Animals
All experimental procedures were performed in compliance with the National Institutes of Health guidelines for the use of experimental animals and approved by the Institutional Animal Care and Use Committee of Xi'an Jiaotong University. Mice were single housed in a temperature- and humidity-controlled room with a 12-h reverse light/dark cycle and provided ad libitum access to water and food. 7-week-old male C57BL/6 mice were purchased from the Beijing Vital River Laboratory Animal Technology Co. Ltd and allowed one week of acclimation to the housing conditions before the initiation of experiments. Male dopamine D3 receptor-knockout (D3RKO) mice were a kind gift from Professor Xu (Department of Anaesthesia and Critical Care, The University of Chicago) as described previously [25], and all mice were bred at the housing facilities and used at 8-12 weeks of age. All animals were randomly allocated to the different experimental groups used in this study.
Pharmacological treatments and viral vectors
Lipopolysaccharide (LPS) from Escherichia coli (L-3129, serotype 0127: B8) was purchased from Sigma-Aldrich, they were freshly dissolved in sterile saline. Minocycline (a microglial inhibitor), PD128907 (dopamine D3 receptor agonist), MK2206 (Akt signalling pathway inhibitor) and SP600125 (JNK signalling pathway inhibitor) were obtained from Selleckchem (Houston, TX, USA); minocycline and PD128907 were dissolved in 0.9% saline, and MK2206 and SP600125 were diluted in 0.1% dimethylsulfoxide (DMSO),they were stored at -80 °C. Cytokine IL-4 was purchased from Pepro Tech (Rocky Hills, NJ), dissolved into PBS and kept at -20°C. The adeno-associated virus (AAV) vector was used to genetically over-express D3R (pAAV-CMV-EGFP-2A-Drd3-3FLAG, AAV-D3R), and AAV expressing U6-driven shRNA and CMV-driven mCherry were used to inhibit D3R (pAAV-U6-shDrd3-CMV-EGFP-WPRE-spolyA, AAV-shD3R). Their vectors were both serotyped with AAV2/8 and purchased from Obio Technology, and the viral titer respectively was 1×1012 and 1×1013 particles per ml. All viral vectors were aliquoted and stored at −80 °C until used.
BV-2 microglial cell culture
The immortalized murine microglial cell line, BV‑2 cell, was purchased from the Kunming Institute of Zoology in the Chinese Academy of Sciences (Kunming, China). BV-2 microglial cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37 °C in a humidified atmosphere containing 95% air and 5% CO2. Prior to experimental use, BV-2 microglia were seeded on 100 mm culture dishes, and the medium was changed every two days. When they reached 70-80% confluence, the cells were split with 0.25% trypsin and then seeded on 24-well culture plates (2×104/well) for experimental use. After control siRNA and D3R siRNA transfected into BV-2 microglia, cells were treated with or without LPS (100 ng/ml) or IL-4 (20 ng/ml) for 24 h. In the MK2206 and SP600125 treatment groups, BV-2 cells were simultaneously treated with MK2206 (20 µM and 40 µM) / SP600125 (80 µM and 160 µM) and LPS for 24 h after cells were pretreated with small interfering RNA (siRNA).
Primary microglial cell culture
Primary murine microglia (PMM) were isolated and purified from striatum and mid-brain of neonatal mice (P3–P5) as previously described [28]. In brief, three-five fetal mice brains from WT or D3RKO mice were removed from skull, meninges were stripped and the striatum and mid-brain regions were dissected. Gilal cells were disaggregated by trypsinization (0. 25 % trypsin, 5 min, 37 °C, 5 % CO2), and cells were washed, resuspended in DMEM media supplemented with 10% FBS and 1% penicillin/streptomycin. Afterward, the cell suspension was seeded onto 75 cm2 tissue culture flasks precoated with 5 mg/ml poly-D-lysine at 37 °C in humidified atmosphere of 5% CO2. After incubation for 24 h, the media was replaced by fresh media. Next, half of the volume of media was renovated every 3-4 days and cells were cultured for additional 10 to 14 days. Microglia were obtained from mixed glial culture by mechanical extraction using a horizontal rotating shaker at 230-250 rpm for 2 h and seeded onto poly-D-lysine-coated 24-well culture plates (2-3×104/well) for further use. The purity of the microglial cells obtained was evaluated by CD11b immunostaining (≥ 95% CD11b+ cells). The primary microglial cells obtained from WT and D3RKO mice were treated with or without LPS (100 ng/ml) for 24 h.
siRNA transfection
D3R expression was transiently silenced using D3R siRNA (XIEBHC Biotechnology Beijing, China) according to the manufacturer’s instructions. Briefly, cultured BV-2 cells were plated at a density of 2×104 cells per 24-well plate. After 18 h of growth to 30%-50% confluence, the cells were transfected with control siRNA (nonspecific scramble siRNA that does not target any mouse genes) or D3R siRNA using a mixture of plasmid and lipofectamine2000 (Invitrogen, Carlsbad, USA) in OPTI-MEN according to manufacturer's specification. The cells were incubated with the siRNA mix for 6 hours and then the medium was replaced with new DMEM media with 10% FBS and incubated for another 40 h at 37 °C in humidified atmosphere of 5% CO2 for protein extraction to check the knockdown efficiency by western blot.
Stereotaxic surgery
Mice were anaesthetized with isoflurane (4.0% for induction and 1.0% thereafter for maintenance), and their heads were fixed in a stereotaxic frame (RWD Life Science Co., Shenzhen, China). The skull surface was exposed and all skull measurements were made relative to bregma, drugs or packaged virus injection into the NAc was performed using a microinjection needle with a 10-μl microsyringe (Hamilton, USA) to deliver at a rate of 0.15 µl/minute using an automated injection pump (KDS Legato™ 130, USA). Then the injection needle was withdrawn 10 min after the end of the infusion. The stereotaxic coordinates for nucleus accumbens (NAc) injection were anterior posterior (AP) 1.50 mm, medial lateral (ML) 1.00 mm and dorsal ventral (DV) 4.50 mm relative to Bregma. In the pharmacological treatments, 0.3 µl of minocycline (8 µg), PD128907 (4 µg) or vehicle (0.9 % saline) was bilaterally injected into the NAc 30 min prior to saline (0.3 µl) or LPS (0.3 µl, 100 ng) administration. The dose of LPS was selected based on its ability to induce depressive-like behaviors that are temporally distinct from acute sickness behaviors [29], and the doses of minocycline and PD128907 were chose based on our preliminary experiment showing the beneficial effects of the minimum dose in an animal model of depressive-like behaviors exposed to NAc administration of LPS. At the end of the experiment, trypan blue solution (0.4%) was injected into the NAc, and the injection sites were histologically verified with Nissl staining. For in vivo viral injection, 0.3 µl of virus expressing AAV-D3R or AAV-shD3R were infused into the bilateral NAc of the D3RKO or WT mice, respectively. Mice were used at least one week after AAV injection.
Depressive-like behavioral tests
All tests were carried out during the light phase (between 9:00 am and 4:00 pm), and the mice were allowed to acclimatize to the behavioral test room for at least one hour. The forced swim test (FST) and tail suspension test (TST) were performed after 24 h of LPS/saline injection or 4 weeks of virus administration. In the sucrose preference test, 24 h of the water and sucrose consumption were measured after pharmacological and viral treatments. According to our previous study [25], the FST was conducted as follows. Mice were placed in a transparent plastic cylinder (30 cm height × 20 cm diameter) that was partially filled to a height of 15 cm with 24±1°C water for 6 min. The water in the cylinder was changed between each mouse during the test session. The test duration was video-recorded for 6 min, and the mice were calculated for the final 4 min of immobile time. The TST was conducted as follows. Mice were suspended 30 cm above the floor by hanging on a fixed hook using a small piece of adhesive tape placed approximately 2 cm from the tip of the tail for 10 min. The duration of immobility over the 10 min was recorded and calculated. The sucrose preference test was conducted as follows. To quantify inflammation-induced anhedonia, we subjected mice to the two-bottle sucrose preference test. Approximately 2 weeks prior to treatment, mice were trained by simultaneous presentation with a bottle of water and a bottle of 1% (wt/vol) sucrose solution. The bottles were weighed prior to being placed on the lid of each mouse’s home cage and reweighed to determine the amount of sucrose solution and water that had been consumed after 24 h. The positions of the bottles were changed every 12 h to ensure that the mice did not develop a preference for one side. Mice were trained until a stable baseline preference was established, and then, treatments were administered. Sucrose preference was calculated as the percentage of sucrose solution consumed relative to the total fluid intake: sucrose intake/(sucrose intake + water intake) × 100. The behavioral tests were performed by experimenters who were blinded to the experimental groups.
Tissue collection and quantitative real-time RT-PCR (qRT-PCR) analysis
At 0, 4, 12, or 24 h post-injection of LPS and after 4 weeks of virus injection, mice were euthanized by sodium pentobarbital solution (100 mg/kg). NAc brain tissue was dissected bilaterally on ice and immediately frozen in sample tubes placed in liquid nitrogen. The tissue was stored frozen at -80 °C until processing. Next, total RNA was isolated using the TRIzol® RNA extraction kit (Invitrogen). Reverse transcription was performed using 1 µg of total RNA for each sample by using the PrimeScriptTM RT reagent kit (Takara Bio Inc.) according to the manufacturer’s instructions. Real-time PCR amplification was performed using the Stratagene Mx 3005p Real-Time PCR Detection System (Agilent Technologies, Santa Clara, CA, USA) with SYBR Green master mix (Takara Bio Inc.) in a final volume of 20 µL that contained 1 µL of cDNA template from each sample. The primers used in our study are listed as follows: D3R forward: CATGATTACGGCTGTGTGGG, D3R reverse: GAGGATCCGTTTTCTTCGCC; Iba1 forward: ACGAACCCTCTGATGTGGTC, Iba1 reverse: TGAGGAGGACTGGCTGACTT; GAPDH forward: TGTGTCCGTCGTGGATCTGA; GAPDH reverse: TTGCTGTTGAAGTCGCAGGAG. The relative mRNA values were normalized to the control values of the GAPDH gene and calculated using the comparative cycle threshold (△△Ct) method [30].
Western blot analysis
Western blot was performed as described previously [25]. Briefly, NAc tissue after LPS/saline and cultured BV-2 cells treated with siRNA 24 h after LPS challenge were collected and lysed in RIPA lysis buffer (1× phosphate-buffered saline, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 1% sodium dodecyl sulfate; Beyotime, Shanghai, China) containing a 1:50 ratio of protease and phosphatase inhibitor cocktail (Roche, Basel, Switzerland). The protein samples were determined using a BCA kit (Solarbio Science & Technology Co., Ltd., Beijing, China), resolved via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE), and transferred to polyvinylidene difluoride (Millipore, USA) membranes. The primary antibodies against the following targets were used: anti-Iba1 antibody (1:1000; Abcam, USA), anti-CD11b antibody (1:1000; Abcam, USA), anti-D3R antibody (1:2000; Abcam, USA), anti-GAPDH antibody (1:2000; Proteintech, USA), anti-phosphorylated ERK1/2 antibody (p-ERK1/2, 1:1000; CST, USA), anti- ERK1/2 antibody (ERK1/2, 1:1000; CST, USA), anti-phosphorylated P38 antibody (p-P38, 1:1000; CST, USA), anti-P38 antibody (1:1000; CST, USA), anti-phosphorylated JNK antibody (p-JNK, 1:1000; CST, USA), anti-JNK antibody (1:1000; CST, USA), anti-phosphorylated CREB antibody (p-CREB, 1:1000; CST, USA), anti-CREB antibody (1:1000; CST, USA), anti-phosphorylated Akt antibody (p-Akt, 1:1000; CST, USA), anti-Akt antibody (1:1000; CST, USA). Proteins were visualized by incubation in ECL solution (Millipore, USA), and images were captured using a Fusion FX5 camera system. The scanned images were measured using ImageJ software (National Institute of Health, Bethesda, MA, USA). Specific bands were then quantified and normalized to the GAPDH loading control for each lane and each blot.
Cytokine assessment
After NAc brain region and primary microglial and BV-2 cells were treated by LPS or IL-4 for 24 h, the supernatants obtained from NAc tissue and cultured cells were collected. The concentrations of secreted TNF-α, IL-1β, IL-6, IL-10 and Arginase-1 were detected by enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer’s instructions (Invitrogen, Thermo Fisher). Sample values were read from the standard curve. Each sample was assayed in duplicate.
Flow cytometry
The NAc brain tissue after virus administration were collected and placed in the 2 ml RPMI and disaggregated by grinders, and the collected cell suspension was filtered through a 70-µm strainer to prevent cell clumps and re-suspended in 200 mL PBS for detection. The BV-2 cells in the culture dish were digested using trypsin, and washed and re-suspended in PBS. All isolated cells from tissue and BV-2 cell were incubated with FITC-conjugated monoclonal mouse CD45 antibody (BioLegend, San Diego, USA), brilliant violet 421™-conjugated monoclonal mouse CD11b antibody (BioLegend, San Diego, USA), PE-conjugated monoclonal mouse CD86 antibody (BioLegend, San Diego, USA) and APC-conjugated monoclonal mouse CD206 antibody (BioLegend, San Diego, USA) for 30 min at 4℃ in the dark. Finally, cells were fixed and measured using a Beckman Coulter flow cytometer.
Immunofluorescence staining
The primary microglial and BV-2 cells were seeded on coverslips and cultured in DMEM with 10% FBS for 24 h. After LPS treatment, cells were washed twice in PBS and fixed in 4% paraformaldehyde at room temperature for 30 min, then permeabilized with Triton X-100 for 10 min and blocked with normal goat serum for 1 h. The cells were stained by rabbit anti-mouse CD11b antibody (1:200; Abcam, USA) overnight at 4°C and then incubated with fluroscence-secondary antibody FITC (1:500; Proteintech, USA). Cells were treated with DAPI solution for 20 min at 37°C. Images were acquired by a Fluorescence confocal microscope (Lecia SP8, Germany ) and analyzed with ImageJ software system.
Statistical analysis
All data are presented as the mean±SEM. Data were analysed using IBM SPSS Statistics 20.0. No statistical methods were used to predetermine sample sizes, but our sample sizes are similar to those reported in previous publications [25, 29]. Student’s t-tests and one-way (treatment) analysis of variance (ANOVA) were performed as appropriate. After ANOVA was performed, the LSD post hoc test was used for multiple comparisons. P-values less than 0.05 were considered statistically significant.