Datasets
The clinical pathological information from 1255 breast cancer patients treated at the Breast and Thyroid Surgery Department of Wuhan University People's Hospital between 2008 and 2016. RNA-sequencing expression matrix and clinical information of breast cancer samples and para-cancerous tissues were downloaded from the Cancer Genome Atlas (TCGA) database on UCSC Xena (https://xena.ucsc.edu/). Two additional independent datasets (GSE20685 and GSE58812) and single-cell RNA-seq data and bulk RNA-seq data 24 breast tumors (GSE176078) were obtained from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). Aging-related genes were collected from SenMayo (https://genomics.senescence.info/cells/), cell age (https://genomics.senescence.info/cells/), SeneQuest (http://Senequest.net), and the aging atlas (https://ngdc.cncb.ac.cn/aging/index). Somatic mutation data were downloaded from the Genomic Data Commons (GDC) (https://portal.gdc.cancer.gov/). The somatic mutation data, sorted in the form of Mutation Annotation Format (MAF), were analyzed and used to calculate the Tumor Mutation Burden (TMB) using the R package maftools.
Construction and validation of a aging-related prognostic signature
To identify genes associated with aging and construct a prognostic signature, we conducted two types of regression analyses: univariate Cox -LASSO regression. Through this analysis, we were able to identify 19 genes: MTHFD2, EIF4EBP1, SDC1, RAD54B, LIMCH1, CAB39L, ULBP2, CACNA1H, WT1, GATA4, SYT1, ELOVL2, DOK7, S100B, BCL2A1, IFNG, FOXE1, MAP2K6. These genes were used to develop an aging-related prognostic model based on these genes. To categorize breast cancer patients, we calculated the risk score for each patient in the training set using the following formula:
Risk score = ∑ni = ∑(Coefi*xi)
The cancer patients were classified into high-risk and low-risk groups based on the median of their risk scores. The R package survivalROC was utilized to estimate the predictive sensitivity of the risk score. The efficacy of the model was assessed in the validation set using the same coefficient and cutoff values that were employed in the training set.
Biological functional analysis between high/low-risk group patients
The DESeq2 R package was utilized to analyze differentially expressed genes (DEGs). DEGs were identified using a cutoff of an adjusted p-value of less than 0.05 and a fold change of |Log2| greater than 1. Gene set enrichment analysis (GSEA) was conducted using the clusterProfiler R package. Fisher's exact test was employed to determine significant indicators, with a false discovery rate (FDR)-corrected p-value threshold of less than 0.05. Single-sample gene set enrichment analysis was performed using the GSVA R package. Gene signatures of recurrent cancer cell states were obtained from a previous study.
Cell culture
We generated the B16F10/MC38-MTHFD2 cell line through knockdown experiments in B16F10/MC38 cells. We targeted two sites of the MTHFD2 gene and obtained two knockdown cell lines, which we named B16F10/MC38-MTHFD2 sh1 and B16F10/MC38-MTHFD2 sh2, respectively. For our knockdown experiments, we used B16F10/MC38-NC as the negative control. All cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37°C in 5% CO2. The shRNA sequences are listed below:
MTHFD2-sh1: GCTCATGAAGAACACCATTAT
MTHFD2-sh2: CGGTCATCGATGTGGGAATAA
Stable cell line generation
To generate stable shRNA knockdown cells, lentiviruses were generated in 293T using the PLKO.1 lentivirus packaging system with gene-specific shRNAs. After 48 hours of lentivirus production, the media was collected and cell debris was removed using a 0.45 um microfiltration membrane. The lentivirus was immediately added to cells in a 6-well dish, along with 2 µg/ml polybrene. The cells were then diluted 1/20 and transferred to a 10 cm2 dish 24 hours after transduction. They were subsequently treated with puromycin (4 µg/ml for DLD-1 and 1 µg/ml for SH-SY5Y) until single-cell colonies could be isolated and analyzed by RT-qPCR to confirm knockdown.
Cell Proliferation Assays
CCK-8 (beyotime, Cell Counting Kit-8) was added to complete culture medium of the same volume, cultured for the same duration as the experimental group, and the absorbance at 450nm was measured together. Cells in logarithmic growth phase with good condition were selected to prepare cell suspension and counted. Approximately 100µl of cell suspension was seeded per well based on appropriate cell seeding density, with 4–6 replicate wells per group. The culture plate was pre-incubated in a cell culture incubator (37°C, 5% CO2) for 12–24 hours to allow cells to reach the logarithmic growth phase. 10µl of CCK-8 reagent was added to each well. The culture plate was returned to the cell culture incubator and further incubated for 0.5-4 hours. The absorbance at 450nm wavelength (OD value) was measured using a microplate reader. The experiment was repeated three times, and the average of the experimental results was taken as the final experimental result. Cell viability (%) = [(As-Ab) / (Ac-Ab)] × 100%; As: Absorbance of the experimental group (including cells, culture medium, CCK-8 solution, and drug solution); Ac: Absorbance of the control group (including cells, culture medium, CCK-8 solution, without drug); Ab: Absorbance of the blank group (including culture medium, CCK-8 solution, without cells or drug).
RNA isolation and Real-time PCR
Total RNA was extracted from the samples using TRIzol (Vazyme, Shanghai), following the instructions provided by the manufacturer. Subsequently, cDNA was synthesized using the Reverse Transcript Kit (Vazyme). Real-time PCR was then carried out in triplicate using the SYBR Green Master Mixture (Vazyme) on the Real-time PCR Detection System (Roche). Quantification was determined based on the cycle threshold (Ct) value and calculated using the 2-ΔΔCt method. The primer sequences are listed below:
MTHFD2-forward: ACTCCCAGAGCACATTGATG
MTHFD2-reverse: CCAGCCACTACCACATTCTT
VEGF-forward: TCAAACCTCACCAAAGCCAG
VEGF-reverse: TCTGAACAAGGCTCACAGTG
P21-forward: ACATCTCAGGGCCGAAAAC
P21-reverse: TGGAGACTGGGAGAGGG
Preparation of cells for flow cytometry
Cells were seeded according to experimental requirements, and cells were harvested when they reached the desired density. The original culture medium was collected into centrifuge tubes, 1× trypsin digestion was added, and digestion was stopped by adding the original culture medium after the specified time, followed by centrifugation. The supernatant was removed, and the cells were resuspended in 1ml pre-chilled PBS buffer and transferred to 1.5ml Eppendorf tubes, then centrifuged at 4°C, 1000g for 5 minutes. The supernatant was removed, leaving approximately 50µl, gently tapping the bottom of the tube to loosely separate the cells. The dispersed cell suspension was added to 1ml pre-chilled 70% ethanol, gently mixed by pipetting, and fixed at 4°C for at least 4 hours in the refrigerator. The fixed cells were removed, centrifuged at 4°C, 1000g for 5 minutes, the supernatant was removed, 1ml pre-chilled PBS buffer was added to resuspend the cells, followed by centrifugation, removal of the supernatant, leaving 50µl PBS buffer, and gently tapping the tube bottom to separate the cells. Dye preparation: Dyes were prepared according to the instructions based on the number of samples, with the entire process conducted in the dark. 500µl propidium iodide staining solution was added to each sample tube, mixed slowly with a pipette gun, incubated in the dark at 37°C for 30 minutes, after completion, data was saved using a flow cytometer, and subsequent processing was carried out.
Western blot analysis
We electrophoresed equal amounts of lysates, ranging from 30 to 50 µg, onto polyvinylidene difluoride membranes. Subsequently, the membranes were blocked using PBST with 5% milk and probed with primary antibodies, specifically Actin (1:3000; Proteintech, P62736), and P21 (1:1000, Proteintech, P63000), overnight at 4°C. After washing thrice with PBST, the membranes were incubated for 1 h at room temperature with secondary antibodies, including goat anti-rabbit IgG-HRP (1:4000, Proteintech, SA00001-2) and goat anti-mouse IgG-HRP (1:2000, Proteintech, SA00001-1).
Flow cytometry
The stained cells were analyzed and sorted based on DNA-A and DNA-W of the Sytox Green fluorescence signal, as well as FSC and SSC light scattering. The analysis was conducted using an LSRII flow cytometer (Becton Dickinson, San Jose, CA, U.S.A.) with an excitation wavelength of 488 nm. The cells were sorted using a FACS Digital Vantage PE flow cytometer (Becton Dickinson) with the same excitation wavelength. The selected channels are as follows: Alexa Fluor™488: Excitation at 488 nm, emission collected in the 530/30 band; PI (Propidium Iodide): Excitation at 561 nm, emission collected in the 610/20 band.
Animal experimentation
Seven-week-old male wild-type C57BL/6 mice were kept in a controlled environment with a 12-hour light/dark cycle, ensuring a consistent temperature and pathogen-free conditions. They had free access to food and water. The mice were sacrificed either when the tumor size reached 200 mm2 or when clear signs of discomfort were observed, in accordance with the guidelines established by the Institutional Animal Care and Use Committee of Tongji University Cancer Center, Shanghai Tenth People's Hospital, School of Medicine, Tongji University.
Statistical analysis
This study independently repeated all experiments three times or more, and all data were analyzed using GraphPad Prism 8. The data are presented as mean ± SEM. Statistical differences were tested using one-way ANOVA. A significance level of P < 0.05 indicates statistical significance. In the figures, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, and "ns" indicates no statistical significance.