestatic features accompany intractable pruritus with the pathogenesis of neurogenic dysfunction. K_ATP channels can potentially modulate neuronal excitability, providing essential clues to support the role of K_ATP channel openers in suppressing itch [2, 16]. The present study investigated the effect of K_ATP channel openers and blockers in BDL mice, which is validated as a severe model of obstructive cholestasis. Our results revealed that the scratching behavior to intradermal vehicle injection was potentiated in the bile duct ligated mice on the 7th day after surgery, while the scratching behavior remained unaffected in the Sham animals. This potentiated evoked scratching behavior was significantly suppressed following pre-treatment with intraperitoneal diazoxide and minoxidil, the K_ATP channel openers. In contrast, glibenclamide, a K_ATP channel blocker, significantly increased the scratching behavior. Additionally, the sub-effective dose of glibenclamide reversed the anti-pruritic effects of diazoxide and minoxidil. Thus, these findings suggest the possible role of K_ATP channels in the pathogenesis of cholestatic itch. Our results also showed a significant increase in the expression of dermal Kcnj11 (Kir6.2) in the BDL mice samples. In addition, the locomotor activity in BDL mice did not differ significantly from the Sham mice on the 7th day after surgery, indicating that the motor malfunction did not affect the scratching behavior.

The major neuronal types mediating itch are small-diameter primary sensory neurons (C fibers) with their cell bodies in the DRG or trigeminal ganglia. The itch neurons terminate in the epidermis and form branched-free nerve endings containing numerous receptors for pruritogens. Activation of membrane receptors induces calcium influx via different intracellular signaling pathways that ultimately affect the expression or function of ion channels [26]. These ion channels depolarize the membrane, and action potentials happen when the total depolarization exceeds the threshold of voltage-dependent Na⁺ channels. Consequently, peripheral sensory signals are encoded and transmitted to the central nervous system, resulting in an itching [27]. In cholestasis, the systemic itch mediators (e.g., bile acids, bilirubin, endogenous opioids, histamine, LPA, and its synthetic enzyme autotaxin) arising in the liver and gastrointestinal tract reach the skin by blood circulation and activate the sensory endings of itch neurons [7].

Previous reports revealed the modulatory role of K_ATP channels in the different models of acute itch in animals. K_ATP channel openers attenuate chloroquine- and compound 48/80-induced itch in mice, while K_ATP channel blockers exacerbate the itching behavior [16, 17]. The involvement of K_ATP channels in adjusting the signal transmission, which eventually evokes itch, needs to be addressed.

K_ATP channels compose two distinct protein subunits; an inwardly rectifying potassium channel family (Kir6.1 or Kir6.2) and an ATP-binding regulatory subunit, the SUR (SUR1, SUR2A, SUR2B, or SUR2C). K_ATP channels are found in various regions of the CNS at either supraspinal (e.g., locus coeruleus, hypothalamus, hippocampus, and cortex) or spinal (e.g., dorsal horn) levels. The peripheral nervous system also expresses Kir6.2/SUR1 and Kir6.2/SUR2 K_ATP channelsthat work downstream of the G-protein-coupled receptors [28–30]. In addition, the gene encoding the K_ATP channels is also present in the skin of mouse models of itch [17]. We also found overexpression of the Kcnj11 gene in the skin samples of BDL animals. This gene encodes the Kir6.2 subunit of the K_ATP channels, so an alteration in the K_ATP current may provoke neuronal transmission of itch. Consequently, stimulation of K_ATP channel openers and suppression of K_ATP channel blockers may be therapeutic targets to hinder the itch sensation.

K_ATP channel opening leads to K⁺ efflux and subsequent hyperpolarization, which then affects Ca²⁺ channels and causes Ca²⁺ entry restriction, reducing cellular excitability [16]. In addition, K_ATP channels can exert analgesic and anti-inflammatory effects. Previous evidence reported that peripheral stimulation of K_ATP channels might be the underlying mechanism for analgesia prompted by nitric oxide, cGMP, and opioid signaling [31, 32]. Hence, the possible role of K_ATP channels in itching suppression or aggravation may be modulated via calcium entry or signaling pathways involved in analgesia and inflammation.

To summarize, the establishment of liver injury in mice affects excessive scratching behavior. Treatment with K_ATP channel openers and blockers reduces and intensifies the scratching behavior, respectively. Moreover, pre-treatment with a K_ATP channel blocker reverses the anti-scratching effect of K_ATP channel openers. Our study uncovered the novel regulatory role of K_ATP channels in cholestatic itch.

Limitations and Future Directions

Herein, we studied the possible involvement of K_ATP channels in the BDL-induced itch via pharmacological interventions and behavioral assessments. However, further biochemical measurements are granted to clarify the role of K_ATP channels in cholestatic pruritus.

Future studies to elucidate the transcription level of genes encoding K_ATP channels via immunohistochemistry or western blotting could further confirm the findings of the present study. It is also recommended to evaluate the involvement of K_ATP channels in cholestatic pruritus by utilizing genetically modified animals with overexpression or knockout of the Kcnj11 gene.

Exaggerated scratching behavior in mice may be noted in conjunction with liver damage. We found that treatment with KATP channel openers and blockers diminishes and exacerbates the scratching behavior, respectively. Additionally, pre-treatment with a KATP channel blocker can counteract the anti-scratching effect of KATP channel openers. Our study shed light on the novel modulatory role of KATP channels in cholestatic pruritus.

K_ATP channels

ATP-sensitive potassium channels

BDL

bile duct ligation

ICP

intrahepatic cholestasis of pregnancy

PBC

primary biliary cirrhosis

LPA

lysophosphatidic acid

BAM

bovine adrenal medulla

TRPV

Transient receptor potential vanilloid

TGR5

Takeda G protein-coupled receptor 5

PAR

protease-activated receptor

SUR

Sulfonylurea Receptor

TRPA

transient receptor potential cation channel, subfamily A

chloroquine

i.p.

Intraperitoneal

i.d.

Intradermal

RT-qPCR

Quantitative reverse transcription-polymerase chain reaction

DRG

dorsal root ganglion

Ethics Approval: All the experimental procedures were done based on the ARRIVE guidelines for animal research and approved by the Ethics Committee of Tehran University of Medical Sciences (Ethics code: IR.TUMS.VCR.REC.1395.1693).

Consent to Participate: Not Applicable

Consent for Publication: Not Applicable

Data Availability: All data generated or analyzed during this study are included in this article. Further inquiries can be directed to the corresponding author.

Competing Interests: Arya Afrooghe, Maryam Shayan, Nazgol-Sadat Haddadi, Asma Rashki, Shahabaddin Solaimanian, Maryam Shokrian Zeini, Ahmad-Reza Dehpour declare that they have no relevant financial or non-financial interests to disclose.

Funding: This study is supported by a grant from the Iran National Sciences Foundation (INSF) (Grant No. 96002757).

Author Contributions: ARD conceived and designed the research and supervised the study. AA, MS, NSH, AR, SS, and MSZ conducted the experiments. AA, MS, and NSH analyzed and interpreted data and wrote the manuscript. All authors read and approved the manuscript. The authors declare that all data were generated in-house and that no paper mill was used.

Afrooghe A et al (2023) Therapeutic potential of bromhexine for acute itch in mice: Involvement of TMPRSS2 and kynurenine pathway. Int Immunopharmacol 117:109919
Twycross R et al (2003) Itch: Scratching more than the surface. QJM: monthly J Association Physicians 96:7–26
Akiyama T, Carstens E (2013) Neural processing of itch. Neuroscience, 250
Bassari R, Koea JB (2015) Jaundice associated pruritis: a review of pathophysiology and treatment. World J Gastroenterol 21(5):1404–1413
Hussain A et al (2019) Pruritus Secondary to Primary Biliary Cholangitis: A Review of the Pathophysiology and Management with Phototherapy. British Journal of Dermatology
Kremer AE, Oude Elferink RP, Beuers U (2011) Pathophysiology and current management of pruritus in liver disease. Clin Res Hepatol Gastroenterol 35(2):89–97
Beuers U et al (2014) Pruritus in cholestasis: facts and fiction. Hepatology 60(1):399–407
Sanjel B, Maeng H-J, Shim W-S (2019) BAM8-22 and its receptor MRGPRX1 may attribute to cholestatic pruritus. Sci Rep 9(1):1–13
Yu H et al (2019) MRGPRX4 is a novel bile acid receptor in cholestatic itch. bioRxiv, : p. 633446
Yu H et al (2019) MRGPRX4 is a bile acid receptor for human cholestatic itch. eLife, 8
Meixiong J et al (2019) MRGPRX4 is a G protein-coupled receptor activated by bile acids that may contribute to cholestatic pruritus. Proceedings of the National Academy of Sciences, 116(21): pp. 10525–10530
Kittaka H et al (2017) Lysophosphatidic acid-induced itch is mediated by signalling of LPA5 receptor, phospholipase D and TRPA1/TRPV1. J Physiol 595(8):2681–2698
Elferink RPO et al (2011) The molecular mechanism of cholestatic pruritus. Dig Dis 29(1):66–71
Sun HS, Feng ZP (2013) Neuroprotective role of ATP-sensitive potassium channels in cerebral ischemia. Acta Pharmacol Sin 34(1):24–32
de Weille JR, Lazdunski M (1990) Regulation of the ATP-sensitive potassium channel. Ion Channels 2:205–222
Takano N, Arai I, Kurachi M (2004) Possible antipruritic effects of K + channel openers in mice. J Dermatol Sci 35(1):71–73
Ostadhadi S et al (2017) Pharmacological evidence for the involvement of adenosine triphosphate sensitive potassium channels in chloroquine-induced itch in mice. Pharmacol Rep 69(6):1295–1299
Coavoy-Sánchez SA et al (2016) Hydrogen sulfide donors alleviate itch secondary to the activation of type-2 protease activated receptors (PAR-2) in mice. Pharmacol Res, 113(Pt A): pp. 686–694
Noroozi N et al (2022) Protective Effects of Dapsone on Scopolamine-Induced Memory Impairment in Mice: Involvement of Nitric Oxide Pathway. Dement Geriatric Cogn Disorders Extra 12(1):43–50
Tag CG et al (2015) Bile duct ligation in mice: induction of inflammatory liver injury and fibrosis by obstructive cholestasis. J visualized experiments: JoVE, (96): p. 52438
Kaster MP et al (2005) Effects of potassium channel inhibitors in the forced swimming test: possible involvement of L-arginine-nitric oxide-soluble guanylate cyclase pathway. Behav Brain Res 165(2):204–209
Mohseni G et al (2017) Agmatine enhances the antidepressant-like effect of lithium in mouse forced swimming test through NMDA pathway. Biomed Pharmacother 88:931–938
Ostadhadi S et al (2017) Development of resistance to serotonin-induced itch in bile duct ligated mice. Clin Exp Pharmacol Physiol 44(6):680–685
Haddadi N-S et al (2017) Peripheral NMDA Receptor/NO System Blockage Inhibits Itch Responses Induced by Chloroquine in Mice. Acta dermato-venereologica 97(5):571–577
Shokrian Zeini M et al (2021) Losartan ointment attenuates imiquimod-induced psoriasis-like inflammation. Int Immunopharmacol 100:108160
LaMotte RH, Dong X, Ringkamp M (2014) Sensory neurons and circuits mediating itch. Nat Rev Neurosci 15(1):19–31
Baraniuk JN (2012) Rise of the sensors: nociception and pruritus. Curr Allergy Asthma Rep 12(2):104–114
Ocaña M et al (2004) Potassium channels and pain: present realities and future opportunities. Eur J Pharmacol 500(1–3):203–219
Sarantopoulos C et al (2003) ATP-sensitive potassium channels in rat primary afferent neurons: the effect of neuropathic injury and gabapentin. Neurosci Lett 343(3):185–189
Yamashita S et al (1994) Possible presence of the ATP-sensitive K + channel in isolated spinal dorsal horn neurons of the rat. Neurosci Lett 170(2):208–212
Picolo G, Cassola AC, Cury Y (2003) Activation of peripheral ATP-sensitive K + channels mediates the antinociceptive effect of Crotalus durissus terrificus snake venom. Eur J Pharmacol 469(1–3):57–64
Shayan M et al (2022) Neuroprotective effects of Lasmiditan and Sumatriptan in an experimental model of post-stroke seizure in mice: Higher effects with concurrent opioid receptors or KATP channels inhibitors. Toxicol Appl Pharmcol 454:116254

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

The Possible Involvement of KATP Channels in Cholestatic Pruritus in Mice

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

1. Introduction

2. Materials and Methods

2.1. Animals and housing

2.2. Chemicals

2.3. Induction of cholestasis

2.4. Open-field locomotor activity

2.5. Rostral back model of acute itch

2.6. Quantitative reverse transcription-polymerase chain reaction (RT-qPCR)

2.7. Statistical analysis

3. Results

3.1. The effect of BDL on the scratching behavior

3.2. The effect of the K_ATP channel openers on the scratching behavior

3.3. The effect of the K_ATP channel blocker on the scratching behavior

3.4. The effect of K_ATP channel openers and blockers on the scratching behavior

3.5. The mRNA expression of Kcnj8 and Kcnj11

4. Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1

The Possible Involvement of KATP Channels in Cholestatic Pruritus in Mice

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

1. Introduction

2. Materials and Methods

2.1. Animals and housing

2.2. Chemicals

2.3. Induction of cholestasis

2.4. Open-field locomotor activity

2.5. Rostral back model of acute itch

2.6. Quantitative reverse transcription-polymerase chain reaction (RT-qPCR)

2.7. Statistical analysis

3. Results

3.1. The effect of BDL on the scratching behavior

3.2. The effect of the KATP channel openers on the scratching behavior

3.3. The effect of the KATP channel blocker on the scratching behavior

3.4. The effect of KATP channel openers and blockers on the scratching behavior

3.5. The mRNA expression of Kcnj8 and Kcnj11

4. Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1

3.2. The effect of the K_ATP channel openers on the scratching behavior

3.3. The effect of the K_ATP channel blocker on the scratching behavior

3.4. The effect of K_ATP channel openers and blockers on the scratching behavior