1) Participants
In this study, 19 neurosyphilis (NS) patients and 13 syphilis non-NS patients were diagnosed in the Department of dermatology, Beijing Youan Hospital between 2015 and 2018. We recorded the medical history, neurological symptoms and signs, and serum and CSF laboratory testing results. According to the guidelines of NS in the USA, Europe, and related literatures[20–22], the criteria for the diagnosis of NS in our study included neurological symptoms with positive syphilis serologies and one or more of the following: (a) positive CSF rapid plasma regain (RPR); (b) positive CSF Treponema pallidum particle agglutination (TPPA) and fluorescent treponemal antibody absorption (FTA-ABS), with increased CSF protein (> 45 mg/dL) or elevated CSF leukocytes (> 5 WBCs/mm3) in absence of other known causes of these abnormalities. The patients enrolled in the syphilis non-NS group had a serofast status and underwent lumber punctures to rule out neurosyphilis.
The exclusion criteria were as follows: other infectious diseases, neurodegenerative diseases, and autoimmune diseases.
This study was approved by the Beijing Youan Hospital Research Ethics Committee (LL-2022-032-K). Written informed consent was obtained from all participants.
2) Cell Culture and treatment
The human microglial cell line (HMO6) was acquired from the American Type Culture Collection (Manassas, USA). HMO6 cells were grown in Dulbecco's modified Eagle's medium (DMEM, HyClone, Logan, Utah, USA) with high glucose supplemented with 10% heat-inactivated fetal bovine serum (Gibco, SV30087.02) and 1% penicillin/streptomycin (Sigma, P4333). Cells were cultured in a 5% CO2-humidified atmosphere at 37°C.
Recombinant T. pallidum Tp47 protein was purchased from Novoprotein (Shanghai, China). LAL test was used to detect endotoxins in the rTp47 preparation, which was found to have < 0.05 endotoxin units (EUs)/ml. Lipopolysaccharide (LPS) was purchased from Sigma-Aldrich (St. Louis, USA). The cells used for the tests were assessed for viability using trypan blue (Sigma) under an Olympus (USA) microscope; only cells with > 95% viability were used in the experiments. Cells were treated with various concentrations of rTp47 (1, 3, and 10 µg/mL), LPS (1µg/mL), and PBS treatment were set as positive and negative controls[23].
3) Flow cytometry
HMO6 cells were seeded at a density of 1 × 105 cells/well into 24-well plates and incubated for 24 h. Then, cells were treated with different doses of rTp47 (1, 3, and 10 µg/mL), LPS (1µg/mL), and PBS for 24 h. The cells were collected and washed twice with PBS, suspended in binding buffer, and incubated with FITC Annexin V pyroptosis Detection Kit (BioLegend, 640922) for staining at room temperature for 15 min in the dark. For surface expression analysis, HMO6 cells were stained at 4°C for 30 min with human/mouse APC-conjugated anti-TREM2 (FAB17291A; R&D Systems). Cells were detected on FACSCanto II flow cytometer, and data analysis was performed using the FlowJo V10 software (BD Biosciences, USA).
4) Western Blot
Cells were plated in 10-cm dishes and treated with rTp47(1, 3, and 10 µg/mL), LPS (1µg/mL), and PBS for 24 h. Then, cells were collected after 24 h for WB analysis. Briefly, protein concentration was measured by the BCA (bicinchoninic acid, BCA) Protein Assay Kit (Beyotime, P0010, Shanghai, China). The proteins were separated by 10% SDS-PAGE and then subsequently transferred to PVDF membranes (Merck Millipore, ISEQ00010, USA). After blocking with 5% skim milk, the membranes were then incubated at 4°C overnight with the following primary antibodies: NLRP3 (dilution:1:1000, Rockland, America), caspase-1 (dilution:1:1000, Rockland, America), TREM2 (dilution:1:1000, Rockland, America), IL-1β (dilution:1:1000, Rockland, America), GAPDH (dilution:1:1000, Rockland, America). After washing with TBST three times, the membranes were incubated with horseradish peroxidase-coupled secondary antibody (dilution:1:2000, Rockland, America) for 2 h at room temperature. The immunoreactivity was detected using enhanced chemiluminescence (ECL Advance Kit, Biyotime, China) and visualized using Image Lab software (Bio-Rad Laboratories, Hercules, CA). The relative levels of protein were normalized by the ratio of target protein to GAPDH.
5) Quantitative Real-Time PCR
Total RNA from human CSF and HMO6 cells was extracted by using the TRIzol reagent (Ambion, USA). 1 µg of total RNA was reverse-transcribed into cDNA using a Reverse Transcription Kit (Takara, Japan), followed by amplification of the cDNA using the SYBR Green Master Mix (Takara, Japan). We analyzed three replicates for each sample, on Applied 21 Biosystems 7500 (Life Technologies Corporations, Carlsbad, CA, USA). The PCR reaction conditions were as follows: pre-denaturation at 95°C for 30 seconds, followed by 40 cycles of 5 seconds at 95°C and 34 seconds at 60°C. The relative expression of the target genes was evaluated using the 2−∆∆Ct method and normalized to the amount of endogenous control (GAPDH). The specific primer sequences are in (Table 1).
Table 1
Primers used for qRT⁃PCR in this study.
Gene | 5′-3′ |
TREM2 | Forward: TTACTCTTTGTCACAGAGCTGT |
Reverse: CAGTGCTTCATGGAGTCATAG |
NLRP3 | Forward: AACAGCCACCTCACTTCCAG |
Reverse: CCAACCACAATCTCCGAATG |
Caspase-1 | Forward: CCGTGGAGAGAAACAAGGAGT |
Reverse: CCCCTGACAGGATGTCTCCA |
IL-1β: | Forward: GCCCATCCTCTGTGACTCAT |
Reverse: AGGCCACAGGTATTTTGTC |
GAPDH | Forward: GAAGGTGAAGGTCGGAGTC |
Reverse: GAAGATGGTGATGGGATTTC |
6) Enzyme-Linked Immunosorbent Assay (ELISA)
The levels of IL-1β (U-CyTech BV, CT526A, Holland) TNF-α, IL-10, TGF-β (Invitrogen, Carlsbad, CA), and sTREM2 (RayBiotech, ELH-TREM2-1, USA) in CSF of NS patients or syphilis non-NS patients and cell supernatant were quantified by ELISA using commercial kits. All testing was performed according to the manufacturer's instructions. The optical density was measured at 450 nm using the Synergy H1 microplate reader.
7) Generation of CRISPR/Cas9-Mediated Knockout (KO) Cell Line
Retroviral plasmids pLV-hU6-TREM2 sgRNA01(Human)-gRNA (The pHS-ACR-0404 Backbone-EFS-hCas9-2A-Puro, Beijing Syngenbio Co., LTD.) was used. CRISPR/Cas9-mediated gene editing was targeting human TREM2 in HMO6 cells. According to the manufacturer’s instructions, plasmids were transfected with Attractene Transfection Reagent (QIAGEN, Beijing, China, Catalog No. 301004). After 72 h, the transduced cells were selected using puromycin (1 µg/mL) and analyzed by Western blotting to verify deletion of TREM2. For the rTp47 treatment experiment, KO cells were treated with rTp47 at 10 µg/ml for 24 h.
8) Co-immunoprecipitation
HMO6 cells (108) were collected and lysed with RIPA lysis buffer (1% NP-40 and 0.25% deoxycholate) (Beyotime, P0013D, Beijing, China) containing 1 mM phenylmethylsulfonyl fluoride (PMSF) (Beyotime, ST505, Beijing, China). Then, 30 µg of protein was added to 500 µl of RIPA lysis buffer, and 1µg of the anti-TREM2 antibody (Cell Signaling Technology, 91068T, USA) and 1µg of normal rabbit IgG (Santa Cruz Biotechnology, sc-2026, Texas, USA) were added. Then, 30 µL of protein A/G beads (SMRRT, SA032005, Changzhou, China) was added to the protein-antibody mixture and incubated at 4°C overnight. After incubation, the samples were centrifuged at 2500 rpm for 4 min at 4°C and washed three times with RIPA lysis buffer. Next, the supernatant was removed, and 30µL of 2× loading buffer was added and boiled for 10 min. The boiled samples were separated by 10% SDS-PAGE for western blot analysis using NLRP3 (Rockland, 600-401-R14, USA) and TREM2 antibodies, and these immunoblot results were indicated as the IB (immunoblot) group. The 5% cell lysate was used as an input control (5% input), and it was blotted and analyzed with NLRP3, TREM2 and GAPDH antibodies.
9) Statistical Analyses
Statistical analysis was performed using SPSS21.0, and figures were created by GraphPad Prism8 (GraphPad, San Diego, CA). Continuous data were compared with the non-parametric Mann-Whitney U-test when the data were non-parametric or independent two-sample t-test when the data were parametric. One-way ANOVA was used to compare three or more group means with one independent variable. Two-way ANOVA was used to compare three or more group means with two independent variables. Post hoc comparisons were performed using Tukey's test. A two-sided P value < 0.05 was considered statistically significant.