HDAC inhibitors modulate Hippo pathway signaling in hormone positive breast cancer

doi:10.21203/rs.3.rs-4354853/v1

Download PDF

Research Article

HDAC inhibitors modulate Hippo pathway signaling in hormone positive breast cancer

https://doi.org/10.21203/rs.3.rs-4354853/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Breast cancer has constantly been the leading causes of death in women, and hormone receptor (HR) positive, HER2 negative is the majority subtype. Histone deacetylase (HDAC) inhibitors have shown clinical benefit in HR (+) breast cancer patients. The hippo pathway proteins YAP/TAZ are often viewed as pro-tumorigenic, however, recent studies support a role of YAP as a tumor suppressor in HR (+) breast cancer downregulation of estrogen receptor (ER) expression. Few studies have investigated the link between HDACi and the Hippo pathway. In our study, we demonstrate that HDAC inhibitors induce transcriptional down-regulation of YAP expression, while conversely activating a TEAD mediated transcriptional program with upregulation of canonical Hippo pathway genes. We further identified 4 Hippo canonical genes (CCDC80, GADD45A, F3, TGFB2) that were upregulated by HDAC inhibitors and associated with significantly improved survival in a HR (+) breast cancer cohort. Patients with high CCDC80 or GADD45A expression had significantly better survival outcomes compared to patients with low expression. Our study provides a novel mechanism of action for the clinical benefit of HDAC inhibitors, while providing further experimental support that Hippo-TEAD transcriptional activation is associated with better outcomes in HR (+) breast cancer.

Breast cancer has constantly been the leading causes of death in women(1, 2), of which the hormone positive (HR(+)) subtype consists of the majority (~ 70%) (3). Treatment concept for HR(+) metastatic breast cancer (mBC) currently consists of endocrine therapy (tamoxifen, fulvestrant, aromatase inhibitors) in addition to targeted therapies (CDK4/6 inhibitors(4–6), PI3K/AKT/mTOR inhibitors(7–9), and histone deacetylase (HDAC) inhibitors (10)), ongoing investigational modalities that including SERCAs (selective estrogen receptor covalent antagonist)(11), CDK7 inhibitors(12), CERANs (complete estrogen receptor antagonists)(13) and others. With the expanding portfolio of molecular based agents, treatment for HR (+) mBC have improved significantly since the past decade, although still a far cry from curing this metastatic disease.

Histone deacetylases (HDACs) play a fundamental role in epigenetic modulation of gene expression. Class 1 HDACs inhibit gene transcription by regulating chromatin accessibility, and forms the core regulatory subunits for gene suppression, including the CoREST, NuRD, Sin3 complexes (containing HDAC1 and HDAC2), and NCoR complex containing HDAC3(14). HDAC inhibitors (HDACi) including vorinostat (SAHA), belinostat (PDX101), romidepsin and panobinostat (LBH589) have been approved by the FDA for hematological cancers (15–17). In a phase III clinical trial for HR(+)HER2(-) metastatic breast cancer, the addition of the class I HDACi tucidonistat (chidamide) to aromatase inhibitors demonstrated improved survival (18). The above clinical results suggest that HDACi may have promising activities in HR (+) breast cancer that warrant further research to realize the maximal therapeutic benefit.

The Hippo pathway is a fundamentally important pathway that governs multiple essential biological functions in cell biology. This includes cell proliferation, organ size, contact inhibition, as well as increasingly reported roles in cancer (19). Disruption of the Hippo pathway drives carcinogenesis in animal models (20) and in human cancer (comprehensively reviewed in (21)). The canonical Hippo pathway signaling pathway is composed of a phosphorylation cascade including kinases MST1/2, MAP kinases, and LATS1/2 (22), which regulates Yes-associated protein (YAP) and its transcriptional coactivator with PDZ-binding motif (TAZ; also known as WWTR1). YAP and TAZ, well established major effector proteins of the Hippo pathway (23), can mobilize intranuclearly and binds the transcription factor TEAD, resulting in downstream activation of CTGF, CYR61, ANKRD and others (24). YAP/TAZ are generally recognized as oncoproteins and linked to increased oncogenic potential and aggressiveness (25–32), although studies have reported tumor suppressor roles as well(33).

The role of Hippo pathway in epigenetic control of estrogen signaling in HR (+) breast cancer is a topic of intense research. A seminal paper reported LATS1/2 facilitated ESR1 ubiquitination, and LATS1/2 inhibition resulted in YAP/TAZ/ERα (ESR1) activation in HR(+) breast cancer with increased oncogenicity (34). A conflicting study was recently published showing that LATS1/2 are required to maintain ESR1 expression, and genetic deletion of LATS1/2 stabilizes YAP expression, which in turn facilitates VGLL3-TEAD signaling to decreases ESR1 in breast cancer (35). Since ESR1 was associated with increased tumorigenicity and unfavorable prognosis in HR(+) breast cancer (36, 37), YAP therefore seems to play a role as a tumor suppressor in this context (35). Other recent studies also show LATS1/2 as a tumor promoting role in breast cancer (33, 38). At this point, it remains inconclusive whether the canonical hippo pathway signaling of LATS-YAP/TAZ is tumor promoting or suppressing in breast cancer. As studies accumulate rapidly in the Hippo research field, growing evidence suggest a context dependent different roles of the hippo pathway in cancer (39), requiring additional studies for a concrete conclusion.

The aforementioned study that linked YAP signaling to ESR1 suppression(35) demonstrated that YAP-TEAD activation resulting from LATS1/2 knockout increased VGLL3 expression, which in turn recruited NCOR2 repression complex to silence ESR1 expression. The authors also discovered HDACi including entinostat, TSA, and others, increased VGLL3 expression resulting in ESR1 silencing, thus providing a rationale for HDAC inhibitor activity in breast cancer (35), although a direct relationship between HDACi and YAP expression was not described. In another paper from the same research group, the authors described that in small cell lung cancer (SCLC), the benzamide HDACi entinostat (class I HDACi) increased YAP expression, while the pan-HDAC inhibitor TSA did not (40), and TSA could even counter-suppress the activity of entinostat induced YAP expression. They further proposed a model where in SCLC cells, YAP expression was suppressed by RCOR1/2/3 repression complex, while the SIN3A complex sustained YAP expression that was inhibited by TSA. This intricate regulation surrounding YAP expression suggested that HDACi mechanism of action may be extremely nuanced and context dependent. Adding to the level of complexity, another paper described that HDACi downregulated YAP expression in multiple cancer types(41), in which pan-HDACi were used (LBH589, Dacinostat, TSA, JNJ-26481585) that showed HDACi decrease of YAP protein expression. The above studies show inconsistent results regarding the relationship between Hippo pathway and HDAC inhibition. Intriguingly, benzamides (of which entinostat belongs to) have demonstrated lower inhibition ability towards Sin3 complexes compared to CoREST and NuRD(14), suggesting that different types of HDACi pharmacore possess distinct preferences of repression complexes which could potentially act as different modes of epigenetic control of Hippo pathway activity.

The above background illustrates the current state of the research regarding Hippo pathway, HDACi and HR (+) breast cancer, with much unanswered questions. We wish to experimentally clarify the role of HDACi and its impact on the Hippo pathway signaling. We also sought to probe how activation of the hippo pathway and its downstream proteins impact clinical outcome in HR (+) breast cancer. Interestingly, we discovered that molecularly, HDACi downregulate YAP expression transcriptionally, but conversely heightens TEAD signaling and upregulation of multiple downstream targets. Clinically, upregulation of several well-known hippo downstream targets is associated with improved survival in HR (+) breast cancer patients. Our findings provide further insight in the role of hippo signaling in HR (+) breast cancer as a therapeutically relevant disease pathway and its role in HDACi mediated clinical efficacy.

Cell culture and drug treatment

The hormone positive breast cancer cell lines T47D and MCF7 (purchased from ATCC Cell Lines (https://www.atcc.org/ ) were maintained in RPMI-1640 (Gibco) and Dulbecco's Modified Eagle Medium (DMEM, Gibco) respectively. All culture medium contained 10% Fetal Bovine Serum (FBS, Gibco) and 1% Penicillin Streptomycin (P/S, Gibco). Cells were incubated in 37°C, 5% CO₂ under standard molecular biology conditions. Romidepsin (Selleck Chemicals, Houston, TX, USA) and Suberoylanilide Hydroxamic Acid (SAHA, Cayman Chemicals, Ann Arbor, Michigan) were obtained as solution in dimethyl sulfoxide (DMSO), diluted to 1 mm with DMSO and stored at − 20°C until further use.

cDNA preparation and RT-qPCR

T47D or MCF-7 (5 to 7 x 10⁵ per well) were seeded onto 6 cm dish. After cell adhesion, cells were treated for 5 days, washed in PBS and RNA extracted using the TRIzol procedure, resuspended in 35 µL water and checked for quantity with a Nano-Drop (Thermo Fisher Scientific, RNA with A260/A280 ratios over 1.9 were used.) than stored at − 80 degree. The preparation of cDNA was performed using a HiScript I TM First Strand cDNA Synthesis Kit (Bionovas, Toronto, Canada) following the standardized procedure. For gene expression analysis, RT-qPCR analysis was performed, per standard molecular biology protocols. Sequences of primers are as follows: YAP: Forward: TAGCCCTGCGTAGCCAGTTA, Reverse: TCATGCTTAGTCCACTGTCTGT, CYR61 Forward: AATGGAGCCTCGCATCCTATA, Reverse: TTCTTTCACAAGGCGGCA

CTGF: Forward: CCCTCGCGGCTTACCGACTGG,

Reverse: CACAGGTCTTGGAACAGGCGC,

GAPDH: Forward:GAGTCAACGGATTTGGTCGT, Reverse:GAGGTCAATGAAGGGGTCAT. Data were analyzed using the ∆∆Ct method and statistical significance was determined using a student’s t-test.

Western blotting

Cell lysates were subjected to SDS-polyacrylamide gel electrophoresis and subsequently transferred to membranes (Cytiva, Marlborough, MA, USA). Membranes were blocked with a mixture of 5% skimmed milk in PBS for 1 hour. Subsequently, they were incubated overnight at 4°C with primary antibodies specific to YAP (GeneTex, Alton Pkwy Irvine, CA, USA, GTX129151), phosphorylated YAP (Cell Signaling Technology, Danvers, MA, USA, #4911), TAZ (Cell Signaling Technology, Danvers, MA, USA, #4883), GAPDH (Santa Cruz Biotechnology, Dallas, Texas, USA, sc-47724), tubulin (Thermo Fisher Scientific Inc., Waltham, MA, USA, MA5-16308), ESR1 alpha (Cell Signaling Technology, Danvers, MA, USA, #8644), LATS1 (Cell Signaling Technology, Danvers, MA, USA, #3477), LATS2 (Cell Signaling Technology, Danvers, MA, USA, #5888), with dilutions from 1:500–1:3000 in each blocking buffer. After primary antibody incubation with washes by PBST (PBS with 0.1% Tween-20), the membranes were incubated with a secondary antibody conjugated with horseradish peroxidase for 1h. protein bands were visualized by using the ECL kit (Millipore, Bedford, MA, USA), and imaging done by GE Amersham Imager 600.

Luciferase assay

Cells are seeded at a density of 4x10⁵ cells/well in a 6-well plate and cultured overnight to allow for cell attachment. A vector system expressing luciferase is then transfected into the target cells using the Lipofectamine™ 3000 system. Six hours post-transfection, the medium is replaced with standard cell culture medium. The following day, the original medium is removed, and the drug is added to the corresponding wells. After 48 hours of drug treatment, the drug-containing medium is removed, the cells are washed with 1x PBS, and an appropriate amount of 1x lysis buffer is added to lyse the cells. The cells are then scraped and collected, and after shaking, centrifuged at 12,000g for 1 minute to collect the supernatant of cell lysates. An aliquot of 20 µL cell lysate is transferred to a 96-well white plate, and 100 µL Luciferase substrate is added, and the analysis is performed on the TECAN SPARK Multimode Microplate Reader. The luciferase expression values are obtained by repeating the reading every 10 seconds for a total of 10 minutes. Additionally, 2 µL of cell lysate is used for protein quantification using the BCA Protein Assay Kit, serving as the normalization for each well.

Immunofluorescence

Cells were cultured on Millicell® EZ SLIDES (Millipore, Bedford, MA, USA), fixed in 4% paraformaldehyde for 10 min at room temperature and extracted with 0.2% Triton X-100 solution for 10 min. After blocking with phosphate buffered saline with Tween-20 (PBST) containing 1% bovine serum albumin for 30 min, the cells were incubated with YAP antibody overnight at 4℃. Cells were washed for three times with PBST and then incubated with fluorescein isothiocyanate conjugated secondary antibody for 1 h. After that, cells were counterstained with Fluoroshield™ with DAPI (Sigma-Aldrich, Burlington, MA) to visualize the nucleus. The coverslips were mounted onto glass slides with an anti-fade solution and subjected to the examination under an Olympus FV10i confocal microscope.

RNA-sequencing

T47D or MCF-7 (5 to 7 x 10⁵ per well) were seeded onto 6 cm dish and treated with 1µM palbociclib or vehicle for 5 days, washed in PBS, and RNA was extracted (Total RNA Isolation Kit, NovelGene). RNA was checked for quantity with a Nano-Drop (Thermo Fisher Scientific, RNA with A260/A280 ratios over 1.9 were used.) than stored at − 80°C. Libraries were prepared using a TruSeq Stranded mRNA sample preparation kit (Illumina, San Diego, CA) from 500 ng of purified total RNA according to the manufacturer’s protocol in a reduced reaction volume. The finished cDNA libraries were assessed for quality using a Bioanalyzer and quantified with a Quant-iT dsDNA Assay kit (Thermo Fisher Scientific, Waltham, MA). The uniquely indexed libraries were multiplexed based on this quantitation and the pooled sample was quantified by qPCR using the Kapa Biosystems (Wilmington, MA) library quantification kit by the Molecular Biology Core Genomics Facility at the Dana-Farber Cancer Institute and sequenced on a single Illumina NextSeq500 run with single-end 75bp reads. Reads were processed to counts using the bcbio-Nextgen toolkit version 1.0.3a (https://github.com/chapmanb/bcbio-nextgen) as follows: (1) Reads were trimmed and clipped for quality control in cutadapt v1.12; (2) Read quality was checked for each sample using FastQC 0.11.5; (3) High-quality reads were then aligned into BAM files through STAR 2.5.3a using the human assembly GRCh37; (4) BAM files were imported into DEXSeq-COUNT 1.14.2 and raw counts TPM and RPKM were calculated. R package edgeR (McCarthy et al., 2012; Robinson et al., 2010) 3.18.1 (R version 3.2.1) was used for differential analysis and generate log fold change, p value and FDR.

The RNA-seq results were deposited into the Gene Expression Omnibus (GEO) database under the accession number GSE263971.

TCGA analysis, pathway analysis and data processing

Heatmaps, gene ontology (GO) analysis, dot plot, ridge plot was generated by the R packages “ClusterProfiler”, “enrichplot”, “ComplexHeatmap”, “GSEAplot”. DAVID analysis was performed on the DAVID website (https://david.ncifcrf.gov/tools.jsp(42)). TCGA analysis were performed on cBioPortal website (https://www.cbioportal.org/) using the METABRIC dataset(43). From the METABRIC dataset, "Breast Invasive Ductal Carcinoma" was firstly chosen, followed by selection of "mRNA expression z-scores relative to all samples", “ER status positive”. After filtering, clinical and mRNA data were downloaded from the remaining samples, with removal of samples with unavailable overall survival data, yielding total 1030 samples. The C-G high expression cohort were selected with patients’ samples with either CCDC80 or GADD45A consisting of a positive z-score (> 0), with the remaining samples defined as the C-G low expression cohort. Sample IDs from each the C-G high and C-G low cohort were retrieved and input into cBioPortal as 2 non-overlapping groups for further analysis. The complete list of each cohort is uploaded as supplementary files.

Class 1 HDACi transcriptionally repress YAP expression.

Previous research has shown that class I HDACi downregulate YAP protein expression in cancer cells (41); however whether this is mediated at the transcriptional level is unclear from the study. We treated the HR (+) breast cancer cell lines MCF7 and T47D with romidepsin for 24 hours and observed significant downregulation of YAP1 mRNA (Fig. 1A). Suppression of YAP1 was observed in multiple cell lines, including the HR (+) HER2(-) breast cancer cell lines MCF7, T47D, CAMA-1, as well as the HER2(+) BT-474, triple negative breast cancer line (TNBC) MDA-231, and the lung cancer cell line A549 (Fig. 1B). Similar results were observed when treated with the pan-HDAC inhibitor SAHA (supp Fig. 1A). This suppression in YAP expression was time dependent (Fig. 1C). The canonical hippo pathway is based on phosphorylation of YAP, which directs it to cytoplasmic destruction instead of intranuclear translocation. Interestingly, romidepsin or SAHA treatment decreased phosphorylated YAP (Fig. 1D). Since both YAP mRNA and phosphorylated-YAP are downregulated, our data suggests that HDACi decrease YAP by a transcriptomic silencing mechanism instead of protein degradation mediated by the canonical Hippo pathway.

We then asked whether HDACi transcriptional suppression of YAP expression was a general phenomenon regardless of cell type. We queried GEO for publicly deposited transcriptional profiling databases utilizing HDACi on human cancer cell lines. In a total of 7 transcriptomic databases (from GSE70120, GSE74478) where the bladder cell lines VM-CUB1 and UM-UC-3 cells were treated with the HDACi romidepsin, givinostat, SAHA, and siRNA towards HDAC1/2, we observed a consistent downregulation of YAP mRNA (Fig. 1E), while TAZ expression was less significantly decreased. A recent study described that HDACi entinostat, SAHA, CORIN resulted in ESR1 downregulation in MCF-7 cells ((44), Fig. 1). We confirmed this observation by treating T47D cells with romidepsin, SAHA, and entinostat. Our data revealed that these HDACi suppressed ESR1 expression in a dose dependent fashion (Fig. 1F). There was a consistent downregulation of YAP/TAZ protein expression with all three HDACi, as well as ESR1 (Fig. 1G). In summary, our data indicate that HDACi result in YAP expression downregulation at the transcriptional level, and also induces ESR1 protein downregulation.

2. HDACi activate TEAD transcription and downregulate ESR1

Following our above results, we wished to investigate whether HDACi downregulation of YAP expression resulted in suppression of the Hippo-YAP-TEAD transcriptional output and subsequent downstream signaling. We utilized the 8xGTIIC-TEAD luciferase reporter, a well-established reporter assay for investigating TEAD mediated transcription(45), in breast cancer cell lines treated with HDACi. We hypothesized that YAP downregulation would suppress the YAP-TEAD signaling and hippo transcriptional output. Unexpectedly, TEAD transcription upregulated significantly after HDACi treatment according to the luciferase reporter (Fig. 2A). Downstream conventional Hippo-TEAD signaling targets including CYR61, CTGF, were all significantly upregulated (Fig. 2B). One possible explanation was despite global YAP downregulation, intranuclear YAP was increased, leading to upregulation of YAP-TEAD transcription. However, we did not observe increased intranuclear YAP expression by immunofluorescence (Fig. 2C). In the 7 transcriptomic datasets treated with HDAC inhibition, the average fold change for CTGF and CYR61 were generally upregulated as well (Fig. 2D). Our data suggests that at the cellular level, HDAC inhibition results in upregulation of Hippo pathway targets.

3. Transcriptional profiling of HDACi

To specifically investigate the transcriptomic changes by HDACi in HR (+) breast cancer cells, we then performed RNA-sequencing in T47D and MCF7 cells treated with romidepsin. To mitigate the confounding effect on individual cell line characteristics that would impact the results, we overlapped genes that were both differentially expressed in MCF7 and T47D. In both cell lines, nearly ~ 6000 genes were differentially expressed (2-fold difference, p < 0.05, adjusted p < 0.05), with an overlap of 3512 genes (Fig. 3A). We filtered out genes that changed in opposing directions between the 2 lines (i.e. only genes that were concurrently up- or down-regulated in both cell lines were selected), resulting in 3366 genes chosen for further analysis. Gene ontology (GO) analysis revealed pathways relating to cell cycle (including chromosome segregation, mitosis, DNA replication, nuclear division, and others) as leading pathways, indicating that romidepsin strongly perturbs the cell cycle in HR (+) breast cancer (Fig. 3B). Consistently, KEGG pathways associated with romidepsin treatment revealed that the cell cycle was significantly and substantially suppressed as shown by dot plot and ridge plot (Fig. 3C-D), and GSEA analysis showed cell cycle pathway strongly suppressed with NES of -3.59 (Fig. 3E). DAVID analysis also showed cell cycle as the top overrepresented pathways (Fig. 3F), where interestingly, the Hippo pathway was also among the leading enriched pathways.

We sought to investigate the expression profile of a previously reported Hippo pathway gene signature set (46) in our RNA-seq data. We observed that in both cell lines, treatment of romidepsin resulted in upregulation in majority of the signature Hippo pathway downstream genes, including the canonical CYR61/CCN1, CTGF/CCN2, NUAK2, GADD45A and others (Fig. 3G-H).

In conclusion, RNA-seq of HR (+) breast cancer cell lines treated with romidepsin revealed a strong suppression of the cell cycle related pathways and an overrepresentation of the Hippo pathway expression and signaling, as well as confirming that conventional TEAD expression targets such as CYR61, CTGF are upregulated.

Identification of Hippo pathway downstream genes associated with improved survival outcomes in HR (+) breast cancer

Our previous results identified that romidepsin treatment resulted in upregulation of several Hippo pathway signature genes. Specifically, a total of 9 genes (TGFB2, CYR61/CCN1, CTGF/CCN2, TGFB2, CCDC80, GADD45A, IGFBP3, NUAK2, F3) were significantly upregulated in both T47D and MCF7 treated with romidepsin. We asked whether the expression was correlated with survival in HR (+) breast cancer. From the METABRIC cohort(47), we selected cases that were HR(+) HER2(-) and with available mRNA expression data, with a total of 1030 cases selected. When categorized into high versus low gene expression for each gene in this cohort, we discovered that expression of 4 genes (CCDC80, GADD45A, F3, TGFB2) were significantly correlated with overall survival. Strikingly, all 4 genes demonstrated a significant association of higher gene expression level and better overall survival (p-value < 0.05) (Fig. 4A). In the cases of GADD45 (p < 0.0001, overall survival in high versus low expression: 199 versus 142 months) and CCDC80 (p = 0.0022, overall survival in high versus low expression: 178.2 versus 148.8 months), the differences in survival were more substantial.

We hypothesized that gene expression levels of GADD45 and/or CCDC80 would be significant prognostic factors for HR (+) breast cancer, and we sought to further explore clinical characteristics of patients with higher expression of either of these genes. From the above 1030 cases, we categorized the patients into high expression (of either GADD45 and/or CCDC80) and low expression groups. High and low expression groups each contained of 587 and 443 patients respectively. Clinical characteristics of the two groups were examined through the cBioPortal database. As expected, high expression patients (High C-G) had significantly longer survival compared to low expression patients (Low C-G) (185 months versus 132.1 months, hazard ratio 0.71, p = 0.00002) (Fig. 4B). Clinical characteristics revealed no significant difference between tumor stage, positive lymph nodes, type of breast surgery (supplementary); interestingly, when applying the 3-gene classifier (48), the low C-G group had significantly more patients with high proliferation ER + HER2- profile, indicating a more proliferative nature of cancer (Fig. 4C). Recurrence free survival was also significantly higher in the C-G group (p = 0.01) (Fig. 4D).

To validate our findings, we examined the expression of CCDC80 and GADD45A in the GSE70120, GSE74478 datasets from Fig. 1E. We discovered a consistent upregulation in both GADD45A and CCDC80 gene expression after various HDACi treatment (Fig. 4E). Taken together the above, our findings show consistent results that HDAC inhibition results in upregulation of the Hippo pathway targets GADD45A and CCDC80 (in both our RNA-seq data and the GSE70120, GSE74478 datasets), and high CCDC80 or GADD45A expression is associated with more favorable survival outcomes in HR(+)HER2(-) breast cancer (from the TCGA METABRIC database) with less aggressive cancer biology (lower proliferation). We summarized our findings from this study in a mechanistic illustration (Fig. 4F).

Even with the advent of CDK4/6 inhibitors, metastatic hormone positive breast cancer still remains incurable, with patients ultimately succumbing to the disease. There is still a huge unmet need for therapeutic agents such as HDACi that are efficacious in treatment for HR (+) breast cancer. The treatment of HR (+) breast cancer is unique that besides cytotoxic chemotherapy and targeted therapy (such as PI3K/AKT/mTOR inhibitors), therapeutics that disrupt estrogen signaling or ESR1 expression provide clinical benefit in HR (+) breast cancer patients. Previous studies have demonstrated HDACi mediated ESR1 downregulation (49, 50), likely through upregulation of transcriptional repressors for ESR1(51). This hypothesis is supported by the recent study that delineates HDACi upregulation of VGLL3 which recruits silencing complexes that suppress ESR1 expression (35). In general, HDACi may exert cytotoxicity in HR(+) breast cancer by multiple mechanisms including ESR1 downregulation (49, 50), induction of intrinsic CDK inhibitors such as p21 (52), induction of p53 resulting in cancer cell apoptosis (53), and others. Although clinical trials using HDACi have had both successes and failures in phase III trials (including the ACE trial(18) and the E2112 trial(54)), HDACi still remains a viable option for treatment in HR(+) breast cancer, and further understanding of the underlying mechanism will further unlock the potential for therapeutics avenues.

Accumulating recent evidence now support the notion that Hippo pathway signaling, especially YAP/TAZ-TEAD signaling, may not be uniformly oncogenic, rather it is more likely that the Hippo pathway may be context dependent in terms of oncogenicity. In our study, we discovered that despite HDACi suppression of YAP expression, as evidenced by our cell line data, RNA-seq data and publicly available GEO datasets, TEAD signaling is activated, and the majority of Hippo signature genes (46) are upregulated, including the conventional Hippo-TEAD targets CYR61 and CTGF(55). CYR61 and CTGF were proposed as mediators for paclitaxel resistance(55) and is generally considered as oncogenic (56, 57). However, from our RNA-seq data we observed that other Hippo pathway signature genes are modulated as well, suggesting that HDACi induce an intricate transcriptional perturbation effect on Hippo pathway transcriptome. Interestingly, we discover GADD45A and CCDC80 as highly prognostic of improved survival in HR (+) HER2(-) breast cancer patients. GADD45A and CCDC80 are well established targets of Hippo-TEAD signaling (46, 58, 59). GADD45A is associated with luminal type breast cancer, highly positive in HR + cancers and low in normal or HER2/TNBC(60), plays a role in cell cycle regulation(61) and was previously reported as directly induced by HDACi(62). Most studies have shown GADD45A is pro-apoptosis and plays a role in tumor killing(63, 64). Few studies have reported the role of CCDC80 in cancer. A recent study reported tumor suppressive role of CCDC80 in colon cancer cell lines(59). Interestingly, this study reported an oncogenic role of LATS1/2 (59), in which the authors speculate is context dependent. Taken together the findings from our study and others (65, 66), we speculate that the context dependent role of the hippo pathway in cancer, i.e. whether oncogenic or tumor-suppressive, is dependent upon the amplitude of expression induced for Hippo targets that possess anti-tumor properties, such as CCDC80 and GADD45A. As CCDC80 is relatively under-investigated in cancer, further studies will be beneficial to further characterize its role as a prognostic and/or therapeutic potential. Our findings provide, at least partially, a possible explanation for HDACi efficacy in HR (+) breast cancer and propose a previously undiscovered HDAC-TEAD-CCDC80/GADD45A axis that could serve as potential biomarkers or therapeutic development in HR (+) breast cancer.

CDK4/6 inhibitors have dramatically altered the landscape of treatment for HR (+) breast cancer. The currently FDA approved CDK4/6 inhibitors palbociclib, ribociclib, abemaciclib, provide significant prolongation of progression-free survival and is now the standard of care in metastatic and high-risk non-metastatic HR(+)HER2(-) breast cancer (67, 68). However, despite the initial anticipation (69), CDK4/6 inhibitors have yet to replicate the success in non-breast cancers. Many hypotheses have speculated the reason for the exclusive efficacy of CDK4/6 inhibitors in breast cancer, with the prevailing explanation being that HR (+) HER2(-) breast cancers demonstrate heightened sensitivity towards cell cycle inhibition. As demonstrated in our data, HDACi strongly perturbated cell cycle related pathways in HR (+) HER2(-) breast cancer cell lines. This has been well characterized mechanistically(70, 71), and it is tantalizing to speculate that HDACi may possess efficacy towards HR(+)HER2(-) breast cancer partially through cell cycle suppression. Indeed, HDACi remove the repressor complexes that Rb utilizes for G1/S checkpoint control (72), functionally acting analogous to CDK4/6 inhibitors. Preclinical studies have shown synergistic tumoricidal effects of combined CDK4/6 inhibitors and HDACi(73); however this combination will be challenging for clinical development due to both drugs possessing significant neutropenia activities(18). The clinical activity of HDACi adds support to the hypothesis that cell cycle control may be a critical target for HR (+) breast cancer, suggesting that different modalities that target the cell cycle, especially the G1/S checkpoint, may be potentially effective in this group of patients. Current clinical development are underway, including other CDK inhibitors (such as CDK2) (74), targeting of the G2/M checkpoint(75), targeting the CAK (CDK-activating kinase) by CDK7 (76), and others.

In summary, our study provides novel insights into the role of the hippo pathway and HDACi in HR (+) breast cancer. We discover that while HDACi downregulates YAP, TEAD signaling is heightened that upregulates several downstream genes of the hippo pathway linked to improved survival. Our findings provide possible mechanisms for HDACi role in HR(+) breast cancer, and hint towards potential novel targeting agents, such as LATS inhibitors (35), Hippo pathway modulating agents, or further exploitation of CCDC80 and GADD45A, to improve outcomes and survival for this group of patients.

Acknowledgements

The authors thank the funding agencies (NSTC, Taiwan Clinical Oncology Research Foundation, the Melissa Lee Cancer Foundation, Taipei Veterans General Hospital) for support.

Funding: This study was partially funded by the grants to JIL: NSTC 112-2314-B-A49 -054 (National Science and Technology Council, Taiwan), the Taiwan Clinical Oncology Research Foundation, the Melissa Lee Cancer Foundation, and 112DHA0100294 (Taipei Veterans General Hospital internal grant)

Siegel RL, Miller KD, Jemal A. Cancer statistics, 2020. CA Cancer J Clin. 2020;70(1):7-30.
Duggan C, Trapani D, Ilbawi AM, Fidarova E, Laversanne M, Curigliano G, et al. National health system characteristics, breast cancer stage at diagnosis, and breast cancer mortality: a population-based analysis. The Lancet Oncology. 2021;22(11):1632-42.
Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, et al. Molecular portraits of human breast tumours. Nature. 2000;406(6797):747-52.
Goetz MP, Toi M, Campone M, Sohn J, Paluch-Shimon S, Huober J, et al. MONARCH 3: Abemaciclib As Initial Therapy for Advanced Breast Cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2017;35(32):3638-46.
Hortobagyi GN, Stemmer SM, Burris HA, Yap YS, Sonke GS, Paluch-Shimon S, et al. Ribociclib as First-Line Therapy for HR-Positive, Advanced Breast Cancer. The New England journal of medicine. 2016;375(18):1738-48.
Finn RS, Martin M, Rugo HS, Jones S, Im SA, Gelmon K, et al. Palbociclib and Letrozole in Advanced Breast Cancer. The New England journal of medicine. 2016;375(20):1925-36.
Jones RH, Casbard A, Carucci M, Cox C, Butler R, Alchami F, et al. Fulvestrant plus capivasertib versus placebo after relapse or progression on an aromatase inhibitor in metastatic, oestrogen receptor-positive breast cancer (FAKTION): a multicentre, randomised, controlled, phase 2 trial. The Lancet Oncology. 2020;21(3):345-57.
Andre F, Ciruelos E, Rubovszky G, Campone M, Loibl S, Rugo HS, et al. Alpelisib for PIK3CA-Mutated, Hormone Receptor-Positive Advanced Breast Cancer. The New England journal of medicine. 2019;380(20):1929-40.
Baselga J, Campone M, Piccart M, Burris HA, 3rd, Rugo HS, Sahmoud T, et al. Everolimus in postmenopausal hormone-receptor-positive advanced breast cancer. The New England journal of medicine. 2012;366(6):520-9.
Wang J, Xu B. Targeted therapeutic options and future perspectives for HER2-positive breast cancer. Signal Transduct Target Ther. 2019;4(1):34.
Erika P. Hamilton JSW, Timothy J. Pluard, Stephen R. D. Johnston, Aki Morikawa, Elizabeth Claire Dees, Robert Hugh Jones, Barbara B. Haley, Anne Caroline Armstrong, Adam Louis Cohen, Pamela N. Munster, Gail Lynn Shaw Wright, Fadi Kayali, Manav Korpal, Jianjun Alan Xiao, Jenny Long, Benoit Destenaves, Lei Gao, Antonio Gualberto, Dejan Juric. Phase I/II study of H3B-6545, a novel selective estrogen receptor covalent antagonist (SERCA), in estrogen receptor positive (ER+), human epidermal growth factor receptor 2 negative (HER2-) advanced breast cancer. ASCO Annual Meeting I2021.
S.J. Howell MGK, S. Lord, L. Kenny, A. Bahl, G. Clack, E. Ainscow, H. Arkenau, J.L. Mans, C. Palmieri, P. Richards, R. Jeselsohn, Z. Mitri, W.J. Gradishar, S. Sardesai, J. O'Shaughnessy, M. Lehnert, S. Ali, S. McIntosh, R..C. Coombes. 265P - Study of samuraciclib (CT7001), a first-in-class, oral, selective inhibitor of CDK7, in combination with fulvestrant in patients with advanced hormone receptor positive HER2 negative breast cancer (HR+BC). European Society for Medical Oncology 20212021.
Lin NU, Borges VF, Patel MR, Okera M, Meisel J, Wesolowski R, et al. 382MO Updated results from the phase I/II study of OP-1250, an oral complete estrogen receptor (ER) antagonist (CERAN) and selective ER degrader (SERD) in patients (pts) with advanced or metastatic ER-positive, HER2-negative breast cancer. 2023.
Bantscheff M, Hopf C, Savitski MM, Dittmann A, Grandi P, Michon AM, et al. Chemoproteomics profiling of HDAC inhibitors reveals selective targeting of HDAC complexes. Nature biotechnology. 2011;29(3):255-65.
Iyer SP, Foss FF. Romidepsin for the Treatment of Peripheral T-Cell Lymphoma. Oncologist. 2015;20(9):1084-91.
Richardson PG, Laubach JP, Lonial S, Moreau P, Yoon SS, Hungria VT, et al. Panobinostat: a novel pan-deacetylase inhibitor for the treatment of relapsed or relapsed and refractory multiple myeloma. Expert review of anticancer therapy. 2015;15(7):737-48.
Autin P, Blanquart C, Fradin D. Epigenetic Drugs for Cancer and microRNAs: A Focus on Histone Deacetylase Inhibitors. Cancers (Basel). 2019;11(10).
Jiang Z, Li W, Hu X, Zhang Q, Sun T, Cui S, et al. Tucidinostat plus exemestane for postmenopausal patients with advanced, hormone receptor-positive breast cancer (ACE): a randomised, double-blind, placebo-controlled, phase 3 trial. The Lancet Oncology. 2019;20(6):806-15.
Harvey KF, Zhang X, Thomas DM. The Hippo pathway and human cancer. Nature reviews Cancer. 2013;13(4):246-57.
Halder G, Johnson RL. Hippo signaling: growth control and beyond. Development. 2011;138(1):9-22.
Zanconato F, Cordenonsi M, Piccolo S. YAP/TAZ at the Roots of Cancer. Cancer cell. 2016;29(6):783-803.
Meng Z, Moroishi T, Guan KL. Mechanisms of Hippo pathway regulation. Genes & development. 2016;30(1):1-17.
Moroishi T, Hayashi T, Pan WW, Fujita Y, Holt MV, Qin J, et al. The Hippo Pathway Kinases LATS1/2 Suppress Cancer Immunity. Cell. 2016;167(6):1525-39 e17.
Harvey K, Tapon N. The Salvador-Warts-Hippo pathway - an emerging tumour-suppressor network. Nature reviews Cancer. 2007;7(3):182-91.
Eisinger-Mathason TS, Mucaj V, Biju KM, Nakazawa MS, Gohil M, Cash TP, et al. Deregulation of the Hippo pathway in soft-tissue sarcoma promotes FOXM1 expression and tumorigenesis. Proceedings of the National Academy of Sciences of the United States of America. 2015;112(26):E3402-11.
Lu T, Li Z, Yang Y, Ji W, Yu Y, Niu X, et al. The Hippo/YAP1 pathway interacts with FGFR1 signaling to maintain stemness in lung cancer. Cancer letters. 2018;423:36-46.
Li Z, Wang Y, Zhu Y, Yuan C, Wang D, Zhang W, et al. The Hippo transducer TAZ promotes epithelial to mesenchymal transition and cancer stem cell maintenance in oral cancer. Mol Oncol. 2015;9(6):1091-105.
Song S, Honjo S, Jin J, Chang SS, Scott AW, Chen Q, et al. The Hippo Coactivator YAP1 Mediates EGFR Overexpression and Confers Chemoresistance in Esophageal Cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015;21(11):2580-90.
Cottini F, Hideshima T, Xu C, Sattler M, Dori M, Agnelli L, et al. Rescue of Hippo coactivator YAP1 triggers DNA damage-induced apoptosis in hematological cancers. Nature medicine. 2014;20(6):599-606.
Chan LH, Wang W, Yeung W, Deng Y, Yuan P, Mak KK. Hedgehog signaling induces osteosarcoma development through Yap1 and H19 overexpression. Oncogene. 2014;33(40):4857-66.
Janse van Rensburg HJ, Azad T, Ling M, Hao Y, Snetsinger B, Khanal P, et al. The Hippo Pathway Component TAZ Promotes Immune Evasion in Human Cancer through PD-L1. Cancer research. 2018;78(6):1457-70.
Elaimy AL, Guru S, Chang C, Ou J, Amante JJ, Zhu LJ, et al. VEGF-neuropilin-2 signaling promotes stem-like traits in breast cancer cells by TAZ-mediated repression of the Rac GAP beta2-chimaerin. Sci Signal. 2018;11(528).
Fan H, Wang X, Li W, Shen M, Wei Y, Zheng H, et al. ASB13 inhibits breast cancer metastasis through promoting SNAI2 degradation and relieving its transcriptional repression of YAP. Genes & development. 2020;34(19-20):1359-72.
Britschgi A, Duss S, Kim S, Couto JP, Brinkhaus H, Koren S, et al. The Hippo kinases LATS1 and 2 control human breast cell fate via crosstalk with ERalpha. Nature. 2017;541(7638):541-5.
Ma S, Tang T, Probst G, Konradi A, Jin C, Li F, et al. Transcriptional repression of estrogen receptor alpha by YAP reveals the Hippo pathway as therapeutic target for ER(+) breast cancer. Nature communications. 2022;13(1):1061.
Furth PA, Wang W, Kang K, Rooney BL, Keegan G, Muralidaran V, et al. Overexpression of Estrogen Receptor alpha in Mammary Glands of Aging Mice Is Associated with a Proliferative Risk Signature and Generation of Estrogen Receptor alpha-Positive Mammary Adenocarcinomas. The American journal of pathology. 2023;193(1):103-20.
Denkert C, Loibl S, Kronenwett R, Budczies J, von Torne C, Nekljudova V, et al. RNA-based determination of ESR1 and HER2 expression and response to neoadjuvant chemotherapy. Ann Oncol. 2013;24(3):632-9.
Li Q, Sun Y, Jarugumilli GK, Liu S, Dang K, Cotton JL, et al. Lats1/2 Sustain Intestinal Stem Cells and Wnt Activation through TEAD-Dependent and Independent Transcription. Cell stem cell. 2020;26(5):675-92 e8.
Li FL, Guan KL. The two sides of Hippo pathway in cancer. Semin Cancer Biol. 2021.
Wu Z, Su J, Li FL, Chen T, Mayner J, Engler A, et al. YAP silencing by RB1 mutation is essential for small-cell lung cancer metastasis. Nature communications. 2023;14(1):5916.
Han H, Yang B, Nakaoka HJ, Yang J, Zhao Y, Le Nguyen K, et al. Hippo signaling dysfunction induces cancer cell addiction to YAP. Oncogene. 2018;37(50):6414-24.
Sherman BT, Hao M, Qiu J, Jiao X, Baseler MW, Lane HC, et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic acids research. 2022;50(W1):W216-W21.
Pereira B, Chin SF, Rueda OM, Vollan HK, Provenzano E, Bardwell HA, et al. The somatic mutation profiles of 2,433 breast cancers refines their genomic and transcriptomic landscapes. Nature communications. 2016;7:11479.
Ma S, Tang T, Probst G, Konradi A, Jin C, Li F, et al. Transcriptional repression of estrogen receptor alpha by YAP reveals the Hippo pathway as therapeutic target for ER(+) breast cancer. Nature communications. 2022;13(1):1061.
Dupont S, Morsut L, Aragona M, Enzo E, Giulitti S, Cordenonsi M, et al. Role of YAP/TAZ in mechanotransduction. Nature. 2011;474(7350):179-83.
Wang Y, Xu X, Maglic D, Dill MT, Mojumdar K, Ng PK, et al. Comprehensive Molecular Characterization of the Hippo Signaling Pathway in Cancer. Cell reports. 2018;25(5):1304-17 e5.
Curtis C, Shah SP, Chin SF, Turashvili G, Rueda OM, Dunning MJ, et al. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature. 2012;486(7403):346-52.
Haibe-Kains B, Desmedt C, Loi S, Culhane AC, Bontempi G, Quackenbush J, et al. A three-gene model to robustly identify breast cancer molecular subtypes. J Natl Cancer Inst. 2012;104(4):311-25.
Bicaku E, Marchion DC, Schmitt ML, Munster PN. Selective inhibition of histone deacetylase 2 silences progesterone receptor-mediated signaling. Cancer research. 2008;68(5):1513-9.
deFazio A, Chiew YE, Donoghue C, Lee CS, Sutherland RL. Effect of sodium butyrate on estrogen receptor and epidermal growth factor receptor gene expression in human breast cancer cell lines. The Journal of biological chemistry. 1992;267(25):18008-12.
Raha P, Thomas S, Thurn KT, Park J, Munster PN. Combined histone deacetylase inhibition and tamoxifen induces apoptosis in tamoxifen-resistant breast cancer models, by reversing Bcl-2 overexpression. Breast Cancer Res. 2015;17(1):26.
Ju R, Muller MT. Histone deacetylase inhibitors activate p21(WAF1) expression via ATM. Cancer research. 2003;63(11):2891-7.
Wang H, Zhou W, Zheng Z, Zhang P, Tu B, He Q, et al. The HDAC inhibitor depsipeptide transactivates the p53/p21 pathway by inducing DNA damage. DNA repair. 2012;11(2):146-56.
Yeruva SLH, Zhao F, Miller KD, Tevaarwerk AJ, Wagner LI, Gray RJ, et al. E2112: randomized phase iii trial of endocrine therapy plus entinostat/placebo in patients with hormone receptor-positive advanced breast cancer. NPJ Breast Cancer. 2018;4:1.
Lai D, Ho KC, Hao Y, Yang X. Taxol resistance in breast cancer cells is mediated by the hippo pathway component TAZ and its downstream transcriptional targets Cyr61 and CTGF. Cancer research. 2011;71(7):2728-38.
Yin S, Jin W, Qiu Y, Fu L, Wang T, Yu H. Solamargine induces hepatocellular carcinoma cell apoptosis and autophagy via inhibiting LIF/miR-192-5p/CYR61/Akt signaling pathways and eliciting immunostimulatory tumor microenvironment. J Hematol Oncol. 2022;15(1):32.
Kim H, Son S, Ko Y, Shin I. CTGF regulates cell proliferation, migration, and glucose metabolism through activation of FAK signaling in triple-negative breast cancer. Oncogene. 2021;40(15):2667-81.
Passaro F, De Martino I, Zambelli F, Di Benedetto G, Barbato M, D'Erchia AM, et al. YAP contributes to DNA methylation remodeling upon mouse embryonic stem cell differentiation. The Journal of biological chemistry. 2021;296:100138.
Pan WW, Moroishi T, Koo JH, Guan KL. Cell type-dependent function of LATS1/2 in cancer cell growth. Oncogene. 2019;38(14):2595-610.
Tront JS, Willis A, Huang Y, Hoffman B, Liebermann DA. Gadd45a levels in human breast cancer are hormone receptor dependent. Journal of translational medicine. 2013;11:131.
Hollander MC, Fornace AJ, Jr. Genomic instability, centrosome amplification, cell cycle checkpoints and Gadd45a. Oncogene. 2002;21(40):6228-33.
Hirose T, Sowa Y, Takahashi S, Saito S, Yasuda C, Shindo N, et al. p53-independent induction of Gadd45 by histone deacetylase inhibitor: coordinate regulation by transcription factors Oct-1 and NF-Y. Oncogene. 2003;22(49):7762-73.
Wang X, Hao Y, Chen J, Ding P, Lv X, Zhou D, et al. Nuclear complement C3b promotes paclitaxel resistance by assembling the SIN3A/HDAC1/2 complex in non-small cell lung cancer. Cell death & disease. 2023;14(6):351.
Hu Y, Jin R, Gao M, Xu H, Zou S, Li X, et al. Transcriptional repression of IKKbeta by p53 in arsenite-induced GADD45alpha accumulation and apoptosis. Oncogene. 2019;38(5):731-46.
Traboulsi T, El Ezzy M, Dumeaux V, Audemard E, Mader S. Role of SUMOylation in differential ERalpha transcriptional repression by tamoxifen and fulvestrant in breast cancer cells. Oncogene. 2019;38(7):1019-37.
Nait Achour T, Sentis S, Teyssier C, Philippat A, Lucas A, Corbo L, et al. Transcriptional repression of estrogen receptor alpha signaling by SENP2 in breast cancer cells. Mol Endocrinol. 2014;28(2):183-96.
Johnston SRD, Andre V. Abemaciclib plus endocrine therapy for hormone receptor-positive, HER2-negative, node-positive, high-risk, early breast cancer - Authors' reply. The Lancet Oncology. 2023;24(3):e104.
Morrison L, Loibl S, Turner NC. The CDK4/6 inhibitor revolution - a game-changing era for breast cancer treatment. Nature reviews Clinical oncology. 2024;21(2):89-105.
Lim JS, Turner NC, Yap TA. CDK4/6 Inhibitors: Promising Opportunities beyond Breast Cancer. Cancer discovery. 2016;6(7):697-9.
Richon VM, Sandhoff TW, Rifkind RA, Marks PA. Histone deacetylase inhibitor selectively induces p21WAF1 expression and gene-associated histone acetylation. Proceedings of the National Academy of Sciences of the United States of America. 2000;97(18):10014-9.
Marks PA, Richon VM, Rifkind RA. Histone deacetylase inhibitors: inducers of differentiation or apoptosis of transformed cells. J Natl Cancer Inst. 2000;92(15):1210-6.
Zhang HS, Gavin M, Dahiya A, Postigo AA, Ma D, Luo RX, et al. Exit from G1 and S phase of the cell cycle is regulated by repressor complexes containing HDAC-Rb-hSWI/SNF and Rb-hSWI/SNF. Cell. 2000;101(1):79-89.
Chaturvedi NK, Hatch ND, Sutton GL, Kling M, Vose JM, Joshi SS. A novel approach to eliminate therapy-resistant mantle cell lymphoma: synergistic effects of Vorinostat with Palbociclib. Leuk Lymphoma. 2019;60(5):1214-23.
Gerosa R, De Sanctis R, Jacobs F, Benvenuti C, Gaudio M, Saltalamacchia G, et al. Cyclin-dependent kinase 2 (CDK2) inhibitors and others novel CDK inhibitors (CDKi) in breast cancer: clinical trials, current impact, and future directions. Crit Rev Oncol Hematol. 2024;196:104324.
Lee WH, Chen LC, Lee CJ, Huang CC, Ho YS, Yang PS, et al. DNA primase polypeptide 1 (PRIM1) involves in estrogen-induced breast cancer formation through activation of the G2/M cell cycle checkpoint. International journal of cancer. 2019;144(3):615-30.
Coombes RC, Howell S, Lord SR, Kenny L, Mansi J, Mitri Z, et al. Dose escalation and expansion cohorts in patients with advanced breast cancer in a Phase I study of the CDK7-inhibitor samuraciclib. Nature communications. 2023;14(1):4444.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
02 Sep, 2024
Reviews received at journal
19 Jul, 2024
Reviewers agreed at journal
04 Jul, 2024
Reviewers invited by journal
17 May, 2024
Editor assigned by journal
07 May, 2024
Submission checks completed at journal
07 May, 2024
First submitted to journal
01 May, 2024

You are reading this latest preprint version

HDAC inhibitors modulate Hippo pathway signaling in hormone positive breast cancer

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Cell culture and drug treatment

cDNA preparation and RT-qPCR

Western blotting

Luciferase assay

Immunofluorescence

RNA-sequencing

TCGA analysis, pathway analysis and data processing

Results

2. HDACi activate TEAD transcription and downregulate ESR1

3. Transcriptional profiling of HDACi

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1