General
Medium-pressure liquid chromatography (Pure C-850 Flash prep®, Buchi, Switzerland) with UV-ELSD detection connected to reversed phase flash columns (Flash pure C18, 40 μm, 4 and 12 g) was used for final purification. Nuclear magnetic resonance (NMR) spectra were recorded on a DRX-600 spectrometer (Bruker Daltonics, USA). ESI-MS spectra were recorded by “Waters” 3100 “USA", TQ Detector (Acquity ultra performance LC), Mass lynx V 4.1.
Drugs, chemicals and kits
Rotenone was obtained from Sigma-Aldrich and it was dissolved in DMSO (dimethyl sulfoxide). Other chemicals and reagents were purchased from Sigma-Aldrich in USA and were of analytical grade. There were five Eliza kits obtained from Sunlong Biotech Co. LTD in this study.
Plant material and botanical identification
The leaves of Pentas lanceolata were collected from Al-Orman Botanical Garden in November 2020, Giza, Egypt. The plants were botanically identified by Treas Labib, Herbarium Section, El-Orman Botanical Garden, Giza, Egypt. The identification was confirmed by Dr Reem Sameer Hamdi, professor of plant taxonomy and Flora, Faculty of Science, Botany department (Cairo University). In our laboratory, a sample of the studied plant is being maintained under the accession number (No. 2020-P.5).
Extraction and isolation of compounds
Figure 1 has shown the design of extraction and isolation of compounds. The extraction was carried out according to the method of Abd-Alla et al. (2022) and the preparation of iridoid-rich fraction (PIRF) has been performed according to our previous work (Fahmy et al., 2020). A brownish-green dry fraction (PIRF, 17.32 g) was stored at 4 °C until use. Part of PIRF (11 g) was subjected to column chromatography (80 cm x 80 mm packed with 320 g silica gel 60-120 mesh Merck) eluted with an elution system of dichloromethane: methanol (9:1) to give rise of two main fractions (A and B). Fraction A (400 mg) rechromatographed on silica gel (22.0 g) using chloroform/methanol as mobile phase. The column was conditioned with chloroform/methanol 9.5:0.5, v/v and the chromatographic run started with 9: 1, v/v mixture. The polarity was gradually increased to finally to 7:3, v/v to afford three subfractions (Fr.A-1 to Fr. A-3). Fr. A-1 (eluted with chloroform/methanol 9:1, v/v) was further subjected to medium pressure liquid chromatography (MPLC) with RP-C18 flash column (4 g) and eluted with MeOH/ H2O gradient to yield compound 1 (eluted with 7% MeOH/H2O, 2 mg)and compound 8 (eluted with 40% MeOH/ H2O, 2.4 mg). Fr. A-2 (eluted with chloroform/methanol 8.5:1.5) was purified by preparative TLC on silica plated with dichloromethane-MeOH- H2O (8:2:0.2) to yield compound 2 (9 mg). Fr. A-3 (chloroform/methanol 8:2) was purified on Sephadex LH-20 and eluted with 50% MeOH/ H2O to afford compound 3 (7.8 mg). Fraction B (150 mg) was purified using medium pressure liquid chromatography (MPLC) with RP-C18 flash column (12 g) and eluted with MeOH/ H2O gradient to yield compound 4 (eluted with 20% MeOH/ H2O 8.0 mg), compound 5 (eluted with 25% MeOH/ H2O, 5.8 mg), compound 6 (eluted with 30% MeOH/ H2O, 20.2 mg) and compound 7 (eluted with 40% MeOH/ H2O, 7.5 mg). All the isolated compounds were identified by direct comparison with standard compounds available in our laboratory and/or comparison with literature data. The design of chemical composition study of iridoids-rich fraction from Pentas lanceolata leaves (PIRF) was illustrated in Fig. 1.
6β,7β-Epoxy-8-epi-splendoside (1): 'H-NMR (600 MHz, CD3OD), δ 7.48 (1H, d, J = 1.5 Hz, H-3), 5.77 (1H, s, H-l), 4.57 (1H, d, J = 7.9 Hz, H-l"), 3.88 (1H, dd, J = 12.0, 2.0 Hz, H-6"a), 3.81 (1H, d, J = 2.6 Hz, H-6), 3.74 (3H, s, -COOMe), 3.68 (1H, d, J = 11.7 Hz, H-10a), 3.65 (1H, dd, J = 12.0, 5.9 Hz, H-6"b), 3.51 (1H, d, J = 2.6 Hz, H-7), 3.48 (1H, d, J = 11.7 Hz, H-10b), 3.23-3.33 (H-5, H-3", H-4", and H-5", overlapped with solvent signal), 3.13 (1H, dd, J = 9.0, 8.1 Hz, H-2"), 2.33 (1H, d, J = 8.8 Hz, H-9); 13C-NMR (150 MHz, CD3OD), δ 168.4 (C-11), 154.2 (C-3), 107.7 (C-4), 99.8 (C-1"), 93.8 (C-1), 80.6 (C-8), 78.4 (C-3"), 77.9 (C-5"), 74.5 (C-2"), 71.6 (C-4"), 65.2 (C-10), 62.8 (C-6"), 60.8 (C-7), 57.9 (C-6), 51.8 (COOMe), 46.4 (C-9), 33.2 (C-5). ESI- MS: m/z 443.11 [M+Na].
Asperulosidic acid (2): 'H-NMR (600 MHz, CD3OD), δ 7.41 (IH, d, J = 1.4 Hz, H-3), 5.98 (IH, d, J = 1.5 Hz, H-7), 4.97 (IH, d, J = 8.9 Hz, H-1), 4.94 (IH, d , J = 15.0 Hz, H-10a), 4.90 (IH, dd , J = 6.0, 1.6 Hz, H-6), 4.81 (IH, d , J = 15.0 Hz, H-10b), 4.72 (IH, d , J = 7.9 Hz, H-l''), 3.83 (1H, dd, J = 12.0, 1.5 Hz, H-6"a), 3.61 (1H, m, H-6"b), 3.23-3.38 (H-2", H-3", H-4", and H-5", overlapped with solvent signal), 3.05 (1H, t, J = 6.9 Hz, H-5), 2.58 (1H, t, J = 8.1 Hz, H-9), 2.09 (3H, s, CH3CO); 13C-NMR (150 MHz, CD3OD), δ 172.6 (CO-Me) 170.3 (C-11), 151.4 (C-3), 146.1 (C-8), 131.7 (C-7), 107.4 (C-4), 100.8 (C-1), 100.5 (C-1"), 78.5 (C-3"), 77.8 (C-5"), 76.1 (C-6), 75.1 (C-2"), 71.6 (C-4"), 64.0 (C-10), 63.0 (C-6"), 46.9 (C-9), 43.8 (C-5), 20.7 (CO-Me). ESI-MS: m/z 455.05 [M+Na]+.
Deacetyl-asperulosidic acid (3): 'H-NMR, (600 MHz, CD3OD), δ 7.61 (1H, s, H-3), 6.02 (IH, d, J = 1.5 Hz, H-7), 5.05 (IH, d, J = 8.9 Hz, H-1), 4.82 (1H, H-6), 4.72 (1H, d, J = 7.9 Hz, H-l"), 4.46 (1H, dd, J = 15.5, 1.1 Hz, H-10a), 4.22 (1H, d, J = 15.5 Hz, H-10b), 3.85 (1H, dd, J = 12.2, 1.8 Hz, H-6"a), 3.62 (1H, dd, J = 12.0, 5.8 Hz, H-6"b), 3.39 (1H, t, J = 8.8, H-5"), 3.22-3.29 (3H, m, H-2", H-3"and H-4"), 3.02 (1H, t, J = 6.6 Hz, H-5), 2.56 (1H, t, J = 7.9 Hz, H-9); 13C-NMR (150 MHz, CD3OD), δ 172.0 (C-11), 154.6 (C-3), 151.5 (C-8), 129.8 (C-7), 109.6 (C-4), 101.4 (C-1), 100.4 (C-1"), 78.5 (C-3"), 77.8 (C-5"), 75.6 (C-6), 75.0 (C-2"), 71.7 (C-4"), 62.9 (C-6"), 61.7 (C-10), 46.0 (C-9), 43.0 (C-5). ESI-MS: m/z 413.28 [M+Na]+.
13R-epi-epoxygaertneroside (4): 'H-NMR (600 MHz, CD3OD) δ 7.55 (1H, d, J = 1.6 Hz, H-3), 7.22 (2H, d, J = 8.6 Hz, H-2', H-6'), 7.04 (1H, d, J = 1.5 Hz, H-10), 6.77 (2H, d, J = 8.6 Hz, H-3', H-5'), 5.40 (1H, d, J = 1.2 Hz, H-13), 5.33 (1H, brs, H-1), 4.54 (1H, d, J = 7.9 Hz, H-1"), 4.03 (1H, d, J = 2.5 Hz, H-7), 3.85 (1H, dd, J = 11.8, 1.2 Hz, H-6"a), 3.77 (3H, s, -COOMe ), 3.70 (1H, m, H-6"b), 3.46 (1H, d, J = 7.6 Hz, H-5), 3.35 (1H, d, J = 2.5 Hz, H-6), 3.12-3.35 (H-2", H-3", H-4", and H-5", overlapped with solvent signal), 2.77 (1H, dd, J = 8.3, 1.1 Hz, H-9); 13C-NMR (150 MHz, CD3OD), δ 171.7 (C-12), 168.0 (C-14), 158.6 (C-4'), 153.9 (C-3), 148.0 (C-10), 140.5 (C-11), 133.0 (C-1'), 129.3 (C-2', C-6'), 116.3 (C-3', C-5'), 108.0 (C-4), 99.6 (C-1"), 92.8 (C-1), 92.6 (C-8), 78.4 (C-3"), 77.8 (C-5"), 74.4 (C-2"), 71.3 (C-4"), 69.6 (C-13), 62.5 (C-6"), 59.2 (C-6), 57.8 (C-7), 51.9 (COOMe), 43.6 (C-9), 33.0 (C-5). ESI- MS: m/z 587.13 [M+Na].
Gaertneroside (5): 'H-NMR (600 MHz, CD3OD) δ 7.51 (1H, d, J = 1.6 Hz, H-3), 7.45 (1H, d, J = 1.3 Hz, H-10), 7.28 (2H, d, J = 8.5 Hz, H-2', H-6'), 6.78 (2H, d, J = 8.5 Hz, H-3', H-5'), 6.47 (1H, dd, J = 5.6, 2.5 Hz, H-6), 5.56 (1H, dd, J = 5.6, 2.2 Hz, H-7), 5.36 (1H, d, J = 1.2 Hz, H-13), 5.15 (1H, d, J = 4.9 Hz, H-1), 4.67 (1H, d, J = 7.9 Hz, H-1"), 3.91 (1H, m, H-5), 3.79 (1H, dd, J = 12.1, 2.2 Hz, H-6"a), 3.75 (3H, s, -COOMe ), 3.69 (1H, m, H-6"b), 3.21-3.38 (H-2", H-3", H-4", and H-5", overlapped with solvent signal), 2.90 (1H, dd, J = 7.6, 4.9 Hz, H-9); 13C-NMR (150 MHz, CD3OD), δ 172.4 (C-12), 168.4 (C-14), 158.6 (C-4'), 152.5 (C-3), 150.1 (C-10), 141.6 (C-6), 137.9 (C-11), 133.2 (C-1'), 129.9 (C-7), 129.6 (C-2', C-6'), 116.3 (C-3', C-5'), 110.9 (C-4), 100.5 (C-1"), 98.0 (C-8), 94.4 (C-1), 78.4 (C-3"), 77.8 (C-5"), 74.4 (C-2"), 70.9 (C-4"), 69.9 (C-13), 62.2 (C-6"), 51.9 (COOMe), 50.8 (C-9), 40.3 (C-5). ESI- MS: m/z 547.14 [M-H]-.
13R-epi-Gaertneroside (6): 'H-NMR (600 MHz, CD3OD) δ 7.48 (1H, d, J = 1.5 Hz, H-3), 7.25 (1H, d, J = 1.3 Hz, H-10), 7.21 (2H, d, J = 8.6 Hz, H-2', H-6'), 6.77 (2H, d ,J = 8.6 Hz, H-3', H-5'), 6.45 (1H, dd, J = 5.6, 2.6 Hz, H-6), 5.47 (1H, dd, J = 5.6, 1.8 Hz, H-7), 5.40 (1H, d, J = 1.0 Hz, H-13), 5.35 (1H, d, J = 3.8 Hz, H-1), 4.65 (1H, d, J = 7.9 Hz, H-1"), 3.90 (1H, m, H-5), 3.88 (1H, dd, J = 11.8, 1.0 Hz, H-6"a), 3.74 (3H, s, -COOMe ), 3.65 (1H, m, H-6"b), 3.36 (1H, m, H-3"), 3.28-3.30 (H-4", and H-5", overlapped with solvent signal), 3.22 (1H, dd, J = 9.2, 8.0 Hz, H-2"), 3.00 (1H, dd, J = 7.9, 3.9 Hz, H-9); 13C-NMR (150 MHz, CD3OD), δ 172.4 (C-12), 168.4 (C-14), 158.5 (C-4'), 152.2 (C-3), 150.5 (C-10), 141.0 (C-6), 137.9 (C-11), 133.2 (C-1'), 130.1 (C-7), 129.2 (C-2', C-6'), 116.3 (C-3', C-5'), 111.4 (C-4), 99.8 (C-1"), 97.9 (C-8), 93.8 (C-1), 78.5 (C-3"), 77.8 (C-5"), 74.5 (C-2"), 71.4 (C-4"), 69.5 (C-13), 62.6 (C-6"), 51.9 (COOMe), 50.6 (C-9), 39.9 (C-5). ESI- MS: m/z 547.14 [M-H]-.
13R-Methoxy-epi-gaertneroside (7): 'H-NMR (600 MHz, CD3OD) δ 7.49 (1H, d, J = 1.3 Hz, H-3), 7.30 (1H, brs, H-10), 7.19 (2H, d, J = 8.5 Hz, H-2', H-6'), 6.77 (2H, d ,J = 8.5 Hz, H-3', H-5'), 6.45 (1H, dd, J = 5.6, 2.5 Hz, H-6), 5.45 (1H, dd, J = 5.6, 1.9 Hz, H-7), 5.34 (1H, d, J = 4.4 Hz, H-1), 4.95 (1H, brs, H-13), 4.67 (1H, d, J = 7.9 Hz, H-1"), 3.90 (1H, m, H-5), 3.86 (1H, m, H-6"a), 3.75 (3H, s, -COOMe ), 3.65 (1H, m, H-6"b), 3.27-3.39 (H-3", H-4",H-5" and -OCH3, overlapped with solvent signal), 3.22 (1H, d, J = 9.0 Hz, H-2"), 2.97 (1H, dd, J = 7.7, 4.4 Hz, H-9); 13C-NMR (150 MHz, CD3OD), δ 172.3 (C-12), 168.4 (C-14), 158.9 (C-4'), 152.4 (C-3), 150.9 (C-10), 141.3 (C-6), 135.8 (C-11), 130.2 (C-1'), 129.9 (C-7), 129.8 (C-2', C-6'), 116.4 (C-3', C-5'), 111.3 (C-4), 99.8 (C-1"), 98.0 (C-8), 93.9 (C-1), 78.9 (C-13), 78.5 (C-3"), 77.8 (C-5"), 74.6 (C-2"), 71.5 (C-4"), 62.8 (C-6"), 57.2 (-OCH3), 51.9 (COOMe), 50.7 (C-9), 40.2 (C-5). ESI- MS: m/z 561.14 [M-H]-.
Kaempferol-3-O-robinobioside (8): 'H-NMR (600 MHz, CD3OD) δ 8.09 (2H, d, J = 8.8 Hz, H-2', 6'), 6.88 (2H, d, J = 8.8 Hz, H-3', 5'), 6.38 (1H, d, J = 1.8Hz, H-6), 6.19 (1H, d, J = 1.8 Hz, H-8), and 5.02 (1H, d, J = 7.8, H-1"), 4.52 (1H, brs, H-1"'), 1.18 (3H, d, J = 6.3, H-6"'). 13C NMR (150 MHz, CD3OD) δ 179.4 (C-4), 167.8 (C-7), 162.9 (C-5), 161.6 (C-4'), 159.1 (C-2), 158.7 (C-9), 135.7 (C-3), 132.4 (C-2', 6'), 122.7 (C-1'), 116.1 (C-3', 5'), 105.7 (C-10), 105.1 (C-1"), 101.9 (C-1"'), 100.5 (C-6), 95.3 (C-8), 75.4 (C-5"), 75.1 (C-3"), 73.9 (C-4"'), 73.0 (C-2''), 72.3 (C-2'''), 72.1 (C-3'''), 70.2 (C-5'''), 69.7 (C-4''), 67.4 (C-6''), 17.91 (C-6'''). ESI-MS m/z: 593.15 [M-H]-
Experimental design of in vitro and in vivo studies
As shown in Figure 2, the experimental design of in vitro and in vivo studies was carried out.
A) In vitro studies on BDNF and NGF
The human colonic epithelial cell line (Caco-2) and human astrocytoma cell (1321N1) were incubated and maintained in Dulbecco's Modified Eagle Medium with high glucose (DMEM) with 10% fetal bovine serum (FBS). The cells were incubated in 24-well plate at a density of 0.5 × 105 cells/well in a humidified atmosphere containing 5% CO2 at 37℃.
At 24 hours after seeding, cells were treated with each sample of PIRF dissolved in dimethyl sulfoxide (DMSO) solution. After 24 hours, cells were collected, and then total RNA was extracted from the cultured cells using PureLink RNA Mini kit (Invitrogen, CA, USA). The cDNA strand was synthesized from 400 ng of total RNA using ReverTra Ace qPCR RT Master Mix (TOYOBO, Osaka, Japan). THUNDERBIRD SYBR qPCR Mix (TOYOBO, Osaka, Japan) was used for quantitative real-time PCR. Real-time PCR was performed using AriaMX Real-time PCR System (Agilent Technologies, CA, USA) under the following conditions: 3 minutes at 95°C, followed by 40 cycles each of 95°C for 3 sec, 60°C for 30 sec. Primers used for amplification were as follows: GTCAAGTTGGGAGCCTGAAATAGTG and AGGATGCTGGTCCAAGTGGTG for BDNF, ACCTTTCTCAGTAGCGGCAA and TGTGTCACCTTGTCAGGGAA for NGF and GGGTCAGAAGGACTCCTATG and GTAACAATGCCATGTTCAAT for β-actin as an internal control. PCR products were analyzed using AriaMx Real-time PCR System Software.
B) Experimental design of the in vivo study
We have 5 groups with 11 male mice in each one: Control group receiving vehicle (DMSO), induced group using rotenone (1.5 mg/kg, three times a week), the last three groups received rotenone together with one of the following oral treatments: L-Dopa (reference drug, 25 mg/kg), 50 mg /kg PIRF, 100 mg /kg PIRF.
Animals
Male mice were divided into groups and housed at constant temperature (25 ± 2 °C), humidity (60 ± 10%), and a 12/12-h light/dark cycle with free access to standard chow diet and water. The investigation in accordance with the Guidelines for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85–23, revised 2011) and was performed in agreement with ethical procedures approved by the Ethics Committee of Safety and Health Committee in NRC (Ethics number: 04420124)
Methodology
Induction of PD
Rotenone-induced PD will be done according to the method of Abdel-Salam et al. (2014). Rotenone will be dissolved in DMSO and given as a solution in a dose of 1.5 mg/kg/day, via the S.C. route, three times per week for 3 weeks, with a total of nine doses. Treatment with L-dopa or PIRF (50 or 100 mg/kg) will be given orally on daily bases for 21 consecutive days starting from the first day of rotenone.
Behavioral study
Three behavioral tests were accomplished 24 hours after the last treatment day to assess motor manifestations in mice, specifically, wire-hanging test, wood-walking test, and stair test.
Wire-hanging test
The wire-hanging test or horizontal bar test is done by hanging the mice by their forelimbs from a steel rod, 25 cm long and 0.2 cm in diameter, placed 25 cm above the bench. The latency time, the time each mouse could stay hanging itself suspended from the rod, will be recorded for three trials with a cut-off time of 60 s.
Wood-walking test
Mice are allowed to walk all along a wooden stick, 1 m long and 1 cm thick, and the time spent by each mouse to reach the end of the stick is recorded for three trials for each mouse to assess motor coordination.
Stair test
The stair test aims to assess skilled motor coordination. Briefly, each mouse will put in the bottom of a wooden stair, placed at an angle of 55 °C from the experimental bench. Then record the time spent by each mouse climbing the stair three times for each mouse.
Tissue sampling
At the end of behavioral tests, mice were anesthetized using urethane and killed by cervical dislocation. The brains were rapidly separated, and the right and left striata are detached and kept on ice and kept at −80 °C for further handling. 5 brains are collected from 5 mice in each group and the right striatum is homogenized in phosphate buffered saline (PBS; 0.1 M, pH = 7.4) to prepare 20% homogenate using a homogenizer (yellow line, DI18 basic, Germany), then centrifuged at 1000 xg at 4 °C for 15 min using a cooling centrifuge (Sigma 3-30 k, USA), and the supernatant was kept at −80 °C for further colorimetric assay of antioxidants. The left striatum of each mouse is homogenized in ice-cold saline to prepare 25% w/v homogenate, then centrifuged at 1000 xg for 20 min. at 4 °C, and stored at −80 °C for additional ELISA of TNF-α, IL-1β, Ach E, β- amyloid and MCP-1. Then three brains from each group were homogenized in methanol (HPLC grade), then centrifuged and the supernatant was kept at -80 for determination of dopamine level using HPLC technique. Alternatively, the rest three brains are separately immersed in 10% formalin solution in normal saline in well-sealed containers and kept for histopathological investigation after tissue hardening.
Biochemical parameters
Determination of reduced glutathione (GSH content)
Briefly, DTNB (5,5’-dithiobis (2-nitrobenzoic acid) or Ellman´s reagent is reduced by the free sulfhydryl group on GSH molecule to generate 5- thio-2-nitrobenzoic acid which has yellow color and can be determined by reading absorbance at 412 nm (Ellman,1959)
Determination of lipid peroxidation (MDA content)
Malondialdehyde (MDA), an end product of lipid peroxidation was measured according to the method described previously (Nair et al., 1984). Thiobarbituric acid reactive substances (TBAS) react with thiobarbituric acid-forming TBA-MDA adduct and the absorbance is read at l532 nm using a spectrophotometer.
Determination of nitric oxide (NO content)
Nitric oxide was measured using Griess reagent according to the literature (Moshage et al., 1995). Nitrate is converted to nitrite by nitrate reductase. Griess reagent then converts nitrite to a deep purple azo compound. The absorbance is read at l 540 nm using a spectrophotometer. Nitrite, a stable end-product of nitric oxide radical, is mostly used as an indicator for the production of nitric oxide.
ELISA of TNF-α, IL-1 β, AchE, β- amyloid and MCP-1
Estimation of striatal TNF-α, IL-1, AchE, β- amyloid and MCP-1 were performed using ELISA technique by test kits obtained from Sunlong Biotech Co. LTD with the following catalogue number: SL0722Ra, SL0402RA, SL0027Ra, SL1392Ra, SL0497Ra according to manufacturer instructions based on the sandwich principle by the aid of ELISA reader (Model Spectra Max Plus-384 Absorbance Microplate Reader, USA).
Determination of dopamine content
Dopamine was analyzed in brain supernatant using Dionex Ultimate 3000 UHPLC (Thermo Scientific, USA). The separation was carried out on Zorbax Eclipse XDB C18 (4.6X150 mm, 5µm). The mobile phase was phosphate buffer (pH, 3.0): methanol (80:20, v/v) at flow rate 0.5 ml/min. The detection wavelength was 270 nm.
Histopathological study
Tissues are hardened for at least 7 days; striata sections will be prepared and stained according to the earlier described method by Bancroft and Steven (1983). Briefly, the hardened sections are washed with water for 1 h, dehydrated in graded concentrations of ethanol, and then cleared in xylene. The cleared specimens are then embedded in melted paraffin wax and dried in an oven at 70 °C for 4–6 h. Tissue sections, 3–5 μm thick, are prepared by rotary microtome and stained by the routine hematoxylin and eosin (H and E) stain.
Statistical analysis
Data are expressed as means ± SEM (standard error of the mean), and statistical analysis were done using one-way analysis of variance (ANOVA) test, followed by Tukey-Kramer post hoc test to compare all means pairwise, by the aid of statistical package for social sciences (SPSS) computer software version 22 (SPSS Inc., Chicago, USA). Differences between mean values will be considered statistically significant at p < 0.05.