Organic extraction process for preparation of alcoholic oil extracts
Fresh O. Europaea and A. hypogaea were purchased from a local herbal supplier in Lahore Pakistan and were authenticated by a certified taxonomist and its consent was taken before starting the protocol. Fresh fruits of O. Europaea and A. hypogaea were rinsed with fresh water to remove the extraneous matter and fruits were dried under shade for 7 days. Size reduction was done using a knife and pulverized using an electrical grinder and blender. 100g powder was soaked for 7 days in HPLC- graded ethanol (500 ml) or n-hexane (500 ml) and incubated at room temperature with occasional agitation and then macerated for seven days thrice separately. Mixtures were strained through muslin fabric followed by Whatman filter paper Grade 42, 2.5µm size. Filtrates were then concentrated at 37°C in a rotary evaporator (IKA Germany RV 10B S99) and pressure of 200mmHg in a water bath connected with a vacuum gauge and vacuum pump (Jones & Kinghorn, 2012).
Rotary evaporator procedure for preparation of alcoholic extracts
The round bottom flask was removed from the base of the condenser and was inspected to ensure that it is clean. Then, the sample was loaded into the cleaned round bottom flask which was then, attached to the condenser. Vacuum grease was used to create a vacuum seal between the condenser and the round bottom flask. The collection flask was inspected. Cabinet doors were opened. The chiller was turned sideways tubing was securely connected to the back of the chiller and condenser. The chiller was turned ON using a power switch and set at 20°C. To change the temperature, the knob was rotated and the vacuum pump was turned ON. A hot bath was filled with a round bottom flask to fit in it. UP and DOWN keys were used to raise or lower the setup. A freeze-dried extract was obtained from the liquid extract obtained at 50oC by using a 100% alcoholic mixture (Raaman, 2006).
Freeze drying method for preparation of alcoholic oil extracts
Before freeze-drying, alcohol was removed by a rotary evaporator, and later, the leftover over extract was submitted to freeze-drying. Initially, samples were frozen with liquid nitrogen (-196°C), equilibrated at -80oC, for 2 hrs and then submitted to freeze-drying in a Labconco Freeze Dry System (Labconco Corporation, U.S.A.) at 1.5×10−4 mbar during 72 h. The moisture content of the freeze-dried particles were determined gravimetrically by weighing small amounts of dried particles i.e. 0.5 g before & after drying in an oven at 110°C. Thereafter, extracts were dried in an incubator. The percentage yield was calculated as 15% for ethanolic oil extract of O. Europaea and 7% for n-hexane extract. A dose of 200 mg/kg body weight was used The weight of rats is between 250-300g. The extract yield of the fresh fruits of O. Europaea and A. hypogaea was calculated using the formula:
Table 1: Percentage yield when solvents were used (mg/100 g crude extract).
Medicinal Plant
|
Ethanolic
|
n-Hexane
|
Olea Europaea
|
2.98 ± 0.86
|
5.74 ± 0.36
|
Arachis Hypogaea
|
3.87 ± 0.56
|
4.74 ± 0.26
|
Separation funnel method for collection of oil
When four different solvents (n-hexane, ethanol) are selected, fractionation begins by moistening or complete dissolution of crude extract with 250mL of water. This is followed by transfer into a separating funnel, shaken, and allowed to settle. Furthermore, to 250mL of n-hexane, the least polar solvent was added and shaken. The content can settle, and the bottom of the separating funnel opened to remove the aqueous layer. The remaining content in the separating funnel was poured into a clean container to get n-hexane fraction. Equal volume of n-hexane was added again, shaken, and separated. The addition continued until after adding n-hexane and shaken no reasonable quantity of extract appeared to move into the n-hexane portion. Similar cycle was performed for ethanol, methanol, petroleum ether and diethyl acetate fractions (Scopetani et al. 2020).
Quantitative analysis of alcoholic extracts of O. Europaea and A. Hypogaea extracts
Determination of total phenolic content
Folin-Ciocalteu (FC reagent) method was used to determine total phenolic content in aerial parts (50 mg/ml in ethanol) of O. Europaea and Gallic acid (100 µg/ml) is used as standard in concentration range of 2-10 µg/ml. The absorbance was measured at wavelength range of 650-760 nm within Shimadzu double beam UV/Visible spectrophotometer. The standard calibration curve was plotted with Gallic acid as standard and expression of results were done by Gallic acid equivalent (GAE) per gram of dry weight of aerial parts of O. Europaea and A. hypogaea oils (Cao et al., 2020).
Determination of total flavonoid content
The total flavonoid content in aerial parts of O. Europaea and A. hypogaea oils (0.5 ml of extract, 50 mg/ml in methanol) was determined by UV colorimetric method containing aluminum chloride reported by Chia-Chi Chang (2002). Quercetin was used as a standard solution in range 20-200ug/ml which is used to calculate the flavonoid content. The absorbance of the reaction mixture is to be measured at 415 nm with a Shimadzu double beam UV/Visible spectrophotometer (Chang et al., 2002). The Total flavonoid content was calculated from the standard curve and reported as quercetin equivalent in the literature (% w/w).
Determination of total tannins content
Folin-Ciocalteau method is used to determine total tannins content. Different aliquot parts were used which included 100 µl extract plus 750 µl of deionized water plus 30% of sodium carbonate and 500 µl of FC reagent. Dilution was done with 10 milliliters of deionized water and was shaken vigorously with contained mixture extract. 30 minutes’ incubation time was required at room temperature and read at 725 nm UV vis Shimadzu double beam spectrophotometer. The blank contained deionized water whereas Gallic acid was used as standard solution. The GAE were expressed as Gallic acid equivalent (Ogawa & Yazaki 2018).
Determination of total alkaloids content
As far as determination of phytochemical method of O. Europaea and A. hypogaea oils is concerned, 1/2 g of O. Europaea and A. hypogaea oils extracts specimens were added supplementary, in particular test tube and 4 milliliter of n-hexane fraction were blended in it, with vigorous shaking and filtration. At that instance take 10 milliliters of 5% HCl along with pouring in a test tube having the mixture of plant extract and hexane. Plant extract macerate was heated in test tube; filtration was done with pouring of certain drops of picric acid in plant extract’s macerate. Formation of yellow colored precipitates indicates the presence of alkaloids (Ajanal et al. 2012).
Determinations of total carotenoids content
Preparation of Standard Beta-Carotene solution was done. Approximately 5.0 ml of n-hexane was dissolved in 1 mg of β-carotene which gives an equivalent amount of 500 micrograms/milliliter. From this solution, 20 microliters were diluted to 10 ml to have a solution equivalent to 1 mg/ml. The absorbance of this solution was taken at 450 nm in a spectrophotometer using extinction coefficient value of beta-carotene then the solution was made 1 mg/ml. The absorbance of this solution was recorded. Carotenoids show characteristics absorbance spectra, for example, Beta-carotene has an absorption maximum of 450 nm in n-hexane with a molecular extinction coefficient of 2590. Therefore, to estimate total carotenoid in the eluent, absorbance of it was read on a spectrophotometer at 450 nm using a 1 cm cell (Barba et al. 2006).
The total carotenoid concentrated is determined by using the formula below:
Total carotenoid content (µg/g): A = Absorbance at 450 nm,
Volume = Total volume of extract (25 or 50 ml) A1%-cm = Absorption coefficient of β-carotene in petroleum ether
Determination of total steroids content
Steroid solution containing 1 ml of each fraction of plant extracts was transferred in the volumetric flask of quantity 10 ml. 2ml of 4 normal solutions of sulphuric acid prepared plus 2 ml of the 0.5% weight/volume ferric chloride solution, in addition to 0.5 % weight/volume potassium hexa-cyanoferrate solution is added. The temperature required for maintaining water bath stays within range of 75±25ºC for 35 minutes with vigorous shaking and diluted up to the mark with deionized water. The absorbance was measured at 780 nm against the blank using spectrophotometer (Görög 2012).
Antioxidant evaluation of O. Europaea and A. Hypogaea oils
Herbals affluently rich in secondary metabolites, in conjunction to antioxidant phenolics, flavonoids and carotenoids have antioxidant activity, by virtue of their redox potential and chemical structures. The crude ethanolic and n-hexane extracts of O. Europaea and A. hypogaea oils had robust antioxidant potential, contrary to entire free radicals computed. The 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical is generally used in assessing free radical scavenging activity (Munteanu & Apetrei 2021). The stock solution containing plant sample of concentration (1.0 mg/ ml) was diluted to final concentrations of 10 µg/ml, 20 µg/ml, 50 µg/ml ,100 µg/ml, 250 µg/ml, 500 µg/ml in either ethanol or n-hexane. An average of 1 ml of a 0.5 millimolar DPPH ethanol solution/n-hexane solution was added to 3.0 ml of the sample solution, with various dilutions shaking in an orbital shaker and was permitted to function at optimum temperature. Subsequently, after 45 minutes absorbance values were recorded at 518 nm as well as converted into percentage anti-oxidative potential employing the following mathematical statement described below:
Afterwards, a curve of % DPPH scavenging capacity versus concentration was plotted and IC50 values were calculated. IC50 denotes the concentration of sample required to scavenge 50% of DPPH free radicals with reference to bioactive modulation of crude extracts is concerned, flavonoids and antioxidant phenolics are responsible (Marinova & Batchvarov, 2011). In regards to vastly scavenging efficacious nature of flavonoids is concerned, predominantly oxidizing molecular species, including singlet oxygen, and various other free radicals implicated in several diseases. Flavonoids suppress reactive oxygen formation, chelate trace elements involved in free-radical production, scavenge reactive species and upregulate and protect antioxidant defenses. Similarly, phenolics conferring oxidative stress tolerance on plants.
Elemental analysis of O. Europaea and A. Hypogaea oil extracts
The O. Europaea and A. hypogaea oil extract were subjected to analysis of major elements such as calcium, potassium, sulfur and trace elements (iron, copper, and zinc) according to the method of camri.
Table 2: Elemental Analysis of the Ethanol and n-hexane Extracts of O. europaea and A. hypogaea
|
Minerals
|
Olea Europaea
|
Arachis Hypogaea
|
1
|
Calcium
|
36.3003 ±1.23
|
3.108 ± 0.17
|
2
|
Iron
|
0.694 ± 0.12
|
4.500 ± 0.25
|
3
|
Potassium
|
22.332 ± 1.12
|
3.049 ± 0.20
|
4
|
Magnesium
|
4.708 ± 0.21
|
0.408 ± 0.03
|
5
|
Sodium
|
3.149 ± 0.19
|
22.332 ± 1.16
|
6
|
Phosphorus
|
0.408 ± 0.05
|
0.694 ± 0.15
|
7
|
Sulphur
|
1.467 ± 1.00
|
0.033 ± 0.004
|
8
|
Zinc
|
0.033 ± 0.002
|
1.032 ± 1.16
|
The mineral content was determined using inductively coupled plasma atomic emission spectrophotometer (Hitachi, USA, ZA3300). It is an analytical method which uses flame with atomic absorption and flame photometry. Optical model with Double beam (Polarized Zeeman method). Sample chamber switching is not required in case of Atomic absorption spectrophotometer. Diffraction grating for ZA3300 model turns out to be Czerny-Turner mount, 1800 Lines /mm, Blazed at 200nm. Wavelength range setting was 190 to 900 nm with automatic spectral peak setting. Focal length, reciprocal dispersion is 400 mm, 1.3 nm /mm. Slit width is in 4 steps i.e. 0.2, 0.4, 1.3, 2.6 nm. Photomultiplier detector was with 2 pieces. Number of lamps turn-on current were 8 Lamps (turret), 2 Lamps with simultaneous lightning, 1.0 to 20 mA (average amperage). The Pre-mix fish tail type burner is installed in ZA 3300 model atomic absorption spectrophotometer (Van Loon. 2012). Number of sample containers are 60 pcs of 1.5 mL container each with 96 micro plate option available. Contiguous dispensing with sample injection volume up to 1-100ul. The concentration of each element in the sample was calculated as the percentage of dry matter. 10 mg of the O. Europaea and A. hypogaea oils were extracted successively with petroleum ether at 42-62°C B.p., ethanol and n- hexane, and using rotary evaporator apparatus. The separation with each solvent system, was carried out prior to the solvent was achromatic for 20 hours. Decisively, the mark left was separated with deionized water digesting on a warming water bath. The separation was continued until a few drops of the last portion of the extract left no residue on drying. The extracts were taken in a tared porcelain dish and evaporated to dryness on a water bath and dried at 105°C to a constant weight (Hart & Fisher. 2012). The percentage extractives were calculated with reference to air-dried drug.
Gas chromatography mass spectrometric analysis of O. Europaea and A. Hypogaea oils
GC-MS analysis of O. Europaea and A. hypogaea oils was performed using the equipment Agilent Technologies Ultra Version: 6.0, MS Model 5975C GC model 7890°A equipped with a fused silica column. Control Information (Sample inlet: GC, Injection Source: PAL sampler, Mass Spectrometer: Enabled, Injection Volume: 1ul, Overlap Injection Mode: No Overlap) PAL Method Information (Syringe: 10ul, Cycle: MACRO GC_ Liq4-V2). Parameters of the PAL cycle {(Air Volume (ul): 0, Pre Clean with Solvent 1: 2, Pre clean with Solvent 2: 0, % Syringe Fill for Cleaning (%): 40, Pre Clean with Sample: 0, Sample Amount for Cleaning (ul): 0, Filling Speed (ul/s): 2, Filling Strokes:1, Inject to: GC Inj 1, Injection Speed: (ul/s): 50, Pre inject Delay (MS):500, Post Inject Delay (MS): 500, Post Clean with Solvent 1: 0, Post Clean with Solvent 2 :2, Oven, Equilibrium Time:0.5min, Max Temperature: 350 degrees C, Slow Fan: Disabled, Oven Program : ON, 50° C: for 3 min : # 1 then 7 °C/min to 180 °C for 20 min, # 2 then 7 °C/min to 300 °C for 30 min, Run Time : 88.714min, QQQ Collision Cell EPC : He Quench gas : Off, N2 Collision Gas: Off, Sample Overlap : Sample Overlap is not enabled, Front SS Inlet He, Mode: Split, Heater: On 260°C, Pressure : On 9.05 Psi, Total Flow : On 26.709mL/min, Septum Purge Flow : On 3mL/min, Gas Saver : On 20mL/min after 2min, Split Ratio: 20:1, Split Flow : 22.58ml/min, Thermal Aux 2 ( MSD Transfer Line) : Heater : ON, Temperature Program : On 260°C for 0 min, Run Time : 88.714 min, Column # 1: OPTIMA –OPTIMA 5MS ; 340 °C: 30m × 250um × 0.25 um, In : Front SS Inlet He, Out: Vacuum, (Initial ) : 50°C , Pressure : 9.05 Psi, Flow : 1.129mL/min, Average Velocity : 38.724 cm/sec, Hold Up Time : 1.2912 min, Flow Program : On 1.129mL/min for 0 min, Run Time : 88.714 min, Signals : Signal # 1 : Test Plot : Save Off 50Hz, Signal # 2 : Test Plot : Save Off 50Hz, Signal # 3 : Test Plot : Save Off 50Hz, Signal # 4 : Test Plot : Save Off 50Hz}. Many phytoconstituents were obtained from GC-MS spectra Oleuropein, Fagarasterol etc (Karasek & Clement, 2012).
Liquid chromatography–mass spectrometric analysis O. Europaea and A. Hypogaea oils
An Agilent 1100 HPLC Series system (Agilent, USA) equipped with a degasser, binary gradient pump, column thermostat, auto sampler, and UV detector, was used. The LC system was coupled with an Agilent 1100 mass spectrometer (LC/MS). For the separation, a reverse-phase analytical column was employed (Zorbax SB- C18 column of 1.8ùm 2.1 × 50 mm particle); the work temperature was 48°C. The detection of compounds was performed on both UV and MS mode (MS Model 5975C). The UV detector was set at 350 nm until 17.5 min, then at 380 nm. The MS system operated using an electrospray ion source in negative mode. The chromatographic data were processed using ChemStation and Data Analysis software from Agilent, USA. The mobile phase was a binary gradient: acetonitrile and formic acid 0.05% (v/v). The elution started with a linear gradient, beginning with 5% acetonitrile and ending at 42% acetonitrile, for 35 minutes; then 42% acetonitrile for the next 3 minutes (López-Fernández et al. 2020)
In vivo studies
Sample collection
A total of 8 groups of 4-6 months old Sprague-Dawley albino rats were bred at Animal house, Institute of Molecular Biology and Biotechnology, The University of Lahore, Lahore, Pakistan after fulfilling all ethical considerations. Serum samples of lipopolysaccharide-induced rats (n=64) were collected. O. Europaea and A. hypogaea were purchased from local herbal market, Lahore, Pakistan.
Induction of neurotoxicity
Lipopolysaccharide (LPS) with concentration 0.1µg/µl prepared in normal saline (N/S). The Lumbosacral (LS) injection of Lipopolysaccharide was injected at 15µg/rat (7.5µg in 5µl/site) using Hamilton micro syringe; for 28 days to induce neurotoxicity. Induced neurotoxicity was later confirmed by Complete Blood Count (CBC), and histopathology. LS injection of Lipopolysaccharide dissolved in normal saline 15 µg/rat (7.5 µg in 5 µl/site), bilaterally into the lumbosacral region using Hamilton micro syringe, Lipopolysaccharide (LPS)+ N/S @ (0.3ml/kg B. wt. /day) for 14 days. Olive Oil Extract (OE), Peanut oil Extract (PE) @ (200 mg/Kg B. wt. /day) for 14 days. Nimodipine® @ (30 mg/Kg B. wt. /day) for 14 days, -Interferon alpha @ 1.5ug/kg for 14 days, Dimethyl fumarate 120mg/kg for 14 days.
Table 3: Experimental Design Related To Induction of Neurotoxicity
Groups (n=8)
|
Treatments
|
LPS (15 µg, icv)
|
Phytochemicals
(200 mg/kg BW per oral)
|
A
|
No (Sham Control)
|
Nil
|
B
|
Yes (Control)
|
Nil
|
C
|
Yes
|
LPS+NIM®
|
D
|
Yes
|
LPS+INF®
|
E
|
Yes
|
LPS+DMF®
|
F
|
Yes
|
LPS+OE
|
G
|
Yes
|
LPS+PE
|
H
|
Yes
|
LPS+OE+PE
|
Development of lipopolysaccharide induced experimental autoimmune encephalomyelitis (EAE) model
The SD rats were treated with intracerbroventricualr (icv) injection of Lipopolysaccharide (Batista et al., 2019). Briefly, the rats were anaesthetized with pentobarbital 45 mg/kg body weight) and placed in stereotaxic apparatus. Through a midline sagittal incision, the scalp was reflected and two drill holes made in the skull for placement of the injection canula in the lateral cerebral ventricle. The animals were given post-operative antibiotic (safinamide 5 mg/kg, intraperitoneally) to ward off sepsis. Rats were then administered rotenone (15 µg dissolved in 5 µl of artificial cerebrospinal fluid) using Hamilton micro syringe. To facilitate drµg diffusion, the canula was left in place for 2–3 min after the injection. The wound was then sealed with sterile wax and Neosporin powder sprayed externally as an additional antiseptic measure.
Determination of antioxidants and reactive oxygen species (ROS) in the serum of albino rats
Lipid peroxidation in blood samples was estimated calorimetrically by measuring Thiobarbituric acid reactive substances (TBARS) (De Leon & Borges, 2020). In cell culture medium and biological fluids, nitrogen oxide level was estimated by analyzing stable nitrogen oxide derived oxidation products; NO2-and NO3-. The concentration of nitrite was measured by Calorimetric Griess assay (Romitelli et al. 2007). Superoxide dismutase (SOD) activity determined by the method of Weydert and Cullen (2010). Meanwhile anti-8-hydroxydeoxyguanosine Antibody kit (catalog number AB5830) Sigma-Aldrich, was used to determine level of 8-hydroxy-2'–deoxyguanosine (8-OHdG). The levels of matrix metalloproteinases-8 (MMP-8) were also measured by human available diagnostic ELISA kit (ABCAM).
Quantitative real-time PCR
Total RNA at various time points was isolated using TRizol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA and an oligo (dT)18 primer (TaKaRa Biotechnology, Dalian, China). Real-time quantitative reverse transcription PCR (qRT-PCR) was performed using an SYBR Green PCR Kit (Roche, Basel, Switzerland) by equipment (Applied Biosystems, Foster City, CA, USA). A 20 µl reaction mixture contained 10µl of SYBR Green buffer, 0.5µl of forward primer, 0.5 µl of reverse primer, 1 µl of H2O and 8 µl of cDNA. GAPDH was used as the internal control. Specific primers for the target genes were designed using Primer 5.0 based on the corresponding gene sequences of the proteins. The data was analyzed using VII-A7 software (Applied Biosystems, Foster City, CA, USA) in a relative quantification study model.
Table 4: PCR reaction mixture (20 μl)
PCR master mix component
|
Volume per reaction
|
cDNA template
|
8 μl
|
SYBR green master mix with ROX
|
10 μl
|
Primer pair mix
|
1.5 μl from 10μM working solution
|
Nuclease free water
|
6.5 μl
|
Total Volume
|
20 μl
|
Table 5: Primer sequences of IL-6, INF-α, TNF- α, GAPDH, β-actin and MMP-8
Gene
|
Direction
|
Sequence
|
IL-6
|
Forward
|
5΄AGGAGACTTGCCTGGTGAAA 3΄
|
|
Reverse
|
5΄CAGGGGTGGTTATTGCATCT 3΄
|
INF-α
|
Forward
|
5΄GCCTCGCCCTTTGCTTTACT 3΄
|
|
Reverse
|
5΄CTGTGGGTCTCAGGGAGATCA 3
|
TNF-α
|
Forward
|
5΄GAGGCCAAGCCCTGGTATG 3΄
|
|
Reverse
|
5΄CGGGCCGATTGATCTCAGC 3΄
|
GAPDH
|
Forward
|
5΄GCACCGTCAAGGCTGAGAAC 3΄
|
|
Reverse
|
5΄TGGTGAAGACGCCAGTGGA 3΄
|
β-actin
|
Forward
|
5΄CACCTTCTACAATGAGCTGC 3΄
|
|
Reverse
|
5΄AGGCAGCTCGTAGCTCTTCT 3΄
|
MMP-8
|
Forward
|
5΄ATGGACCAACACCTCCGCAA 3΄
|
|
Reverse
|
5΄GTCAATTGCTTGGACGCTGC 3΄
|
HISTOPATHOLOGICAL EXAMINATION
The histopathology of the tissue samples (brain, liver, and kidneys) was performed according to the procedures described by Bancroft (2019). The tissue slides were stained using hematoxylin and eosin (H&E) staining procedure.
Table 6: Steps for Tissue Dehydration, Fixation and Embedding
Name of Step
|
Reagent used
|
Duration
|
Fixation
|
10% neutral buffered formalin
|
24-72 hours
|
Washing
|
Running tap water
|
2-4 hours
|
Dehydration
|
Graded alcohol
|
70%
|
1 hour
|
80%
|
1 hour
|
95%
|
1 hour
|
100%
|
1 hour
|
Clearing
|
Xylene
|
Xylene 1
|
30 minutes
|
Xylene 2
|
30 minutes
|
Xylene 3
|
45 minutes
|
Embedding
|
Paraffin wax at 58ºC
|
Paraffin wax 1
|
30 minutes
|
Paraffin wax 2
|
30 minutes
|
Paraffin wax 3
|
30 minutes
|
Paraffin wax 4
|
45 minutes
|
Histopathological examination
Sample for analysis was collected from affected tissue regions and preserved in freshly prepared formalin at a volume ratio o 1:10 of tissue: formalin. The same process was carried out for all the samples.
Steps of tissue fixation and processing
Tissue fixation involves dehydrating the tissues using different alcohol solutions and xylene and then fixing the tissues in preheated paraffin for cutting and sectioning. For dehydration different alcohol concentrations are used mentioned.
Block preparation
Block preparation was carried out with steel molds using paraffin. Tissues from 60 ºC were embedded in blocks and placed immediately in refrigerator at 4 ºC for a day or at -20 ºC for long term preservation.
Sectioning
Microtome was used for sectioning and cutting of block. Microtome was adjusted to cut sections with 4-6 μm. Sections were immediately placed in cold water for five seconds and then transferred to water bath preheated to 45ºC before placing them onto slides.
Section mounting on glass slides
Adherent slides were prepared using protocol by (Mayer’s egg albumin). Slides were labelled properly. Tissues floating on the surface of warm water embedded in paraffin will be picked on the slides. These slides were allowed to cool in an incubator for 10-15 minutes at 37ºC (table 12).
Hematoxylin and eosin staining
Hematoxylin and eosin staining was carried for histological analysis. Different alcoholic reagents were also used for staining along with stains. The protocol of technique and role of the reagents is listed in table 13. All the steps are carried out in darkness. After completion of staining process, mounting step is carried out. Post staining the slides are immediately covered with slide cover slips to prevent any contact with air. DPX mounting media was used in this process. Mounted slides were placed at an angle of 45ºC for drying. Slides were then observed under compound microscope and images were taken at resolution of 10X and 40X for analysis of damage at tissue level.
Table 7: Protocol For Staining Process of Hematoxylin and Eosin
Reagents
|
Time
|
Role
|
Xylene I
|
15 minutes
|
To remove the paraffin wax from the tissues
|
Xylene II
|
15 minutes
|
Xylene III
|
15 minutes
|
Ab. Alcohol I
|
3 minutes
|
To remove the xylene from the tissues
|
Ab. Alcohol II
|
3 minutes
|
90% Alcohol
|
3 minutes
|
70% Alcohol
|
3 minutes
|
D. Water
|
3 minutes
|
To remove alcohol from the tissues
|
Hematoxylin
|
15 minutes
|
For staining of nucleus and basophilic parts of the cell
|
D. Water
|
5 minutes
|
For washing
|
Acid Alcohol
|
3-5 dips
|
To remove the stain from the background of the tissue section
|
D. Water
|
3 minutes
|
For washing
|
Ammonia Water
|
3 minutes
|
For restoration of nucleus blue colour (Blueing)
|
D. Water
|
3 minutes
|
For washing
|
70% Alcohol
|
3 minutes
|
Eosin
|
15 minutes
|
For staining of eosinophilic parts of the cell
|
D. Water
|
1 minutes
|
For washing
|
70% Alcohol
|
3 minutes
|
The mounting material does not miscible with the water found in the tissues. Therefore, water was eliminated by placing slides in ethyl alcohol in ascending order
|
Ab. Alcohol I
|
3 minutes
|
Ab. Alcohol II
|
3 minutes
|
Xylene I
|
15 minutes
|
Permanent tissue sections must be translucent. Therefore, slides were dipped in the xylene as xylene is miscible with mounting medium
|
Xylene II
|
15 minutes
|
Xylene III
|
15 minutes
|
STATISTICAL ANALYSIS
The correlation analysis of the raw data for all attributes was computed using coSTAT computer package. Comparison of means was done using Duncan’s Multiple Range (DMR) tests.