Highly Sensitive Molecular Assay for the Detection of Treponema pallidum infection

doi:10.21203/rs.3.rs-4357384/v1

Download PDF

Research Article

Highly Sensitive Molecular Assay for the Detection of Treponema pallidum infection

https://doi.org/10.21203/rs.3.rs-4357384/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Introduction: According to the World Health Organization (WHO) more than 7 million new Treponema pallidum (T. pallidum) infections were reported among people aged 15–49 years in 2020 globally, the majority of them in developing countries. Syphilis, which is caused by T. pallidum is transmitted through contact with active lesions of a sexual partner or from an infected pregnant woman to her foetus. Gold standard T. pallidum laboratory diagnosis methods include dark-field microscopy, silver staining, direct fluorescence immunoassays and the rabbit infectivity test. However, these tests are associated with false positive or negative results. The gold standard 16S ribosomal (rRNA) gene polymerase chain reaction (PCR) is used for routine amplification of T. pallidum conserved genes. Here we report on an ultrasensitive syphilis diagnostic method, based on de novo genome mining of the T. pallidum DNA to identify identical multi repeat sequences (IMRS) as amplification primers.

Methods: We used genome-mining approaches to find IMRS distributed throughout the T. pallidum genome to design a primer pair that target four repeat sequences. Genomic T. pallidum DNA was diluted from 8.14×10⁴ to 8.14×10^− 2 genome copies/𝜇l and used as template in the IMRS-based amplification assay. For performance comparison, 16S rRNA PCR assay was employed. Probit analysis was used to calculate the lower limit of detection of the T. pallidum-IMRS PCR and the conventional 16S rRNA PCR assays.

Results: Probit analysis confirmed that the T. pallidum-IMRS primers offered higher test sensitivity of 0.03 fg/𝜇L compared to the 16S rRNA PCR (0.714 pg/𝜇L). Using the T. pallidum-IMRS primers, we were able to observe considerable isothermal amplification of genomic DNA at a starting concentration of 0.01 pg/µL.

Conclusion: De novo genome mining of T. pallidum IMRS as amplification primers can serve as a platform for developing ultrasensitive diagnostics for Syphilis and potentially a wide range of infectious pathogens.

Laboratory Diagnostics

Bacteriology

Infectious Diseases

Identical multi-repeat sequences

Treponema pallidum

Isothermal assays

Globally, in 2020, the World Health Organization (WHO) estimated more than 7 million new Treponema pallidum (T. pallidum) infections among people aged 15–49 years [1]. Most of these cases occurred in lower- and middle-income countries. Syphilis, which is caused by T. pallidum is a multistage disease that is transmitted through contact with active lesions of a sexual partner or from an infected pregnant woman to her foetus [2]. Congenital syphilis is a leading cause of stillbirths and perinatal mortality globally. An estimated 350 000 adverse pregnancy outcomes worldwide occurred as a result of syphilis, including 143 000 early foetal deaths, 62 000 neonatal deaths, 44 000 preterm/low-birth-weight babies and 102 000 infected infants were reported globally [3]. Studies have also shown that Syphilis ulcers can facilitate the transmission of HIV up to 5 times among HIV infected patients [4], [5]. Several methods used for the detection of Syphilis such as microscopy and molecular technologies are currently available.

Gold standard T. pallidum laboratory diagnosis methods include dark-field microscopy, silver staining, direct fluorescence immunoassays and the rabbit infectivity test [6]. However, these tests are associated with false positive or negative results particularly when laboratory personnel are unable to distinguish T. pallidum from commensal treponemas [6]. It is therefore recommended that highly sensitive molecular tests based on different gene targets be adopted.

Several T. pallidum genes encoding treponemal surface or subsurface lipoproteins such as treponemal membrane protein A, subsurface lipoprotein 4D, basic membrane protein and T. pallidum 47 kDa lipoprotein and the DNA polymerase I gene have been evaluated for molecular diagnosis [7]. A genital ulcer real-time PCR multiplex assay for simultaneous detection of DNA from four pathogens including T. pallidum has since been evaluated [8]. Molecular tests also allow for the use of non-invasive specimens such as urine, or minimally invasive specimens such as vaginal swabs, which can be self-collected [8]. The sensitivity and specificity of these tests make them useful for increasing access to screening. However, they are associated with high equipment costs and require sophisticated laboratory infrastructure and highly trained personnel to perform to avoid false-positive results owing to contamination [8]. We have recently demonstrated the robustness of the molecular test based on de novo genome mining strategy that identify multiple repeat sequences (IMRS) [8]. The IMRS technology has been previously used in the diagnosis of submicroscopic P. falciparum in asymptomatic patients [12].

In this research, we developed a novel and sensitive molecular assay method based on a de novo genome mining strategy to identify repeat sequences in the T. pallidum genome. Primers for these IMRS are then employed for PCR amplification with improved sensitivity and specificity.

3.1 IMRS genome mining algorithm

The primers used in this study were designed based on Identical Multi-Repeat Sequence (IMRS) genome mining algorithm as previously described [9]. The IMRS algorithm is developed by adapting the Java Collection Framework by plugging in the Google Guava software (available at https://github.com/google/guava). The algorithm performs ab initio analysis of the annotated T. pallidum genome to identify identical repeating oligonucleotide sequences of any given length.

The algorithm fragments the entire genome sequence into overlapping windows of size 'L' and enumerates all fragmented L-mer sequences into positional coordinates on the genome. The repeated L-mers are counted with their positions grouped and sorted based on the repeat count.

The hits are screened by computing positional coordinates for pair of repeat sequences that are adjacent to each other on the genome and within an amplifiable region, so that they can serve as a primer pair in amplification reactions. The specificity of lead pairs was evaluated by NIH’s Basic Local Alignment Search Tool (BLAST) and NCBI Primer-BLAST and the best pair is selected. The selected pair was capable of amplifying sequences from various locations of the T. pallidum genome to generate amplicons of various lengths.

The T. pallidum genome (NZ_CP003679.1) was used as the reference to identify identical, repetitive sequence substrings of 4 bases that can be used as forward or reverse primers. NIH’s Basic Local Alignment Search Tool (BLAST) was used to evaluate the primer pairs to confirm T. pallidum specificity. The resulting primers were predicted to amplify several fragments of DNA of different sizes derived from different regions of the T. pallidum genome.

3.2 T. pallidum Genomic DNA Preparation

T. pallidum DNA was obtained from the American Type Culture Collection (ATCC) (ATCC BAA2642SD) at a concentration of ≥ 1 x 10⁵ copies/µL. T. pallidum genomic DNA was diluted from 8.14×10⁴ to 8.14×10^− 2 genome copies/𝜇L and used as template for both IMRS and 16S rRNA PCR assays in Tris-EDTA buffer (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

3.3 16S rRNA PCR assay

The 16S rRNA PCR assays were carried out in a reaction mixture containing dNTPs (Thermo Fisher Scientific, Waltham, Massachusetts, USA) (0.2 mM), forward and reverse primers (0.01 mM each), Taq Hot-Start DNA polymerase (Thermo Fisher Scientific, Waltham, Massachusetts, USA) (1.25 U), genomic template DNA (1 µL to a final PCR reaction volume of 25 µL). The cycling parameters were as follows: 95°C for 5 min; 40 cycles of: 95°C for 30 s, 56°C for 56 s, 72°C for 59 s; and 72°C for 59 s and a final hold of 4°C. The negative controls consisted of all the PCR reaction components except template DNA which was substituted with molecular grade water (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

3.4 T. pallidum IMRS PCR assay

The T. pallidum IMRS assays were carried out in a reaction mixture containing dNTPs (Thermo Fisher Scientific, Massachusetts, USA) (0.2 mM), forward and reverse primers (0.01 mM each), Taq Hot-Start DNA polymerase (Thermo Fisher Scientific, Massachusetts, USA) (1.25 U), genomic template DNA (1 µL to a final PCR reaction of 25 µL). The cycling parameters for the T. pallidum -IMRS assay were as follows: 95°C for 3 min; 40 cycles of: 95°C for 30 s, 55°C for 30 s, 72°C for 30 s; and 72°C for 5 min and a final hold of 4°C. All PCR products were resolved in 1% agarose gel visualized on a UV Gel illuminator system (Fison Instruments, Glasgow, United Kingdom) under ethidium bromide staining. The negative controls consisted of all the PCR reaction components except template DNA which was substituted with molecular grade water (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

3.5 Isothermal IMRS Amplification Assay

Isothermal (Iso) IMRS amplification assays were performed in a 25 µL reaction mixture consisting of Bst 2.0 polymerase (640 U/mL) (New England Biolabs, Massachusetts, USA), with 1× isothermal amplification buffer, 3.2 µM forward primer, and 1.6 µM reverse primer (Jigsaw Biosolutions, Bengaluru, India) combined with 10 mM dNTPs (Thermo Fisher Scientific, Massachusetts, USA), 0.4 M Betaine (Sigma-Aldrich, Missouri, USA), molecular-grade water and Ficoll (0.4 g/mL) (Sigma-Aldrich, Missouri, USA). Amplification was carried out at 56°C for 40 min. Amplified products were visualized by gel electrophoresis in a 1% gel. The negative controls consisted of all the PCR reaction components except template DNA which was substituted with molecular grade water (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

3.6 Lower limit of detection

To assess the lower limit of detection (LLOD) of the T. pallidum IMRS PCR assay, genomic DNA was diluted 100-fold from 100 pg/µL (8.14 x 10⁴ copies/µL) to 10^− 6 pg/µL (< 1 copies/µL) and 10-fold from 100 pg/µL (8.14 x 10⁴ copies/µL) to 10^− 2 pg/µL (< 1 copies/µL) for the gold standard 16S rRNA PCR assay. Thereafter, 5 replicates of each dilution were used for the assays. Amplification products were visualized on gel after electrophoresis. To determine the LLOD of the T. pallidum 16S rRNA and IMRS-PCR assays, probit analysis was performed using the ratio of successful reactions to the total number of reactions performed for each assay. Similarly, to assess the LLOD for the T. pallidum Iso-IMRS-PCR assay, genomic DNA was diluted 10-fold from a starting concentration of 8.14 x 10⁴ copies/µL. Thereafter, probit analysis was performed, considering the ratio of successful reactions to the total number of reactions performed for each assay.

3.7 T. pallidum IMRS and 16S rRNA PCR real-time PCR assay

The Quant Studio 5 Real-Time PCR System, with Quant Studio Design and Analysis Desktop Software v1.5., was used as a reference method for the T. pallidum 16S rRNA PCR and the T. pallidum IMRS-PCR assays as well as to determine the sensitivity of the T. pallidum IMRS and 16S rRNA PCR primers for detecting T. pallidum DNA. The genomic DNA was serially diluted 10-fold starting concentration of 10⁴ genome copies/µL. The final real-time PCR master mix volume was run 10 µL in triplicate and consisted of the following components: 5 µL SYBR Green qPCR Master Mix (Thermo Fisher, Massachusetts, USA), 1 µL forward and reverse IMRS primer mix (0.01 mM) 2.5 µL template genomic DNA and 1.5 µL molecular grade water. The amplification cycling conditions were 50°C for 2 min; 95°C for 10 min; 40 cycles of 95°C for 15 s and 60°C for 30 s.

3.8 Cloning and characterization of T. pallidum-IMRS amplicons

Gene cloning was performed to confirm the sequences of the amplicons obtained from the T. pallidum IMRS PCR assay. T. pallidum gDNA was amplified using Assembly_IMRS-F (TTCCGGATGGCTCGAGTTTTTCAGCAAGATCAGGGTTGCCTGGAAGGAAGCGG) and Assembly IMRS-R (AGAATATTGTAGGAGATCTTCTAGAAAGATACTATTTCCCTGCCGTTGGTGTC) primers. The underlined bold sequences correspond to the IMRS primers for amplifying the T. pallidum genome whereas the bold italicised corresponds to sequences in the cloning vector. The resulting amplicons was resolved on 2% agarose to confirm the fragment size and subsequently purified using the PureLink™ PCR purification kit (Thermo Fisher). The purified amplicon was then ligated into pJET1.2/ blunt vector (Thermo Fisher) using the NEBuilder® HiFi DNA Assembly kit (NEB) as per the manufacturer’s instruction. The resulting NEBuilder HiFi DNA Assembly product was transformed into NEB 5-alpha Competent E. coli (NEB #C2987, NEB) following the manufacturer’s instructions. Transformed colonies were randomly selected, DNA extracted and Sanger-sequenced using the universal pJET1.2 forward sequencing primer (CGACTCACTATAGGGAGAGCGGC) and pJET1.2 reverse? sequencing primer (AAGAACATCGATTTTCCATGGCAG). The resulting nucleotides were trimmed and analysed using SnapGene software (GSL Biotech; available at snapgene.com), aligned to check for similarity or “clonal” differences and BLAST used to check for similarity with the T. pallidum genome.

3.9 Clinical samples

Vaginal swab samples collected from a cohort of women aged between 19–49 years enrolled in an STI screening study at the Kenyatta National Hospital in Nairobi County in 2022 were used in this study. DNA extraction was done using the Qiagen kit (Hilden, Germany) and thereafter, quantification was done using the Nanodrop spectrophotometer instrument. The T. pallidum − 16S rRNA conventional PCR assay was used to confirm T. pallidum infections. Thereafter, T. pallidum positive samples were used to validate the T. pallidum -IMRS primers. Use of these samples and study proposal was approved by the Mount Kenya University Ethical Review Committee (MKU/ERC/1649).

3.10 Data analysis

Graphs were plotted with GraphPad Prism version 7.0 (GraphPad Software, San Diego, CA, USA). The mean, and SD values were calculated in Excel 2016. To determine the LLOD of T. pallidum -IMRS and T. pallidum − 16S rRNA PCR assays (the concentration at which genomic T. pallidum DNA is detected with 95% confidence), probit regression analyses were performed in Excel 2016. Genomic Trichomonas vaginalis were used to determine the specificity of the T. pallidum -IMRS primers for other STIs. Statistical analyses were performed using t-test of GraphPad Prism version 7.0. For two-tailed distributions, P < 0.05 was considered significant.

4.1 Design and Distribution of IMRS Primer Sets on T. pallidum Genome

Repeats were identified that could be used as forward and reverse primers for an amplification assay using the IMRS based genome mining algorithm [9]. A total of 4 repeats were identified and the targeted regions are shown in Table 1. These repeats can inter-changeably serve as forward or reverse primers due to their presence in opposite orientations at various loci of the sense and antisense strands as depicted using a circus plot (Fig. 1A). It was hypothesized that the identified primer pair F 5’- CAGGGTTGCCTGGAAGGAAGCGG-3’ and R 5’- ACTATTTCCCTGCCGTTGGTGTC − 3’ would generate a large number of amplicons, leading to increased analytical sensitivity in PCR assays.

Table 1

IMRS Primer target regions on the *Treponema pallidum* bacterial genome
No.	Amplification regions	Expected sequence fragment
1	136343–136513	171bp
2	153737–153906	170bp
3	333221–333391	171bp
4	673715–673885	171bp

4.2 Amplification of Sequences on T. pallidum Genome using Identical Multi-Repeat Primers and Gold Standard 16S rRNA primers

To confirm the ability and sensitivity of the IMRS primers to amplify the targeted regions in the T. pallidum genome, serially diluted DNA was used as a template for PCR amplification. The IMRS primers could detect T. pallidum genomic DNA from a concentration of as low as 1 fg/µL (Fig. 1B). The gold standard 16S rRNA primers (Fig. 1C) could also detect T. pallidum genomic DNA down to a concentration of 1 fg/µL except for the faint bands. The intensity plots to determine area under the curve were used to estimate the sensitivity of the T. pallidum IMRS primers (Table 2).

Table 2

Calculation of Area Under the Curve PCR band estimates in Fig. 1B and 1C obtained using primers for *Treponema pallidum* -IMRS and 16S rRNA.
Quantification of PCR Amplicons using Area Under the Curve Analysis
IMRS primers	20121.53786 (15684.877–22284.108)
16S rRNA primers	575.7067143 (335.627–1210.506)

4.3 Determination of the Lower Limit of Detection (LLOD) for IMRS PCR and Gold Standard 16S rRNA PCR assay

To determine the lowest limit of detection (LLOD) of the IMRS PCR assay relative to the gold standard 16S rRNA PCR, probit statistic was performed using T. pallidum genomic DNA serially diluted 100-fold and 10-fold and used as template for the T. pallidum -IMRS and 16S RNA PCR assays, respectively (Table 3). Figure 2A shows the probit plot for the T. pallidum -IMRS PCR assay, and Fig. 2B shows the probit plot for the gold standard 16S rRNA PCR assay. The LLOD was calculated as the concentration at which T. pallidum DNA can be detected with 95% confidence. As indicated, the IMRS primers for T. pallidum had an LLOD = 0.03 fg/µL, Fig. 2A. The gold standard primers for T. pallidum had an LLOD = 0.714 pg/µL. Overall, the probit analysis showed that the T. pallidum -IMRS PCR assay had increased sensitivity compared to the gold standard 16S rRNA PCR assay.

Table 3

*Treponema pallidum* genomic DNA was serially diluted 100 folds (IMRS) and 10-folds (16S rRNA) and used as template to estimate the LLOD.
IMRS		16S rRNA
Serial dilutions (pg/µl)	Replicates (5)	Serial dilutions (pg/µl)	Replicates (5)
100	5/5	100	5/5
1	5/5	10	4/5
0.01	5/5	1	3/5
0.0001	5/5	0.1	2/5
0.000001	5/5	0.01	2/5
0.00000001	5/5	0.001	2/5
1E-10	0/5	0.0001	1/5
Coefficient	-0.4123	Coefficient	-7.7857
P-Value	0.9994	P-Value	0.584

Table 4

Demographic characteristics of participants enrolled into the study. 25 participants had confirmed T. pallidum infection as determined by PCR.
Variable		Treponema pallidum positive, n, (%) = 25, (12)	Treponema pallidum negative, n, (%) = 178, (88)	P-Value
Age Category				0.7461
	10–19	0,0	2,1
	20–29	9,4	60,30
	30–39	14,7	100,49
	40–49	2,1	16,8
Marital status				0.0373
	Married	20,10	154,76
	Not Married	5,2	24,12
Level of Education				0.9865
	Primary	2,1	14,7
	Secondary	9,4	65,32
	Tertiary	14,7	99,49
Employment status				0.0001
	Employed	21,10	27,13
	Not employed	4,2	151,74
Parity				0.0047
	Primipara	4,2	35,17
	Multipara	18,9	133,66
	Grandmultipara	3,1	10,5
Gestational Age				0.0736
	First trimester	2,1	11,5
	Second trimester	7,3	36,18
	Third trimester	16,8	131,65
Miscarriage				0.0001
	None	11,5	109,54
	Once	8,4	49,24
	Twice	2,1	14,7
	Thrice	3,1	4,2
	Quadruple	1,0	2,1

4.4 Isothermal Amplification of Genomic T. pallidum DNA

Serially diluted genomic DNA was used to perform Isothermal T. pallidum -IMRS amplification. As shown in Fig. 3A, the reaction products were visualized on a 1% gel. The Iso- T. pallidum -IMRS assay successfully amplified T. pallidum DNA down to < 1 copy/µL. The LLOD for the T. pallidum -Iso-IMRS assay was estimated at 1 fg/µL (Fig. 3B).

Real-time PCR assay was also performed using serially diluted genomic T. pallidum DNA as a template and T. pallidum-IMRS primers or T. pallidum-16S rRNA primers. The mean Ct values at each dilution were used to plot amplification bar graphs (Fig. 4 for T. pallidum -IMRS primers and for T. pallidum-16S rRNA primers). The mean Ct values were statistically significant, P < 0.0001.

4.5 Plasmid T. pallidum -DNA concentration in ng/𝜇l of transformed E. coli cells

To validate the exact regions that were amplified by the T. pallidum -IMRS primers, we cloned the amplicon into blunt cloning vectors and transformed into electrocompetent E. coli cells and plated onto agar plates. DNA transformed E. coli cells was extracted and sequenced. Multiple sequencing alignment confirmed T. pallidum sequences. These results suggested that the T. pallidum -IMRS primers were specific for targets within the genome (Fig. 1 Supplementary file).

4.6 Validation of the T. pallidum -IMRS primers using clinical samples

To validate the specificity of the IMRS primers using clinical samples, 25 T. pallidum positive DNA (Fig. 2 Supplementary file) samples from a cross-sectional study at the Kenyatta National Hospital were used to evaluate the reliability of the T. pallidum -IMRS primers for detecting T. pallidum DNA. The T. pallidum -IMRS primers showed concordance with the results obtained from conventional PCR diagnosis, successfully identifying T. pallidum infections in the infected samples.

4.8 Specificity of the T. pallidum -IMRS primers

As shown in Fig. 3-Supplementary file, the T. pallidum -IMRS primers were specific only for T. pallidum DNA after amplification of C. trachomatis genomic DNA using T. pallidum -IMRS primers. Also, the T. pallidum -IMRS primers were validared using negative samples. No specific amplification was observed, Fig. 4-Supplementary file.

Early diagnosis and treatment of Syphilis is a pillar to the effective control and lessening of complications and transmission [10]. The major obstacle to this initiative are asymptomatic or undiagnosed infections that can only be detected by using T. pallidum screening tests or through notification by an infected partner [11]. Therefore, affordable rapid diagnostic tests (RDTs) and point of care (POC) tests that lead to immediate diagnosis and treatment are particularly valuable tools for syphilis control and treatment [11]. In resource limited countries with no laboratory capacity the World Health Organization (WHO) has developed algorithms for syndromic case management. However, this often leads to unnecessary treatment in 60–98% of T. pallidum cases [11].

In this paper, we highlight a new concept of genome mining that identifies IMRSs distributed throughout the T. pallidum genome and successfully targets them to develop a PCR assay for Syphilis diagnosis. Unlike the traditional PCR, wherein the primers are designed to amplify the specific target sequences, IMRS forward and reverse primers initiate amplification at multiple loci across the genome. This, in turn, improves the overall analytical sensitivity by generating a high number of amplicons.

Molecular techniques based on PCR gene amplification are quite sensitive. As confirmed in a previous study that compared nPCR assay for the detection of T. pallidum gene tpp47 and DFM, nPCR gave significantly better results for T. pallidum detection in patients with primary syphilis (P = 0.011) but not secondary syphilis (P = 0.339) [12]. In addition, the same study reported that the detection of T. pallidum DNA using nPCR in the PBMC fraction (32%) was more sensitive than detection in plasma (12%) and whole-blood (13%) fractions in primary syphilis [13]. In the present study, using T. pallidum -IMRS primers, T. pallidum infection was confirmed in one vaginal clinical sample. Additional experiments with more clinical samples from patients with primary, secondary and tertiary syphilis should be carried out in-order to fully determine the validity of the T. pallidum-IMRS primers. However, the prevalence of Syphilis remains low in Kenya. According to a Kenyan AIDS Indicator survey that enrolled approximately 9000 women, the prevalence of syphilis in women was 1.7%. The same study also reported that HIV infected women were more likely to have Syphilis [14].

A previous study that used 2.5 µL of 10-fold serially diluted T. pallidum DNA as template for loop-mediated isothermal amplification (LAMP) assay targeting the bmp gene, reported a limit of detection of 5.4 × 10^− 6 [15]. In the present study, we reported a lower limit of detection of 0.001 pg/µL using the Isothermal IMRS assay. This data demonstrates the sensitivity and applicability of the T. pallidum -Iso-IMRS assay particularly in the field-setups.

The commercial kit for detection of T. pallidum DNA, Aridia Real-Time PCR Test has a detection limit of between 10–50 copies of DNA [16]. In the present study, using the T. pallidum -IMRS primers for Real-Time PCR amplification, we reported Ct values at starting template DNA concentration of 1000 genome copies. Approximately 1 pg DNA is equivalent to 800 organisms [17]. Also, a previous study that targeted T. pallidum genes, polA and tpp47 in mucosal clinical samples reported a detection threshold of 1 copy/µL of DNA elution [23], The differences reported in the sensitivity are attributable to the experimental design of the previous study where gene cloning was used in the calibration of the qPCR assay. Also different concentration of T. pallidum DNA in the starting material accounted for differences in the detection limits.

Studies have reported low detection sensitivity of T. pallidum in blood samples, however, lysis of Red Blood Cells has been found to increase sensitivity upto 1 × 10² treponemes/mL. Lysis increases the detection limit of T. pallidum in RBCs as compared to whole blood, serum and plasma [26].

A previous PCR study that targeted polA and 47 kDa gene targets confirmed high sensitivity for T. pallidum in oral and anal samples. Oral and anal shedding of T pallidum occurs in patients with secondary syphilis, suggesting that at this stage, secondary syphilis is highly infectious [27]. Our study used samples from another study to validate the @erformance of the T. pallidum IMRS assay. The clinical data revealed that most of the participants had primary syphilis infection.

Several studies have confirmed that Nucleic Acid Amplification Tests _(NAATs) are alternative sensitive molecular tests for the direct detection of T. pallidum infection [18]–[24]. These assays are pathogenic treponeme specific: 95–97%, [18], [24] and therefore rectal and oral specimens may be tested with a reported limit of detection as low as 1–65 organisms [18]–[22].

Assay	Sample	Target	Limit of Detection	Reference
nPCR	Plasma	polA	3 T. pallidum/mL	https://doi.org/10.1128/spectrum.01772-21
	Plasma	Tpp47	15 T. pallidum/mL
	Urine	polA	30 T. pallidum/mL
	Urine	Tpp47	30 T. pallidum/mL

T. pallidum-IMRS primers were more sensitive as compared to the conventional 16rRNA T. pallidum primers as shown by the area under the curve analysis, Table 2. In addition, probit analysis calculation to determine the lower limit of detection confirmed that the T. pallidum -IMRS primers offered higher test sensitivity of 0.03 fg/𝜇l starting PCR template concentration (Fig. 3). Using the T. pallidum -IMRS primers, we were able to observe considerable Isothermal amplification of genomic DNA at concentration of 0.01 pg/µL.

In this study, we evaluated the detection of the T. pallidum genome using T. pallidum -IMRS primers. Overall, the detection threshold was high and the assay gave results that were highly concordant with syphilis diagnosis. Given the high sensitivity of the T. pallidum -IMRS primers, asymptomatic cases can be identified and therefore greatly enhance early case detection.

The use of the T. pallidum-IMRS primers when modified with fluorescent tags can be used to achieve a visual read-out of pathogen DNA this can then be utilized in the development of a Lateral Flow Assay (LFA) as has been described [28]. Also a simple and integrated platform based on microscale immiscible filtration and isothermal amplification for colorimetric detection of T. pallidum DNA can also be developed as it has been described [29].

The T. pallidum -IMRS Isothermal amplification assay may be improved by using fluorescent tags to achieve a visual read out signal and used reliably for the detection of Syphilis in a simple low-tech but sensitive assay format providing an alternative to more complex molecular tests for diagnosis. Additionally, the assay eliminates challenges associated with conventional molecular tests and provides new opportunities to diagnose Syphilis in point of care settings. For accurate interpretation of amplicons from IMRS PCR assays, qPCR using specific probes can be optimized.

Ethical Statement

Use of these samples and study proposal was approved by the Mount Kenya University Ethical Review Committee (MKU/ERC/1649).

Data Availability

All Data have been presented in this manuscript. All raw data has been uploaded and can be found on the link below

https://doi.org/10.5281/zenodo.10659164

Competing Interests

We have no competing interests.

Funding Statement

This research was supported by the Royal Society, Future Leaders African Independent Researchers (FLAIR) Scheme (FLR\R1\201314) to JG
Authors' Contributions

C.S.: conceptualization, data curation, formal analysis, methodology, writing—original draft; S.K.: data curation, formal analysis, investigation, methodology, supervision, visualization, writing—original draft, writing—review and editing; B.N.K.: investigation, writing—review and editing; R.K.: resources, writing—review and editing; M.M.: resources, writing—review and editing; H.W.: resources, writing—review and editing; M.K.: resources, writing—review and editing; I.N.: resources, writing—review and editing; H.M.A.: resources, writing—review and editing; B.O.: funding acquisition, writing—review and editing; N.P.: resources, writing—review and editing; .J.D.: writing—review and editing; C.M.K.: resources, writing—review and editing; S.R.L.: methodology, writing—review and editing; J.G.: conceptualization, funding acquisition, investigation, methodology, project administration, resources, supervision, writing—original draft, writing—review and editing.

Acknowledgement

We thank Dr. Karen Muthembwa and all clinicians working at the STI Clinic in Kenyatta National Hospital

World Health Organization (2022) Global health sector strategies on, respectively, HIV, viral hepatitis and sexually transmitted infections for the period 2022–2030, no. 8.5.2017
Stamm LV (2010) Global challenge of antibiotic-resistant Treponema pallidum. Antimicrob Agents Chemother 54(2):583–589. 10.1128/AAC.01095-09
World Health Organization (2016) WHO guidelines for the treatment of Treponema pallidum. World Heal Organ 2(398):180. 10.1136/bmj.2.398.180-b
Mata-Marín JA et al (2015) Prevalence of antibodies against Treponema pallidum among HIV-positive patients in a tertiary care hospital in Mexico. Int J STD AIDS 26(2):81–85. 10.1177/0956462414530888
Badie BM et al (2013) Prevalence survey of infection with Treponema pallidum among HIV-positive patients in Tehran. Asian Pac J Trop Biomed 3(4):334–336. 10.1016/S2221-1691(13)60074-X
Zhou C, Zhang X, Zhang W, Duan J, Zhao F (2019) PCR detection for syphilis diagnosis: Status and prospects. J Clin Lab Anal 33(5):1–8. 10.1002/jcla.22890
Theel ES, Katz SS, Pillay A (2020) Molecular and Direct Detection Tests for Treponema pallidum Subspecies pallidum: A Review of the Literature, 1964–2017. Clin Infect Dis 71(1):S4–S12. 10.1093/cid/ciaa176
Grange PA et al (2021) Use of a multiplex PCR assay to assess the presence of treponema pallidum in mucocutaneous ulcerations in patients with suspected syphilis. J Clin Microbiol 59(2):1–9. 10.1128/JCM.01994-20
Raju LS et al (2019) Genome Mining–Based Identification of Identical Multirepeat Sequences in Plasmodium falciparum Genome for Highly Sensitive Real-Time Quantitative PCR Assay and Its Application in Malaria Diagnosis. J Mol Diagnostics 21(5):824–838. 10.1016/j.jmoldx.2019.04.004
Peeling RW, Mabey D, Herring A, Hook EW (2006) Why do we need quality-assured diagnostic tests for sexually transmitted infections? Nat Rev Microbiol 4:S7–S19. 10.1038/nrmicro1569
Behets FMT et al (1995) Management of vaginal discharge in women treated at a jamaican sexually transmitted disease clinic: Use of diagnostic algorithms versus laboratory testing. Clin Infect Dis 21(6):1450–1455. 10.1093/clinids/21.6.1450
Grange PA et al (2012) Evaluation of a PCR test for detection of Treponema pallidum in swabs and blood. J Clin Microbiol 50(3):546–552. 10.1128/JCM.00702-11
Gayet-Ageron A et al (2015) Use of treponema pallidum PCR in testing of ulcers for diagnosis of primary syphilis. Emerg Infect Dis 21(1):127–129. 10.3201/eid2101.140790
Otieno-Nyunya B et al (2011) Epidemiology of syphilis in Kenya: Results from a nationally representative serological survey. Sex Transm Infect 87:521–525. 10.1136/sextrans-2011-050026
Xiao Y et al (2017) Development and evaluation of a loop-mediated isothermal amplification assay for the detection of treponema pallidum DNA in the peripheral blood of secondary syphilis patients. Am J Trop Med Hyg 97(6):1673–1678. 10.4269/ajtmh.17-0051
Chen W et al (2022) A suite of PCR-LwCas13a assays for detection and genotyping of Treponema pallidum in clinical samples. Nat Commun 13(1):1–11. 10.1038/s41467-022-32250-y
Palmer HM, Higgins SP, Herring AJ, Kingston MA (2003) Use of PCR in the diagnosis of early syphilis in the United Kingdom. Sex Transm Infect 79(6):479–483. 10.1136/sti.79.6.479
Orle KA, Gates CA, Martin DH, Body BA, Weiss JB (1996) Simultaneous PCR detection of Haemophilus ducreyi, treponema pallidum, and herpes simplex virus types 1 and 2 from genital ulcers. J Clin Microbiol 34(1):49–54. 10.1128/jcm.34.1.49-54.1996
Hay PE, Clarke JR, Strugnell RA, Taylor-Robinson D, Goldmeier D (1990) Use of the polymerase chain reaction to detect DNA sequences specific to pathogenic treponemes in cerebrospinal fluid. FEMS Microbiol Lett 68(3):233–238. 10.1016/S0378-1097(05)80046-1
Burstain JM, Grimprel E, Lukehart SA, Norgard MV, Radolf JD (1991) Sensitive detection of Treponema pallidum by using the polymerase chain reaction. J Clin Microbiol 29(1):62–69. 10.1128/jcm.29.1.62-69.1991
Noordhoek GT, Wolters EC, De Jonge MEJ, Van Embden JDA (1991) Detection by polymerase chain reaction of Treponema pallidum DNA in cerebrospinal fluid from neurosyphilis patients before and after antibiotic treatment. J Clin Microbiol 29(9):1976–1984. 10.1128/jcm.29.9.1976-1984.1991
Centurion-Lara A, Castro C, Shaffer JM, Van Voorhis WC, Marra CM, Lukehart SA (1997) Detection of Treponema pallidum by a sensitive reverse transcriptase PCR. J Clin Microbiol 35(6):1348–1352. 10.1128/jcm.35.6.1348-1352.1997
Centurion-Lara A, Castro C, Castillo R, Shaffer JM, Van Voorhis WC, Lukehart SA (1998) The flanking region sequences of the 15-kDa lipoprotein gene differentiate pathogenic treponemes. J Infect Dis 177(4):1036–1040. 10.1086/515247
Liu H, Rodes B, Chen CY, Steiner B (2001) New tests for syphilis: Rational design of a PCR method for detection of Treponema pallidum in clinical specimens using unique regions of the DNA polymerase I gene. J Clin Microbiol 39(5):1941–1946. 10.1128/JCM.39.5.1941-1946.2001
Salle R et al (2023) Specific detection of Treponema pallidum in clinical samples: validation of a qPCR assay combining two genomic targets. Sex Transm Infect 99(2):91–96
Wei Z-H et al (2023) Red Blood Cell Lysis Pretreatment Can Significantly Improve the Yield of Treponema pallidum DNA from Blood. Microbiol Spectr 11(3):e05198–e05122
Towns JM et al (2021) Treponema pallidum detection in lesion and non-lesion sites in men who have sex with men with early syphilis: a prospective, cross-sectional study. Lancet Infect Dis 21(9):1324–1331
Peters RPH, Klausner JD, Mazzola L, Mdingi MM, Jung H, Gigi RMS, Piton J, Daniels J, de Vos L, Adamson PC, Gleeson B, Ferreyra C Novel lateral flow assay for point-of-care detection of Neisseria gonorrhoeae infection in syndromic management settings: a cross-sectional performance evaluation. Lancet 2024 Feb 6:S0140-6736(23)02240-7. 10.1016/S0140-6736(23)02240-7. Epub ahead of print. PMID: 38335982.
Rodriguez-Mateos P, Ngamsom B, Ameyo D, Wakaba P, Shiluli C, Iles A, Gitaka J, Pamme N (2023) Integrated microscale immiscible phase extraction and isothermal amplification for colorimetric detection of Neisseria gonorrhoeae. Anal Bioanal Chem 415(21):5129–5137. 10.1007/s00216-023-04734-3Epub 2023 May 18. PMID: 37198361; PMCID: PMC10191819

The authors declare no competing interests.

Download PDF

Version 1

posted

You are reading this latest preprint version

Highly Sensitive Molecular Assay for the Detection of Treponema pallidum infection

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

3.2 T. pallidum Genomic DNA Preparation

3.3 16S rRNA PCR assay

3.4 T. pallidum IMRS PCR assay

3.5 Isothermal IMRS Amplification Assay

3.6 Lower limit of detection

3.7 T. pallidum IMRS and 16S rRNA PCR real-time PCR assay

3.8 Cloning and characterization of T. pallidum-IMRS amplicons

3.9 Clinical samples

3.10 Data analysis

Results

4.1 Design and Distribution of IMRS Primer Sets on T. pallidum Genome

4.4 Isothermal Amplification of Genomic T. pallidum DNA

4.5 Plasmid T. pallidum -DNA concentration in ng/𝜇l of transformed E. coli cells

4.6 Validation of the T. pallidum -IMRS primers using clinical samples

4.8 Specificity of the T. pallidum -IMRS primers

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1