2.1. Primary cell culture and subculture
Blunt snout bream (20-25g) was obtained from the Bream Genetics and Breeding Center (BGBC) of Shanghai Ocean University. All the experiments were performed according to the Guidelines for the Humane Treatment of Laboratory Animals formulated by the Ministry of Science and Technology of the People’s Republic of China. Fish were anesthetized with MS-222 and then wiped with 75% alcohol. After disinfection with 70% alcohol, the tissues were rinsed with D-PBS containing 8% antibiotics (Solarbio, Beijing, China). The plants were cut into blocks, transferred to a culture bottle, complete culture medium was added, and the cells were incubated at 28°C (Gong et al. 2023). After 35 d of primary culture, the bottom of the 90% culture flask was covered with a monolayer of cells. The cells were digested with trypsin solution and subcultured at a 1:1 ratio. (Fan et al. 2017). The solution was passed on every 2 days. In this study, the primary medium consisted of M199 supplemented with 8% triple antibody, and 20% FBS (Gibco, 10,099,141). Subculturing was performed based on the M199 culture medium supplemented with 1% triple antibody and 15% fetal bovine serum.
2.2. Cryopreservation and recovery
After the MAG cells were stable, they were rinsed twice with D-PBS rinse solution, digested with an appropriate amount of trypsin, centrifuged and collected with 1 ml of serum-free cell cryopreservation solution (NCM, Suzhou, China) and frozen in a -80°C freezer. Two months later, the frozen cells were subsequently warmed in a 37°C water bath and incubated in 25 cm2 cell culture bottle for recovery. After 24 h, the survival of the cells was observed, and the culture medium was changed to continue the culture (Abdel-Tawwab et al. 2019; Xu et al. 2021).
2.3. Authentication of cell lines
To determine the source of the established cell line, 16S rRNA and the cytochrome oxidase I (COI) gene sequence analysis was carried out (Wang et al. 2023). 16S-F ATTACCCTGAAACTCAGAGCAT 16S-R: ACCAGCAAACAAACACAGGA and COI-F: ACCCCCCTAGAGGAGCCTGTT COI-R: GAGAGTGACGGGCGGT GTGT were used to amplify16S rRNA (GenBank accession: 125249013) and COI (GenBank accession: no. EF543084.1) gene-specific fragments by using reagent kits (Omega Bio-Tek, Inc. Norcross, GA, USA) to extract DNA from MAG cells and the gill of blunt snout bream tissue. The PCR amplification procedure was as follows: 94°C, 5 min; 30 s at 94°C, 30 s at 60°C, 30 s at 72°C, 35 cycles; and 10 min at 72°C amplification and 1.2% agarose gel electrophoresis. The PCR products were subsequently sequenced via Sanger sequencing (Sheng Gong, Shanghai).
Stable 17th generation MAG cells were cultured in 25 cm2 culture bottle. Colchicine (Beyotime, Nantong, China) was added at a final concentration of 1 µg/mL for 8 h. The culture mixture was washed off, and after digestion, the mixture was centrifuged at 1500 r/min for 5 min. The supernatant was removed, and the cells were suspended in 5 mL of 0.075 mol/L KCl solution for 30 min at 37°C. Subsequently, the cells were fixed three times with Carnoy’s fixative (methanol: glacial acetic acid at 3:1) for 15 min each time using the cold droplet method. After drying, the cells were stained with 10% Giemsa dye for 25 min. Finally, the chromosomes were observed under an optical microscope (Nikon, Japan), and 100 midterm cells were counted (Pan et al. 2021).
2.4. Determination of the optimal cell culture conditions and transfection
The MAG cells were plated into two 6-well plates to evaluate the impact of different FBS concentrations and culture media on cell growth rates. After achieving stable growth, the cells were cultured in M199, L-15, L1640 and DMEM supplemented with 15% FBS to assess the influence of the various culture media on the MAG cells. Concurrently, using M199 as the base medium, cells from the 17th passage were cultured with increasing serum concentrations of 5%, 10%, 15%, and 20% to determine the optimal serum concentration. The initial seeding density of the MAG cells was 1*104 cells/ml, and the culture medium was replaced with fresh medium every 3 d. After 7 d, cell counting was performed using a hemocytometer, and the cell doubling time was calculated. Based on the Formula:\({T}_{2}=\left(t-{t}_{0}\right)/{{log}}_{2}\left(\varDelta N/{N}_{0}+1\right)\), the cell doubling time was calculated, where t −t0 is the culture time in hours, N is the number of harvested cells, and N0 is the number of cells in the initial seeding (Cholewa et al. 2011; Gong et al. 2023).
To evaluate the transfection potential of MAG cells, in the 17th generation, LipofectamineTM2000 transfection reagent (Thermo Fisher Scientific, America) was used to transfect the pEGFP-N1 plasmid expressing the green fluorescent protein (GFP) gene into MAG cells. The fluorescence of the transfected cells was observed under an inverted fluorescence microscope (DMi3000, Leica) (Wei et al. 2022).
2.5. Cell morphological analysis under hypoxia
The 17th passage of stably growing MAG cells were seeded into regular culture dishes and confocal culture dishes for enzyme activity determination sampling and laser confocal microscopy imaging under hypoxic conditions. The MAG cells were subjected to hypoxia treatment with 1% O2 and 99% N2 (HF100, Likang, China) at 0 h, 12 h, and 24 h and reoxygenation treatment for 24 h (the experiment was repeated three times). The tissue samples for enzyme activity determination were immediately frozen in liquid N2 and subsequently stored at − 80°C. The cells were subjected to hypoxic stress, and their growth was observed under an inverted fluorescence microscope (DMi3000, Leica).
2.6. Determination of mitochondrial and cell membrane potential
After discarding the cell culture medium from hypoxia-treated MAG cells and washing with PBS, Annexin V-FITC and Annexin V-FITC were added to determine apoptotic signals. After thorough mixing, MitoTracker Red CMXRos staining solution and Hoechst 33342 staining solution were added to observe changes in the internal state of mitochondria and nuclear morphology. The cells were then incubated in the dark for 20–30 minutes at a low temperature (1–4°C) and stored in the dark. An assay kit (Beyotime, Nantong, China) and laser confocal microscope (Leica TCS SP8, Germany) were used.
2.7. Measurement of intracellular ROS
DCFH-DA (1:1000) was diluted with M199 culture medium and added to hypoxia-treated MAG cells at 37°C in a cell culture incubator to incubate for 20 minutes. Then, the cells were washed three times with M199 culture medium to thoroughly remove unentered DCFH-DA. Laser confocal microscopy was used for observation. An assay kit (Beyotime, Nantong, China) and laser confocal microscope (Leica TCS SP8, Germany) were used.
2.8. Antioxidant enzyme activity
MAG cells subjected to hypoxia were cultured, and tissue homogenates were prepared using physiological saline. The homogenate was centrifuged at 3000 rpm for 5 minutes, after which three parallel supernatants were combined for enzyme activity determination. Each measurement was repeated three times to ensure accuracy. An assay kit (Nanjing Jiancheng Biochemical Company, Nanjing, China) and a full-wavelength enzyme labeling instrument were used for the analysis of total protein, catalase (CAT), and superoxide dismutase (SOD) activity, GSH content, LDH content, and antioxidant anion content in MAG cells sample.
2.9. Statistical analysis
The data were collated and analyzed with Excel 2010 (Microsoft Corp. Redmond, WA, USA), and SPSS 25.0 (IBM Corp. Armonk, NY, USA) was used to analyze the data. The results are reported as the mean ± standard error (mean ± SE). Significant differences between groups were determined by the t-test based on one-way analysis of variance (ANOVA). P < 0.05 indicated a statistically significant difference. Graphs were created using GraphPad Prism 9.5 (GraphPad Software, San Diego, CA, USA).