MRPL27 as a new prognostic biomarker involved in immune cell infiltration and hepatocellular carcinoma progression

doi:10.21203/rs.3.rs-4335610/v1

Download PDF

Article

MRPL27 as a new prognostic biomarker involved in immune cell infiltration and hepatocellular carcinoma progression

https://doi.org/10.21203/rs.3.rs-4335610/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Mitochondrial ribosomal protein L27 (MRPL27) is a member of mitochondrial ribosomal proteins (MRPs). However, the biological function of MRPL27 in hepatocellular carcinoma (LIHC) is still unclear. Use UALCAN, TIMER, TISIDB, Kaplan Meier, and GEPIA database systems to analyze the expression, prognostic value, and relationship between MRPL27 and immune infiltration in LIHC. The expression and clinical significance of MRPL27 in LIHC patients were validated using tissue microarray. Conduct cell function experiments to detect the effects of overexpression and knockdown of MRPL27 on the proliferation, migration, and invasion of Huh7 cells. The tissue microarray results confirmed that MRPL27 expression is upregulated in LIHC, and high MRPL27 expression is associated with poorer prognosis. The expression of MRPL27 is significantly correlated with the infiltration levels of immune modulators, chemokines, and various immune cells. In addition, MRPL27 affects the proliferation, migration, and invasion of LIHC cells. These data indicate that MRPL27 is a new prognostic biomarker for LIHC and is associated with immune infiltration in LIHC.

Biological sciences/Cancer

Biological sciences/Immunology

MRPL27

LIHC prognosis

Tissue chip

Immune infiltration

Hepatocellular carcinoma (HCC) is a common malignant tumor of digestive system, which has a high incidence rate and mortality [1]. Although significant progress has been made in clinical treatment strategies, the incidence of postoperative tumor recurrence and metastasis remains high [2–3]. The development of HCC is a multi-step process of multifactorial etiology and multi gene alternation, which also leads to poor overall prognosis of HCC. Therefore, there is an urgent need to study new biomarkers and treatment targets to improve the survival rate of HCC patients.

Mitochondrial function is crucial for the survival and proliferation of cancer cells, and inhibiting mitochondrial translation can be considered a promising target for cancer treatment. Mitochondrial ribosomal proteins (MRPs) are important components of mitochondrial translation mechanisms. It has been found that MRPs are highly invasive and metastatic to breast cancer [4–5], colorectal cancer [6] and ovarian cancer [7]. The location of enhanced expression can predict the location of tumor occurrence, which indicates that MRPs are closely related to the occurrence and development of tumors. Mitochondrial ribosomal protein L27 is unique to mitochondrial ribosomes and is located on the X chromosome, encoding 146 amino acids and YmL27 protein [8]. Research has shown that the MRPL27 gene is involved in the occurrence of cholangiocarcinoma and lung cancer, and is a risk factor for low survival in patients [9–10]. Moreover, the MRPL27 gene is also involved in the early stages of liver cancer development, such as non-alcoholic fatty liver disease [11]. However, the biological function of MRPL27 in HCC is still unclear.

Tumor infiltrating lymphocytes (TIL) and other tumor infiltrating immune cells (TIICs) are key factors in tumor immune monitoring based on tumor immunogenicity. The density and location of TIL and TIICs in the tumor area and their function play a prominent role in predicting the prognosis and prognosis of cancer. For example, tumor associated diseases (TANs), Tregs, and tumor associated diseases (TAMs) are significantly correlated with the prognosis of colorectal cancer patients and are independent prognostic factors [12]. The reduction of CD4 + central memory T cells and natural killer (NK) cells is significantly associated with better survival in glioblastoma patients [13], and B cells and myeloid dendritic cells (DC) have been identified as independent prognostic factors for survival in lung cancer patients [14], And Treg cells are found in the advanced cervical cancer [15]. Therefore, immune cell infiltration is crucial for the treatment of liver cancer. However, the relationship between MRP27 and immune cell infiltration has not been widely studied.

In this study, the TIMER and UALCAN databases were used to evaluate the expression of MRPL27 mRNA in LIHC. Analyze MRPL27 protein levels using the Human Protein Atlas (HPA) database and validate using tissue microarrays. The GEPIA and Kaplan Meier plotter databases are used to analyze how MRPL27 affects the overall survival rate (OS) of LIHC patients. The correlation between MRPL27 expression and TIICs in LIHC was studied in TIMER and TISIDB databases. The relationship between MRPL27 expression and TIICs gene markers was evaluated using TIMER and GEPIA databases. Further exploration of genes co expressed with MRPL27 and their regulatory networks using GeneMANIA and linkage omics analysis. Cell experiments further confirmed the function of MRPL27 in the proliferation, migration, and invasion of liver cancer cells. This study provides a correlation between MRPL27 and liver cancer prognosis and immune cell infiltration in liver cancer.

Tissue chip analysis

The tissue chip containing 118 cases of LIHC was purchased from Shanghai Xinchao Biotechnology Co., Ltd. (Shanghai, China). Incubate the IHC [33] tissue microarray with the first antibody against MRPL27 (1:40014765-1-AP, protentechUK) as described earlier. According to the proportion of positive cells in all tissue cells and the degree of staining of positive cells, the immunohistochemical test results are determined as follows: A: Score according to the number of stained cells, 1 point for positive cells<1/3, 2 points for positive cells between 1/3-2/3, and 3 points for positive cells ≥ 2/3. B: According to the depth of cell staining, cells without positive reactions are scored as 0 points, light yellow is scored as 1 point, brown is scored as 2 points, brown is scored as 3 points, and the product score is AxB.

Huh7-MRPL27 adenovirus infection in liver cancer Huh7 cells

Firstly, the pDONR221 skeleton plasmid was extracted, transformed into Escherichia coli receptive cells, and positive clones were selected and identified to construct an Ad5 adenovirus vector (referred to as Huh7-MRPL27) with pAV [Exp] - EGFP-EF1A>hMRPL27. The day before infection, each bottle contains 5 × 106 cells. The next day, after the cells have grown to a density of 80% at the bottom of the attached bottle, add the empty vector Huh7-Vector virus solution 1 to every 25cm2 of the culture bottle μ l. Overexpression of Huh7-MRPL27 virus solution 3 μ l. Shake well. After 72 hours of infection, the expression of adenovirus GFP was observed using a fluorescence microscope, and the overexpression of pAV-MRPL27 experimental group and negative control empty vector pAV-Vector group cells were obtained. Primer sequence:

MRPL27-F1: GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGGCGTCGGTGGTGTTGGC；

MRPL27-R1:GGGGACCACTTTGTACAAGAAAGCTGGGTTCAAAGCATAGCTACCAGTTTGAAGG

Transcriptome sequencing

The total RNA was detected in liver cancer Huh7 cells infected with approximately 5 million Huh7-MRPL27 adenoviruses using TRIzol reagent (Ambion, USA) according to the manufacturer's instructions. Total RNA (2 μ g) Was subsequently used to prepare RNAseq library using a NEBNext UltraTM RNA Library Prep Kit from Illumina (NEB, USA) following the manufacturer's protocol The library preparations were sequenced with an Illumina Hiseq 4000 platform and pairdend 150 bp reads were generated Raw data (raw reads) in FASTQ format were processed through in house Perl scripts Reads were aligned to release GRCh38 of the human genome using TopHat 2 (v. 2.1.0). Gene expression levels (FPKM, fragments per kilobase of exit model per million mapped reads) were calculated with HTSeq (v. 0.5.4 p3) All downstream statistical analyses, including PCA, were performed with edgeR program package

Cell transfection

The human LIHC cell line (Huh7) was purchased from the cell bank of the Typical Culture Preservation Committee of the Chinese Academy of Sciences. They were cultured in DMEM medium containing 10% FBS. Shenggong Biotechnology (Shanghai) Co., Ltd. (Shanghai, China) synthesized a short hairpin RNA (siRNA) of si-MRPL27 (Sense:5 '-CAGACGCCAAAGGCAUUAAGAA-3';Antisense:5 '- UUCUUAAUGCCUUGGCGUCUG-3') and a negative control (Sense: 5 '- UUCUCCGAACGUGUCACGUTT-3'; Anti sense: 5 '- ACGUGACACGUUCGGAGAATT-3'). They were transfected into the Huh7 cell line using Lipofectamine 3000 reagents (Invitrogen, Carlsbad, CA, USA).

Cell proliferation analysis

CCK-8 analysis is used to detect cell proliferation. Inoculate cells infected with adenovirus or siRNA into 96 well plates and culture for 1, 2, 3, or 4 days. Add CCK-8 reagent (Meilunbio, Dalian, China) to each well. Measure the absorbance at 450nm using an enzyme-linked immunosorbent assay (Synergy2, BioTek, USA).

Wound healing test

Inoculate the transfected cells into a 6-well plate, and then use the tip of a pipette to create scratches. Collect photos at 0 and 24 hours, while analyzing the wound healing rate.

Transwell analysis

Cell migration was detected using Transwell Room (Corning, New York, USA). Add 1 × 105 Huh7 cells were added to the upper chamber of Transwell chamber, and 20% FBS DMEM medium was added to the lower chamber. After 24 hours, the cells on the lower surface of the membrane were fixed with 4% paraformaldehyde, stained with 0.5% crystal violet, photographed, and counted.

Link to database

UALCAN: http://ualcan.path.uab.edu/; TIMER, https://cistrome.shinyapps.io/timer/ ; GEPIA, http://gepia.cancer-pku.cn/index.html ; Kaplan Meier plotter, https://kmplot.com/analysis/ ; LinkedOmics, http://www.linkedomics.org/login.php ; GeneMANIA, http://www.genemania.org ; TISIDB, http://cis.hku.hk/TISIDB/index.php ; TISCH, http://tisch.comp-genomics.org/.

Statistical analysis

Statistical analysis using online bioinformatics databases and SPSS 22.0 software (IBM, Armonk, New York, USA). The Kaplan Meier curve is used to evaluate the relationship between MRPL27 expression and OS. Evaluate the relationship between MRPL27 expression and immune infiltration, immune modulators, and chemokines through Spearman correlation analysis. To determine prognostic factors, univariate and multivariate Cox regression analyses were conducted. The experimental data is expressed as mean ± standard deviation and compared using the student t-test. Multiple group comparisons were conducted using one-way ANOVA, followed by Bonferroni post hoc testing. Each analysis was repeated in at least three independent experiments. The statistical significance is set to p<0.05.

Expression level of MRPL27 in LIHC

Gene expression analysis in the TIMER database showed significant overexpression of MRPL27 mRNA in various tumor tissues, including liver cancer (Fig. 1A). The UALCAN database also showed that the expression level of MRPL27 was significantly higher in 371 LIHC samples than in normal tissues (Fig. 1B), indicating that the high expression of MRPL27 mRNA in LIHC tissues is closely related to liver cancer differentiation grade (Fig. 1C), cancer stage 1–3 (Fig. 1D), and body weight (Fig. 1E), especially in overweight and obese patients (BMI between 25–40).

The correlation between the expression of MRPL27 in tissue microarray and the survival rate of LIHC patients, the expression of MRPL27 in LIHC, and its prognostic value

Using the UALCAN database to analyze the protein expression and prognostic value of MRPL27 in LIHC patients, patients with high expression of MRPL27 had lower survival time, and compared with patients with low expression (Fig. 2A), the area under the curve showed a high ability to predict clinical outcome of patients (AUC = 0.915)(Fig. 2B). Kaplan-Meier survival curves were then used to assess the correlation between MRPL27 expression and OS in LIHC patients, with higher MRPL27 expression associated with worse OS in LIHC patients (Fig. 2C). Next, we studied the relationship between MRPL27 expression and OS in different subgroups. LIHC patients with high MRPL27 expression had worse OS in multiple subgroups, including sorafenib treatment, Grade-3, and women (Fig. 2D-F). These results suggest that MRPL27 can be used as a biomarker map to predict prognosis in LIHC patients. Further analysis of tissue microarray showed that MRPL27 was overexpressed in LIHC tissues compared to normal tissues, and the IHC score of MRPL27 was positively correlated with clinical stage in LIHC tissues, with higher expression at stage III > 3cm (Fig. 2G). In Table 1, we statistically analyzed the relationship between clinicopathologic data and MRPL27 in these patients, and found that MRPL27 expression was significantly correlated with tumor size (p < 0.01), pathological stage, Recrudescence, and pathological stage (p < 0.05).

Enrichment Analysis of GO and KEGG Pathways in MRPL27

After overexpressing MRPL27 in liver cancer cell line Huh7, transcriptomic sequencing revealed the overall distribution of differentially expressed genes compared to the control group (CG) and experimental group (EG). Overexpression of MRPL27 upregulated 3197 genes and downregulated 2740 genes (Fig. 3A). The Venn diagram of differentially expressed genes can intuitively display the number of unique or common differentially expressed genes among the comparison groups (Fig. 3B), The GO enrichment bar chart of differentially expressed genes can intuitively reflect the distribution of differentially expressed genes on the GO terms of biological processes, cellular components, and molecular functions. GO analysis showed that MRPL27 and co expressed genes are involved in metabolic processes, including intracellular, organelle, cycloplasm, nucleus, binding, etc. (Fig. 3C). The outermost circle of the GO enriched circos map displays the first 20 enriched GO terms, followed by the number of genes annotated with that term (background genes) from all genes in an inward order; The number of differentially expressed genes enriched in this term (foreground genes); The ratio of foreground genes to background genes (rich factor), with 10 gray circles in the innermost circle representing a scale of 0.1-1.0. The filling color of the innermost circle reflects the significant degree of enrichment of the term - log10 (Q-value), with the deeper the color, the more significant it is (Fig. 3D). KEGG pathway enrichment analysis revealed that MRPL27 and co expressed genes are involved in ribosome, amino acid biosynthesis, cell cycle, endocytosis, MTOR signaling pathway, and metabolic pathway (Fig. 3E); The top 20 significantly enriched primary and tertiary pathways in the KEGG enrichment analysis of differentially expressed genes are shown in Fig. 3F.

Expression of MRPL27 at the Single Cell Level in TME

To study the expression of MRPL27 in three datasets (LIHC_GSE1125449, LIHC_GSE140228, and LIHC_GSE98638) in LIHC using the Tumor Immune Single Cell Center (TISCH) database. In LIHC_ In the GSE1125449 dataset, MRPL27 is mainly expressed in Malignant cells, hepatic progenitor cells, fibroblasts cells, endothelial cells, and monocytes/macrophages; LIHC_ In the GSE140228 dataset, MRPL27 is mainly expressed in mast cells, monocytes/macrophages, and dendritic cells; LIHC_ In the GSE98638 dataset, MRPL27 is mainly expressed in tprolif cells, treg cells, depleted CD8T (CD8Tex) cells, CD8T cells, and CD4 conventional T (CD4Tconv) cells (Fig. 4A). These data indicate that in addition to malignant cells, MRPL27 also plays a role in immune cells and stromal cells. In addition, the expression of MRPL27 varies greatly among different cell types, which may lead to heterogeneity of TME in LIHC.

The correlation between MRPL27 expression and immune infiltration

The relationship between MRPL27 expression and the levels of lymphocyte infiltration in 28 tumor types was evaluated by TISIDB (Fig. 5A). In LIHC, the expression of MRPL27 was negatively correlated with the infiltration levels of effector th2 cells, immB cells, act-cd4 cells, tem-cd4 cells, mem-B cells, and eosinophil cells (Fig. 5B). These results suggest that MRPL27 is essential for immune cell infiltration of LIHC. The correlation between MRPL27 expression and different gene markers of immune cells in LIHC was studied using TIMER database. After purity correction, MRPL27 and M1 macrophage COX2; STAT6 of Th2 cell; FOXP3, CCR8 and STAT5B gene markers of Treg cells were significantly negatively correlated (Table 2, ***p<0.001). The correlation between MRPL27 expression and immunomodulators was investigated in TISIDB (Fig. 5C). In LIHC, MRPL27 was inversely associated with multiple immunosuppressants, including CD28, CD40LG, CD274, CD96, KDR, and TGFB1(Fig. 5D). The relationship between MRPL27 and immune stimulants in various tumors was also analyzed (Fig. 5E). In LIHC, a negative correlation was observed between MRPL27 and IL6R, TMEM173, TNFSF9, TNFSF3, TNFSF14, TNFSF15 and (Fig. 5F). Chemokines and chemokine receptors play a crucial role in recruitment and activation of immune cells. The association between MRPL27 expression and chemokines was evaluated in TISIDB. MRPL27 was inversely associated with various chemokines (Fig. 6A), including CCL18, CXCL16, CXCL18, CXCL9, CXCL12, and CXCL14(Fig. 6B). At the same time, MRPL27 was negatively correlated with different chemokine receptors (Fig. 6C), including CCR1, CCR2, CCR4, CCR5, CXCR4, and CX3CR1(Fig. 6D). These findings suggest that MRPL27 is an immunomodulator of LIHC.

MRPL27 affects the proliferation and invasion of LIHC cells

In addition, various cell experiments were conducted to evaluate the function of MRPL27 in LIHC cell proliferation, migration, and invasion. The CCK-8 experiment showed that overexpression of MRPL27 significantly promoted the proliferation of LIHC cells (Fig. 7A); Knocking down significantly inhibits the proliferation of LIHC cells (Fig. 7B); The wound healing experiment showed that overexpression of MRPL27 significantly promoted the wound healing rate of LIHC cells compared to vector (Fig. 7C), while sh-MRPL27 significantly reduced the wound healing rate of LIHC cells compared to sh-NC (Fig. 7D); Overexpression of MRPL27 promotes the invasion of LIHC cells and is significantly inhibited by sh-MRPL27 (Fig. 7E-F). These data indicate that MRPL27 affects the growth and metastasis of LIHC cells.

Mitochondrial ribosomal proteins (MRPs) are important components of mitochondrial translation mechanisms. Their members are highly expressed in various cancer tissues, and their expression levels are negatively correlated with the survival rate of cancer patients. They can also serve as diagnostic and prognostic biomarkers for cancer. MRPL27 has not been widely studied, and its functional role in LIHC is still unclear. We Conduct a comprehensive bioinformatics analysis to systematically investigate the expression and clinical significance of MRPL27 in LIHC. MRPL27 expression is significantly upregulated in LIHC tissues, and high MRPL27 expression is associated with shorter OS in LIHC patients. In addition, MRPL27 is closely related to immune infiltration, immune modulators, and chemokines in LIHC. Finally, various cell experiments have shown that knocking out MRPL27 significantly inhibits proliferation, migration, and invasion of LIHC cells. This study provides new insights into the function of MRPL27, which can serve as a prognostic marker related to immune cell infiltration and tumor development in LIHC.

To investigate the biological function of MRPL27 in LIHC, we overexpressed MRPL27 and performed GO and KEGG analysis. Further KEGG pathway analysis indicates that MRPL27 co expressed genes are involved in various biological processes such as endocytosis, cell cycle, MTOR signaling pathway, endoplasmic reticulum protein processing, various cancer processes, metabolism, and amino acid biosynthesis. MTOR is a serine/threonine kinase that receives inputs from amino acids, nutrients, growth factors, and environmental signals, regulating various basic cellular processes, including protein synthesis, growth, metabolism, aging, regeneration, autophagy, etc. MTOR is often deregulated in human cancer, and somatic mutations that activate mTOR have recently been found in several types of human cancer, making mTOR a therapeutic target. MTOR inhibitors are commonly used as immunosuppressants and have been approved for the treatment of human malignant tumors [16–17]. The processing, modification, and folding of proteins in the endoplasmic reticulum (ER) is a strictly regulated process. Abnormal activation of ER stress sensors and their downstream signaling pathways has become a key regulatory factor for tumor growth and metastasis, as well as response to chemotherapy, targeted therapy, and immunotherapy [18]. Carcinogenic signals and metabolic changes are interrelated in cancer cells. Mitochondrial metabolism maintains tumor phenotype by providing key metabolites for macromolecular synthesis and producing tumor metabolites, thereby supporting tumor synthesis metabolism. In addition, multiple clinical trials have tested the efficacy of inhibiting mitochondrial metabolism as a new cancer treatment method [19–20]. The occurrence, development, and response to treatment of tumors are closely related to the host immune system, and many immune functions rely on complete mitochondrial metabolism. In addition, MRPL27 is associated with several immune related biological processes, such as M1 macrophages, Th2 cell cells, and Treg cells. These findings suggest that MRPL27 may demonstrate the therapeutic potential of LIHC by regulating mitochondrial metabolism, mTOR signaling pathway, and immune response.

The tumor microenvironment (TME) includes a variety of immune cell types, cancer related fibroblasts, endothelial cells, pericytes, and various additional tissue resident cell types, which play a key role in the pathogenesis of cancer [21]. There may be significant differences in the cellular composition and functional status of TME based on the organ where the tumor occurs, the inherent characteristics of cancer cells, tumor staging, and patient characteristics. Understanding the complex interactions between the internal and external mediators of tumor cells, as well as the systemic mediators of disease progression, is crucial for the rational development of effective anticancer therapies. Evaluate the distribution of MRPL27 expression in various cell types using the TISCH database. In TME, cancer associated fibroblasts (CAFs) have been shown to play multiple roles in the development of tumors. They secrete growth factors, inflammatory ligands, and extracellular matrix proteins, which affect cancer cell proliferation and immune rejection [22–23]. CAFs can directly connect and induce naive CD4 T cells to enter regulatory T cells (Tregs) in an antigen-specific way, which helps pancreatic cancer immune escape [24]. Tumor associated macrophages can mediate the phagocytosis and cytotoxic tumor killing of cancer cells, and effectively interact with innate and adaptive immune system components in both directions. Macrophage centered treatment strategies may complement and collaborate with currently available tools in the field of oncology [25–26]. CD8 T cells (Texs) and activated Treg cells are associated with liver metastasis in colorectal cancer [27]; We found that MRPL27 is expressed in Malignant cells, hepatic progenitor cells, fibroblasts cells, endothelial cells, monocytes/macrophages, dendritic cells, tprolif cells, CD8Tex cells, and Treg cells. These data indicate that in addition to malignant cells, MRPL27 also plays a role in immune cells and stromal cells. The negative correlation between MRPL27 and these immune cells further supports the suppression of cancer immunity by overexpression of MRPL27, leading to cancer development and low survival rates in LIHC patients.

Different immune cell subpopulations are recruited into the tumor microenvironment through the interaction between chemokines and chemokine receptors, which have different impacts on tumor progression and treatment outcomes. Targeted chemokines have great potential in combination with other immunotherapies for cancer treatment [28]. MRPL27 is negatively correlated with various chemokines and chemokine receptors, including CCL18, CXCL16, CXCL18, CXCL9, CXCL12, CXCL14, CCR1, CCR2, CCR4, CCR5, CXCR4, and CX3CR1. Chemokines and chemokine receptors are involved in the generation and recruitment of immune cells, contributing to the formation of a tumor promoting microenvironment and strongly influencing tumor promoting and anti-tumor immune responses [29]. It has been found that CCL18 expression in the blood or cancer matrix of breast cancer is related to metastasis and the reduction of patient survival rate [30]. CXCL9 and head and neck squamous cell carcinoma have a strong correlation with prognosis [31], CCR1, CCR5, and their ligands are the main immune centers activated by various tumor derived factors, and their activation is necessary for the differentiation of MDSCs and prototumor macrophages [32]. These findings indicate that MRPL27 is an immune regulatory factor of LIHC.

Meanwhile, we validated the biological function of MRPL27 in LIHC by overexpressing and knocking down MRPL27 in Huh7 cells. The expression of MRPL27 significantly affects cell proliferation, migration, and invasion in LIHC. These findings indicate that MRPL27 is a new prognostic biomarker and a potential therapeutic target for LIHC. However, animal studies are needed to validate the function of MRPL27 in vivo and the significant relationship between MRPL27 and immune infiltration and chemokines. We also need to further investigate the potential molecular mechanisms of MRPL27 in the progression of LIHC.

Acknowledgments

Not applicable.

Funding

This work was supported by the Basic scientific research project of Fujian Science and Technology Department (No.2023R1011001 and No.2021R1012006), Natural Science Foundation of Fujian Province (No.2023J01172), National Natural Science Foundationof China (No. 62072107) and Natural Science Foundation of Fujian Province of China (No. 2020J01610).

Data availability

The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive (Genomics, Proteomics & Bioinformatics 2021) in National Genomics Data Center (Nucleic Acids Res 2022), China National Center for Bioinformation / Beijing Institute of Genomics, Chinese Academy of Sciences (GSA-Human: HRA007385) that are publicly accessible athttps://ngdc.cncb.ac.cn/gsa-human.

Author Contributions

J.Y.Y performed the experiments and data analysis, contributed to manuscript writing; Q.H.L performed experiments and data analysis; X.Y.L Article language editing and modification; K.C performed the experiments and analyzed the data; X.Y.C performed the experiments and analyzed the data; J.Y.H conceived the primary hypothesis, designed the research, analyzed and interpreted the data; Z.J.L conceived the primary hypothesis, designed the research.All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Siegel Rebecca L,Miller Kimberly D,Fuchs Hannah E et al. Cancer statistics, 2022.[J] .CA Cancer J Clin, 2022, 72: 7-33.
Allemani Claudia,Weir Hannah K,Carreira Helena et al. Global surveillance of cancer survival 1995-2009: analysis of individual data for 25,676,887 patients from 279 population-based registries in 67 countries (CONCORD-2).[J] .Lancet, 2015, 385: 977-1010.
Serper Marina,Taddei Tamar H,Mehta Rajni et al. Association of Provider Specialty and Multidisciplinary Care With Hepatocellular Carcinoma Treatment and Mortality.[J] .Gastroenterology, 2017, 152: 1954-1964.
Li X, Wang M, Li S, et al. HIF-1-induced mitochondrial ribosome protein L52: a mechanism for breast cancer cellular adaptation and metastatic initiation in response to hypoxia[J]. Theranostics, 2021, 11（15）:7337-7359.
Ye H, Zhang N. Identification of the Upregulation of MRPL13 as a Novel Prognostic Marker Associated with Overall Survival Time and Immunotherapy Response in Breast Cancer[J]. Comput Math Methods Med,2021, 2021: 1498924.
Zhang L, Lu P, Yan L, et al. MRPL35 Is Up-Regulated in Colorectal Cancer and Regulates Colorectal Cancer Cell Growth and Apoptosis[J]. Am J Pathol, 2019, 189（5）: 1105-1120.
Xu H, Zou R, Li F, et al. MRPL15 is a novel prognostic biomarker and therapeutic target for epithelial ovarian cancer[J]. Cancer Med, 2021, 10（11）: 3655-3673.
Graack HR, Grohmann L, Kitakawa M, et al. The nuclear coded mitoribosomal proteins YmL27 and YmL31 are both essential for mitochondrial function in yeast[J].Biochimie,1991;73 （6）:837-844.
Zhuang L, Meng Z, Yang Z. MRPL27 contributes to unfavorable overall survival and disease-free survival from cholangiocarcinoma patients[J]. Int J Med Sci, 2021, 18（4）: 936-943.
Dai D, Shi R, Han S, et al. Weighted gene coexpression network analysis identifies hub genes related to KRAS mutant lung adenocarcinoma[J]. Medicine （Baltimore）, 2020, 99（32）: e21478.
Zeng Folai,Shi Meijie,Xiao Huanming et al. WGCNA-Based Identification of Hub Genes and Key Pathways Involved in Nonalcoholic Fatty Liver Disease.[J] .Biomed Res Int, 2021, 2021: 5633211.
Ye Lele,Zhang Teming,Kang Zhengchun et al. Tumor-Infiltrating Immune Cells Act as a Marker for Prognosis in Colorectal Cancer.[J] .Front Immunol, 2019, 10: 2368.
Wu, S.; Yang,W.; Zhang, H.; Ren, Y.; Fang, Z.; Yuan, C.; Yao, Z. The Prognostic Landscape of Tumor-Infiltrating Immune Cells and Immune Checkpoints in Glioblastoma. Technol. Cancer Res. Treat. 2019, 18.
Liu, X.; Shang, X.; Li, J.; Zhang, S. The Prognosis and Immune Checkpoint Blockade Efficacy Prediction of Tumor-Infiltrating Immune Cells in Lung Cancer. Front. Cell Dev. Biol. 2021, 9.
Ou Zhihua,Lin Shitong,Qiu Jiaying et al. Single-Nucleus RNA Sequencing and Spatial Transcriptomics Reveal the Immunological Microenvironment of Cervical Squamous Cell Carcinoma.[J] .Adv Sci (Weinh), 2022, 9.
Mossmann Dirk,Park Sujin,Hall Michael N,mTOR signalling and cellular metabolism are mutual determinants in cancer.[J] .Nat Rev Cancer, 2018, 18: 744-757.
Murugan Avaniyapuram Kannan,mTOR: Role in cancer, metastasis and drug resistance.[J] .Semin Cancer Biol, 2019, 59: 92-111.
Chen Xi,Cubillos-Ruiz Juan R,Endoplasmic reticulum stress signals in the tumour and its microenvironment.[J] .Nat Rev Cancer, 2021, 21: 71-88.
Vasan Karthik,Werner Marie,Chandel Navdeep S,Mitochondrial Metabolism as a Target for Cancer Therapy.[J] .Cell Metab, 2020, 32: 341-352.
Porporato Paolo Ettore,Filigheddu Nicoletta,Pedro José Manuel Bravo-San et al. Mitochondrial metabolism and cancer.[J] .Cell Res, 2018, 28: 265-280.
de Visser Karin E,Joyce Johanna A,The evolving tumor microenvironment: From cancer initiation to metastatic outgrowth.[J] .Cancer Cell, 2023, 41: 374-403.
Biffi Giulia,Tuveson David A,Diversity and Biology of Cancer-Associated Fibroblasts.[J] .Physiol Rev, 2021, 101: 147-176.
Chen Yamei,Zhu Shihao,Liu Tianyuan et al. Epithelial cells activate fibroblasts to promote esophageal cancer development.[J] .Cancer Cell, 2023, 41: 903-918.e8.
Huang Huocong,Wang Zhaoning,Zhang Yuqing et al. Mesothelial cell-derived antigen-presenting cancer-associated fibroblasts induce expansion of regulatory T cells in pancreatic cancer.[J] .Cancer Cell, 2022, 40: 656-673.e7.
Mantovani Alberto,Allavena Paola,Marchesi Federica et al. Macrophages as tools and targets in cancer therapy.[J] .Nat Rev Drug Discov, 2022, 21: 799-820.
Pittet Mikael J,Michielin Olivier,Migliorini Denis,Clinical relevance of tumour-associated macrophages.[J] .Nat Rev Clin Oncol, 2022, 19: 402-421.
Liu Yedan,Zhang Qiming,Xing Baocai et al. Immune phenotypic linkage between colorectal cancer and liver metastasis.[J] .Cancer Cell, 2022, 40: 424-437.e5.
Nagarsheth Nisha,Wicha Max S,Zou Weiping,Chemokines in the cancer microenvironment and their relevance in cancer immunotherapy.[J] .Nat Rev Immunol, 2017, 17: 559-572.
Ozga Aleksandra J,Chow Melvyn T,Luster Andrew D,Chemokines and the immune response to cancer.[J] .Immunity, 2021, 54: 859-874.
Chen Jingqi,Yao Yandan,Gong Chang et al. CCL18 from tumor-associated macrophages promotes breast cancer metastasis via PITPNM3.[J] .Cancer Cell, 2011, 19: 541-55.
Bill Ruben,Wirapati Pratyaksha,Messemaker Marius et al. CXCL9:SPP1 macrophage polarity identifies a network of cellular programs that control human cancers.[J] .Science, 2023, 381: 515-524.
Zilio Serena,Bicciato Silvio,Weed Donald et al. CCR1 and CCR5 mediate cancer-induced myelopoiesis and differentiation of myeloid cells in the tumor.[J] .J Immunother Cancer, 2022, 10: undefined.
Han Junyong,Ye Shixin,Chen Jinyan et al. Lysine-Specific Histone Demethylase 1 Promotes Oncogenesis of the Esophageal Squamous Cell Carcinoma by Upregulating DUSP4.[J] .Biochemistry (Mosc), 2021, 86: 1624-1634.

Tables 1 to 2 are available in the Supplementary Files section

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

MRPL27 as a new prognostic biomarker involved in immune cell infiltration and hepatocellular carcinoma progression

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Results

Expression level of MRPL27 in LIHC

Enrichment Analysis of GO and KEGG Pathways in MRPL27

Expression of MRPL27 at the Single Cell Level in TME

The correlation between MRPL27 expression and immune infiltration

MRPL27 affects the proliferation and invasion of LIHC cells

Discussion

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1