Imatinib mesylate reduces c-Myc translocation in double-hit lymphoma cells by suppressing inducible cytidine deaminase

doi:10.21203/rs.3.rs-4368255/v1

Download PDF

Research Article

Imatinib mesylate reduces c-Myc translocation in double-hit lymphoma cells by suppressing inducible cytidine deaminase

https://doi.org/10.21203/rs.3.rs-4368255/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Double-hit lymphoma (DHL) with c-Myc gene translocation is highly aggressive and has a poor prognosis. In DHL cells, activation-induced cytidine deaminase (AID) promotes antibody class switch recombination (CSR), ultimately leading to c-Myc gene translocation caused by Myc/IgH DNA double-strand breaks. In this study, imatinib mesylate downregulated the AID and c-Myc proteins in patients with chronic myelogenous leukemia associated with DHL. In addition, imatinib mesylate reduced AID expression and c-Myc gene translocation in SU-DHL-4 and OCI-Ly18 DHL cells with c-Myc gene translocation. Imatinib mesylate exerted significant inhibitory effects on the proliferation and metastasis of SU-DHL-4 and OCI-Ly18 cells. Finally, imatinib mesylate reduced not only tumor burden in DHL mouse models, but also AID expression and c-Myc gene translocation in vivo. These findings reveal that imatinib mesylate effectively reduces the carcinogenic function of c-Myc in DHL, providing novel strategies for developing therapies targeting c-Myc-driven DHL.

Activation-induced cytidine deaminase

Imatinib mesylate

c-Myc

Double-hit lymphoma

Activation-induced cytidine deaminase (AID) is highly expressed in double-hit lymphoma (DHL), and high AID expression results in enhanced tumor proliferation and significantly reduced survival in DHL patients.
In vitro, AID regulates c-Myc in DHL cell lines.
Imatinib mesylate inhibits AID and c-Myc expression in DHL cells, reducing cell proliferation.
Imatinib mesylate inhibits the growth of tumor nodules in subcutaneous xenograft models and suppresses c-Myc gene translocation in vivo.

Diffuse large B-cell lymphoma (DLBCL) is the commonest type of non-Hodgkin lymphoma, and 6–14% of DLBCL cases have c-Myc gene translocations, often accompanied by BCL-2 or BCL-6 translocations, which is referred to as double-hit lymphoma (DHL)[1]. The outcome of conventional R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, prednisone) chemotherapy for DHL patients is poor, and intensive chemotherapy regimens similar to those applied for "Burkitt lymphoma", combined with autologous stem cell transplantation (ASCT) consolidation, are often utilized[2]. However, a multi-center comparative study reported that DHL cases do not benefit from the above treatment [3].

The most important factor affecting DHL occurrence in DLBCL is c-Myc gene translocation[4]. The c-Myc gene is upregulated in almost all cancers, controlling the expression of many carcinogenic tumor genes, including tumor cell proliferation, metabolism, differentiation, sensitivity to apoptosis stimulation, and genetic instability, which are closely related to tumor initiation and progression[5, 6]. Due to its central role in tumorigenesis, c-Myc has become a promising independent molecular therapeutic target for tumors with c-Myc oncogenes. c-Myc was discovered more than 30 years ago, and anti-c-Myc drugs have been developed, such as antisense oligonucleotides, small interfering RNAs (siRNAs) or phospho-diamine morpholino oligomers (PMO), which induce tumor cell growth arrest, differentiation, or apoptosis[7, 8]. However, the development of drugs directly targeting the c-Myc gene is very limited, so novel treatment methods are needed to block the excessive activity of c-Myc more effectively in cancer cells.

The main reason for c-Myc translocation in B cells is the excessive antibody class switching recombination (CSR). The immunoglobulin (Ig) gene undergoes two DNA alterations to enhance antibody specificity and functionality: somatic hypermutation (SHM) and class switching recombination (CSR)[9, 10]. To date, activation-induced deaminase (AID) is the only enzyme reported to induce SHM and CSR[11, 12]. The double-strand breaks (DSBs) triggered by AID replace the constant region of IgM’s heavy chain with other isotypes to achieve CSR, ultimately causing c-Myc/IgH gene double-strand breaks and carcinogenic chromosomal translocations[13, 14]. AID’s off-target mutations and subsequent DSBs as well as chromosomal translocations often promote tumorigenesis, especially in multiple B-cell lymphoma types[15, 16]. Current data have shown that imatinib mesylate can be utilized as an AID inhibitor in B-cell lymphoma to reduce CSR in vivo[17]. Imatinib mesylate has been clinically used for more than a decade, with significant success in the treatment of BCR/ABL-positive chronic myelogenous leukemia (CML) and gastrointestinal stromal tumors characterized by activated c-KIT, becoming a first-line treatment option[18, 19]. In case imatinib mesylate could reduce c-Myc expression in vivo by inhibiting AID expression in B-cell lymphoma, it may become a targeted drug for c-Myc gene translocation in DLBCL. However, there is currently no relevant research.

To further characterize the molecular effects of imatinib mesylate, this study found that AID and c-Myc were downregulated in chronic myelogenous leukemia patients with DHL treated with imatinib mesylate. Additionally, two human double-hit lymphoma cell lines were used to analyze the effect of imatinib mesylate on c-Myc in vitro, and the therapeutic effect was also evaluated in xenograft mouse models. In summary, our findings reveal a new mechanism of imatinib mesylate in DHL cells. Due to the close associations among the invasive characteristics of c-Myc in DHL cells, imatinib mesylate may become a novel agent to regulate c-Myc-dependent carcinogenic signaling and be used to develop effective treatment strategies for DHL.

2.1. Patients and cell culture

Totally 40 patients with DLBCL, treated in the Department of Hematology, Jinhua Hospital affiliated to Zhejiang University School of Medicine from January 2019 to December 2021, were included. Of these, 20 patients had DHL confirmed by fluorescence in situ hybridization (FISH) testing, while the other patients had chronic myelogenous leukemia complicated by DHL. SU-DHL-4 and OCI-Ly18 cells in this study were purchased from Shanghai SLAE. SU-DHL-4 and OCI-Ly18, both DLBCL cells, are negative for EBV and carry c-Myc gene translocation[20, 21]. SU-DHL-4 and OCI-Ly18 cells were cultured in RPMI 1640 medium (Gibco BRL, Rockville, MD, USA) containing 10% fetal calf serum (FCS), L-glutamine (746µg/ml), sodium bicarbonate (0.2%), streptomycin (90µg/ml) and penicillin G (90µg/ml). All cells were cultured at 37°C in a humid 5% CO₂ environment, with the medium replaced every 2 days. The human specimens and experimental protocols in this study have been approved by the Ethics Committee of Affiliated Jinhua Hospital, Zhejiang University School of Medicine (no. 2019 − 147). The use of human specimens has obtained informed consent from patients and their families.

2.2. Generation of AID knockout stable cell lines

To generate cell lines with stable AID knockout, AIDCas9-1 and AIDCas9-2 lentiviral particles obtained from TransOMIC Technologies Inc. were used to infect SU-DHL-4 cells. The gRNA sequences targeting AID were: gRNA1, TTCTCCGAACGTGTCACGTAA; gRNA2, GTATGAGGTTGATGACTTA. After 24 h of infection, stable cells were selected in medium containing 2 or 4µg/ml puromycin (Gibco, CA, USA) for 15 days. After 3 passages in the presence of puromycin, the cultured cells were used for experiments without further colony selection.

2.3. Immunofluorescence

For immunofluorescence, SU-DHL-4 cells in the logarithmic phase were centrifuged at 1500 rpm for 5 minutes, and an appropriate amount of cells were added to each well of a 6-well plate to achieve a density of about 50–80% on the second day. After washing with PBS, the cells were fixed with 4% paraformaldehyde at room temperature. Next, 0.1% Triton X-100 was used to rupture the cell membrane with at room temperature. Then, primary AID antibody (Abcam, Inc. Cambridge, UK) and Alexa Fluor secondary antibody were added, followed by counterstaining with 10 ng/ml DAPI (1:100 ~ 1:500) at 4℃ in the dark and microscopy.

2.4. Quantitative real-time PCR

For real-time PCR, total RNA was extracted with TRIzol reagent (Invitrogen), and cDNA was synthesized with the GoScript Reverse Transcription System and Oligo(dT)15 primer (Promega, Madison, WI). qRT-PCR was performed with the SsoFast EvaGreen Supermix kit (Bio-Rad) and the relative levels of mRNAs for various myeloid differentiation markers were normalized to GAPDH mRNA expression. The following primer sets were employed: c-MycER, forward 5′-TGTCCATTCAAGCAGACGAG-3′ and reverse 5′-AAGGACAAGGCAGGGCTATT-3′; mouse c-Myc, forward 5′-CCTAGTGCTGCATGAGGAGA-3′ and reverse 5′-TCCACAGACACCACATCAATTT-3′; human c-Myc, forward 5′-TCAAGAGGCGAACACACAAC-3′ and reverse 5′-GGCCTTTTCATTGTTTTCCA-3′. The experiments were performed in triplicate and repeated at least once.

2.5. Western blot

SU-DHL-4 cells were lysed with RIPA buffer, and protein concentrations were determined with the BCA Protein Assay Kit. Totally 30µg total cellular protein was subjected to SDS-PAGE and electro-transferred onto polyvinylidene difluoride (PVDF) membranes. Blots were blocked with 5% fat-free milk for 1 h before incubation with primary antibodies at 4°C overnight. Appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies were added for 1 h at ambient. Protein bands were detected with SuperSignal Chemiluminescent Substrate (Bio-Rad) and visualized on a Chemi DocTM Touch Imaging System (Bio-Rad). Densitometric analysis of protein abundance was performed with the ImageJ software (Image J version 1.44 software, National Institute of Health, Bethesda, MD, USA).

2.6 Cell proliferation assay

The effect of imatinib mesylate on cell proliferation was determined by the MTS assay. Specifically, SU-DHL-4 and OCI-Ly18 cells were co-cultured with imatinib for 48 h after CSR induction as described above. Totally 100µl of each cell suspension was added to each well of a flat 96-well plate, followed by addition of 20µl of MTS solution (CellTiter 96 Aqueous, Promega, Madison, WI, USA) and incubation at 37°C for 1 h. Finally, a microplate reader (Benchmark, Bio-Rad) was used for absorbance reading at 490 nm. For the soft agar colony formation assay, 15,000 SU-DHL-4 and OCI-Ly18 cells were seeded in 0.5 ml of 0.3% soft agar on a 2-ml base layer of 0.6% agar. The cells were allowed to settle, and 2 ml of fresh RPMI medium (with or without imatinib at concentrations of 5µM, 10µM, and 20µM) was added to cover the wells. The plate was incubated at 37°C in a CO2 incubator for up to three weeks. Cell growth medium containing the inhibitor was replaced every four days. At the end of the incubation, the cells underwent 0.25% crystal violet staining. Then, a Leica microscope was used for imaging at ×150.

2.7. Assessment of in vivo antitumor activity

The experimental protocol was approved by the Animal Experimental Ethics Committee of Jinhua Hospital affiliated to Zhejiang University School of Medicine. SPF-grade animals were purchased at 4 weeks of age from Shanghai SLAC Company SCXK (Hu) 2017-0005 (certificate number 20170005054151). Totally 2×10⁶ SU-DHL-4 cells were injected subcutaneously. When the tumor volume reached approximately 100 mm³, SU-DHL-4 lymphoma-bearing nude mice were randomly divided into the PBS and imatinib mesylate groups. Tumors in all nude mice were measured with a digital caliper, and their volumes were derived according to the following formula: V tumor = (tumor length) × (tumor width)²/2. Tumor size and body weight were monitored every five days. After 30 days of treatment, all nude mice were sacrificed with carbon dioxide, and lymphoma samples and major organs were extracted and fixed with formalin (10%).

2.8. Immunohistochemistry

Tumor tissues were fixed with formalin and paraffin embedded. The sections were deparaffinized and immersed in ethanol with a gradient concentration. Then, the sections were treated with the antigen retrieval buffer in a microwave for 1 min. After washing, the sections were blocked with 10% horse serum at ambient for 1 h. The sections were incubated with primary antibodies against AID (Affymetrix eBioscience, San Diego, CA, USA) and c-Myc (Clone EP1176Y, Abcam; 1:100) overnight at 4°C. After washing, the secondary antibody was added, and slides were incubated with DAB (Vector Laboratories, Burlingame, CA) for 30 s and counterstained with hematoxylin (Harris) for 30s. The Vectastain Elite Impression kit was used for blocking, antibody treatment, and color development. A Nikon digital camera mounted on a Leica microscope was used for imaging at ×600.

2.9. Fluorescence in situ hybridization

For FISH, based on H&E staining, the tumor cell-rich area was selected as the hybridization area. Probes (including c-Myc dual-color separation probe; QP-30-191096) and DAPI were purchased from Vysis, Inc. (USA). Streptavidin Alexa594 (Molecular Probes, Eugene, OR, USA) and fluorescein isothiocyanate-anti-digoxin (Roche) were used to detect the labeled probes in the red and green spectra, respectively.

2.10. Statistical analysis

The sample size (n) indicates the number of independent biological samples in each experiment. Sample sizes and experimental repeats are indicated in Figuies and their legends. Generally, all experiments were performed with n ≥ 3, with * indicating p < 0.05 and ** reflecting p < 0.01. Analyses were performed with the GraphPad Prism 9.0 software.

3.1. AID promotes the occurrence of double-hit lymphoma

To assess the role of AID in the development of double-hit lymphoma, the expression of the AID protein was examined in double-hit lymphoma (DHL) and ordinary diffuse large B-cell lymphoma (DLBCL) cells. In immunohistochemical staining, AID expression was higher in DHL compared with ordinary DLBCL (Fig. 1A-B). Moreover, DHL expressed higher Ki-67 levels, indicating enhanced DHL tumor proliferation (Fig. 1A and C). Based on AID expression in tissue specimens from DHL patients, a survival curve was generated (Fig. 1D). Patients with high AID expression had significantly reduced survival compared with those with low AID expression (Fig. 1D). In addition, Ki-67 expression was associated with patient survival, and individuals with high Ki-67 expression had significantly lower survival (Fig. 1H). Next, ¹⁸F-FDG PET-CT was used to evaluate the standard uptake value (SUV) of patients with high AID expression in DHL and low AID expression in DLBCL (Fig. 1E), and SUV^max in patients with high AID expression in DHL was significantly higher than that of DLBCL cases (Fig. 1F). Finally, LDH levels were assessed in the peripheral blood of DHL and DLBCL patients, The results showed that LDH was significantly higher in the peripheral blood of patients with high AID expression in DHL (Fig. 1G). In summary, the retrospective analysis showed that AID plays an important role in the development of DHL, and high AID expression in DHL may be considered a marker of poor prognosis.

3.2. AID controls c-Myc expression in DHL cell lines

To assess if AID regulates c-Myc expression in DHL, the DHL cell line SU-DHL-4 with c-Myc translocation was infected with a lentivirus to knock out AID, and the transfection results were verified by qRT-PCR (Fig. 2A). Using immunofluorescence to analyze c-Myc expression in SU-DHL-4 cells after AID knockdown, SU-DHL-4 cells had significantly decreased fluorescence intensity for the c-Myc protein (Fig. 2B). Compared with the control group, without knockdown, knocking down AID significantly decreased the expression of the c-Myc protein (Fig. 2C). In addition, Western blot also demonstrated that AID knockout decreased c-Myc protein expression (Fig. 2D). After AID knockout, c-Myc mRNA levels were decreased (Fig. 2F). The above results indicate that AID expression can regulate c-Myc in DHL.

3.3. Imatinib mesylate downregulates AID and c-Myc

In a patient with chronic myelogenous leukemia (CML) and DHL, imatinib mesylate at 400 mg was administered once daily for 4 weeks. Unexpectedly, cervical lymph node lesions in the patient were significantly decreased after treatment with imatinib mesylate. In addition, AID protein and c-Myc levels in the tumor tissue from the patient were decreased (Fig. 3A). To further confirm the potential of imatinib mesylate in reducing AID and c-Myc expression, SU-DHL-4 and OCI-Ly18 cells were co-cultured with imatinib mesylate. The results showed that imatinib mesylate inhibited AID mRNA expression in SU-DHL-4 and OCI-Ly18 cells (Fig. 3B), and also inhibited c-Myc mRNA expression (Fig. 3C). Using the MTS assay, the effects of imatinib mesylate at concentrations of 2, 5, 10, and 20µM on the proliferation of SU-DHL-4 and OCI-Ly18 cells were examined. On day 3, imatinib mesylate exerted only a mild inhibitory effect on DLBCL cells at 10µM, but showed a strong inhibitory effect on cell proliferation at 20µM. On day 5, in SU-DHL-4 and OCI-Ly18 cells, the 50% inhibitory concentration (IC50) values of imatinib mesylate were 17.0 and 21.2µM, respectively(Fig. 3D-E). In summary, these results suggest that imatinib mesylate can downregulate AID and c-Myc and reduce the proliferative ability of DHL cells in vitro.

3.4. Imatinib mesylate inhibits the proliferation of tumor cells

To further demonstrate the inhibitory effect of imatinib mesylate on DHL cell proliferation, the soft agar colony formation assay was performed. The results showed that imatinib mesylate significantly affected the soft agar colony formation abilities of SU-DHL-4 and OCI-Ly18 cells. Treatment with 5µM imatinib mesylate significantly decreased the proliferation of SU-DHL-4 cells (Fig. 4A-B). Additionally, imatinib mesylate also reduced the proliferation of OCI-Ly18 cells but required a higher concentration of 20µM (Fig. 4C-D). These results indicate that imatinib mesylate exerts a significant inhibitory effect on DHL cells.

3.5. Imatinib mesylate inhibits the growth of tumor nodules in subcutaneous xenograft models

Considering the excellent targeting effect of imatinib mesylate on B-cell lymphoma cells in vitro, we next evaluated the potential anticancer activity of imatinib mesylate in an experimental B-cell lymphoma model. Based on in vitro data, SU-DHL-4 cells were selected to establish a DLBCL xenograft model. When the tumors grew to 100 mm³, imatinib mesylate was administered at a dose of 50 mg/kg/day for 30 days (Fig. 5A). Compared with the control group, daily imatinib (50 mg/kg/day) significantly inhibited tumor growth (Fig. 5B). In addition, body weight changes can indicate systemic side effects. To examine the potential systemic toxic effects of imatinib mesylate treatment in vivo, the body weights of mice were monitored every 5 days. The body weights of both groups of nude mice had similar trends over 30 days, indicating that imatinib mesylate treatment had no significant systemic toxicity (Fig. 5C). To further examine cell proliferation, Ki-67 expression was determined. As shown in Fig. 5DE, imatinib mesylate treatment decreased Ki-67 expression. Next, dual-color separation FISH probes were used to label the c-Myc gene, and imatinib mesylate treatment decreased c-Myc gene translocation (Fig. 5F-G). Finally, lactate dehydrogenase was detected in mice, and imatinib mesylate treatment decreased lactate dehydrogenase levels (Fig. 5H). Overall, imatinib mesylate successfully inhibited the proliferation of SU-DHL-4 cells in vivo, indicating strong efficacy in the treatment of malignant B-cell tumors. In this study, the excellent results in the subcutaneous lymphoma model support further investigation examining the safety and therapeutic efficacy of imatinib mesylate in a disseminated lymphoma model.

Diffuse large B-cell lymphoma (DLBCL) is the most common lymphoma diagnosed clinically, and about half of the cases can be treated with the standard R-CHOP chemotherapy regimen[22].Retrospective studies have found that about one-third of DLBCL patients can survive for a long time, but patients with c-Myc gene translocations show particularly poor outcomes[23].In up to 30% of DLBCL cases, increased c-Myc protein expression indicates that c-Myc changes may be an important secondary transformation event[24].In B cells, the main reason for c-Myc translocation is that double-strand breaks (DSBs) initiated by AID replace the constant region of IgM heavy chain with other isotypes to achieve CSR, ultimately leading to c-Myc/IgH gene double-strand breaks and carcinogenic chromosomal translocations[13, 14].

We observed that imatinib, an oral active tyrosine kinase inhibitor, significantly reduced the expression of AID protein in chronic myelogenous leukemia. This is particularly important because AID protein can induce damage and mutation of c-Myc, and overexpression of AID is necessary in c-Myc/IgH translocation lesions[25]. In Burkitt lymphoma with c-Myc translocation, a large number of studies have shown that AID causes c-Myc translocation[26].In addition, in several inert B cell malignancies including chronic lymphocytic leukemia and follicular lymphoma, AID expression increases CSR leading to higher-level transformation has been reported[27, 28].Our study showed that imatinib mesylate inhibits AID and c-Myc protein expression in chronic myelogenous leukemia. The possible mechanism is that the alteration of c-Myc by CSR requires the formation of paired DNA breaks, but DNA damage has already occurred in the malignant cells of chronic myelogenous leukemia mature cells [29, 30].

Previously, it has been reported that imatinib mesylate can downregulate the level of E2A protein, leading to significant inhibition of AID[17]. However, there has been no further study on the effect of imatinib mesylate on c-Myc. Our in vitro experiments showed that imatinib mesylate at a concentration of 10–20µM can significantly inhibit AID protein and mRNA, as well as reduce c-Myc mRNA. In addition, we also demonstrated that imatinib mesylate can induce c-Myc translocation in vitro. These findings open up the possibility of controlling the expression and function of c-Myc in DLBCL (and possibly other types) cancer cells through imatinib mesylate. c-Myc has been widely demonstrated to play a key role in the metastasis of various types of cancer cells[31, 32].Therefore, we analyzed the effect of imatinib mesylate treatment on the invasion and soft agar colony formation ability of DHL cells. We observed that imatinib mesylate effectively blocked the invasion and soft agar colony formation ability of DHL cells.In addition, we observed that oral administration of imatinib mesylate reduced tumor growth in HDL tumor xenografts and decreased the levels of c-Myc gene and target proteins in vivo. The c-Myc gene is overexpressed in most tumor cells, making c-Myc inhibitors promising for treating different types of cancer.

However, direct target therapy of c-Myc has not produced significant clinical benefits[5, 33].Due to the lack of evidence that c-Myc inhibitors have therapeutic effects, the recent enthusiasm for direct target therapy of c-Myc has decreased. In this context, our research results reveal the efficacy of imatinib mesylate in vitro and in vivo against c-Myc-translocated DHL cells. Our analysis of c-Myc expression and regulation in DHL not only reveals an unknown mechanism of action of imatinib mesylate, but also opens up a new utilization pathway. In summary, our work strongly supports the potential clinical application value of imatinib mesylate as a treatment for c-Myc gene translocation in DHL in the near future.

Funding

This work was supported by Zhejiang Medical Association Science and Technology Project (No. 2022ZYC-Z3), and the Jinhua Science and Technology Research Program (No.2020-3-043, No.2023-04-067).

Ethics statement

The human specimens and experimental protocols in this study have been approved by the Ethics Committee of Affiliated Jinhua Hospital, Zhejiang University School of Medicine (no. 2019-147). The use of human specimens has obtained informed consent from patients and their families.

Author contributions

JZ and XH contributed to the conception and design of this study, had full access to all study data and take responsibility for the integrity of the data and the accuracy of the data analysis. TY and FH contributed to manuscript writing.SZ and SJ contributed to critical revision of the manuscript. All authors contributed to data acquisition, analysis and interpretation and reviewed and approved the final version.

Declaration of Competing Interest

The authors declare no competing financial interest. No disclosures were reported by all the authors.

Zhuang Y, Che J, Wu M, Guo Y, Xu Y, Dong X, et al. Altered pathways and targeted therapy in double hit lymphoma. 2022;15:26.
Friedberg JW. How I treat double-hit lymphoma. Blood. 2017;130:blood-2017-04-737320.
Clémentine S, Alexandra TG, Bertrand C. Double-hit and double-protein-expression lymphomas: aggressive and refractory lymphomas. Lancet Oncology. 2015;16:e555-e67.
Nguyen HV, Vandenberg CJ, Ng AP, Robati MR, Anstee NS, Rimes J, et al. Development and survival of MYC-driven lymphomas require the MYC antagonist MNT to curb MYC-induced apoptosis. Blood. 2020;135:1019-31.
Zhao L, Li H, Huang X, Liu T, Xin Y, Xiao Z, et al. The endocytic pathway of Pt nanoclusters and their induced apoptosis of A549 and A549/Cis cells through c-Myc/p53 and Bcl-2/caspase-3 signaling pathways. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2021;144:112360.
Meyer N, Penn LZ. Reflecting on 25 years with MYC. Nature Reviews Cancer. 2009;8:976-90.
Dhanasekaran R, Deutzmann A. The MYC oncogene - the grand orchestrator of cancer growth and immune evasion. 2022;19:23-36.
Fatma H, Maurya SK, Siddique HR. Epigenetic modifications of c-MYC: Role in cancer cell reprogramming, progression and chemoresistance. Seminars in cancer biology. 2022;83:166-76.
Durandy A. Activation-induced cytidine deaminase: A dual role in class-switch recombination and somatic hypermutation. European Journal of Immunology. 2003;33:2069.
Kumar, Anjani, Priya, Anshu, Ahmed, Tanzeel, et al. Regulation of the DNA Repair Complex during Somatic Hypermutation and Class-Switch Recombination. Journal of Immunology Official Journal of the American Association of Immunologists. 2018.
Jason Q, Qiao W, Marei D, Nathanael P, Kyong-Rim KK, Wolfgang R, et al. B cell super-enhancers and regulatory clusters recruit AID tumorigenic activity. Cell. 2014;159:1524-37.
Bednarski JJ, Sleckman BP. At the intersection of DNA damage and immune responses. Nature Reviews Immunology. 2019.
Matthews AJ, Zheng S, Dimenna LJ, Chaudhuri J. Regulation of immunoglobulin class-switch recombination: choreography of noncoding transcription, targeted DNA deamination, and long-range DNA repair. Advances in Immunology. 2013;122:1-57.
Ramiro AR. Role of genomic instability and p53 in AID-induced c-myc-Igh translocations. Nature. 2006;440:105-9.
Pasqualucci L. AID is required for germinal center-derived lymphomagenesis. Nature Genetics. 2008;40:108-12.
Xu Z, Fulop Z, Wu G, Pone EJ, Zhang J, Mai T, et al. 14-3-3 adaptor proteins recruit AID to 5'-AGCT-3'-rich switch regions for class switch recombination. Nature Structural & Molecular Biology. 2010;17:1124-35.
Kawamata T, Lu J, Sato T, Tanaka M, Kotani A. Imatinib mesylate directly impairs class switch recombination through down-regulation of AID: its potential efficacy as an AID suppressor. Blood. 2012;119:3123-7.
O'Brien SG, Guilhot F, Larson RA, Gathmann I, Druker BJ. Imatinib Compared with Interferon and Low-Dose Cytarabine for Newly Diagnosed Chronic-Phase Chronic Myeloid Leukemia. New England Journal of Medicine. 2003;348:994-1004.
Paul, Gougis, Angelo, Paci, Romain, Coriat, et al. Nilotinib versus imatinib for GIST. Lancet Oncology. 2015.
Bittremieux M, La Rovere RM, Akl H, Martines C, Welkenhuyzen K, Dubron K, et al. Constitutive IP(3) signaling underlies the sensitivity of B-cell cancers to the Bcl-2/IP(3) receptor disruptor BIRD-2. 2019;26:531-47.
Johnson-Farley N, Veliz J, Bhagavathi S, Bertino JR. ABT-199, a BH3 mimetic that specifically targets Bcl-2, enhances the antitumor activity of chemotherapy, bortezomib and JQ1 in "double hit" lymphoma cells. Leukemia & Lymphoma. 2015;56:2146-52.
Schmitz R, Wright GW, Da WH, Johnson CA, Staudt LM. Genetics and Pathogenesis of Diffuse Large B-Cell Lymphoma. N Engl J Med. 2018;378:1396-407.
MYC translocation partner gene determines survival of patients with large B‐cell lymphoma with MYC ‐ or double‐hit MYC / BCL 2 translocations. European Journal of Haematology. 2013;92:42-8.
Green TM, Young KH, Visco C, Xumonette ZY, Orazi A, Go RS, et al. Immunohistochemical double-hit score is a strong predictor of outcome in patients with diffuse large B-cell lymphoma treated with rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone. Journal of Clinical Oncology. 2012;30:3460-7.
Robbiani DF, Anne B, Elsa C, Bernardo RSM, Yair D, Simone D, et al. AID is required for the chromosomal breaks in c-myc that lead to c-myc/IgH translocations. Cell. 2008;135:1028-38.
Davide M, Annalisa R, Flavio R, Antonio G. Emerging molecular networks in Burkitt's lymphoma. Journal of Cellular Biochemistry. 2013;114:35-8.
Shikata H, Yakushijin Y, Matsushita N, Sakai A, Sugita A, Nakamura N, et al. Role of activation-induced cytidine deaminase in the progression of follicular lymphoma. Cancer Science. 2012;103:415-21.
Reiniger L, ., B?D?R C, ., Bognár A, ., Balogh Z, ., Csomor J, ., Szepesi A, ., et al. Richter's and prolymphocytic transformation of chronic lymphocytic leukemia are associated with high mRNA expression of activation-induced cytidine deaminase and aberrant somatic hypermutation. Leukemia. 2006;20:1089-95.
Richardson C, ., Jasin M, . Frequent chromosomal translocations induced by DNA double-strand breaks. Nature. 2000;405:697-700.
Kuppers R, Dalla-Favera R. Mechanisms of chromosomal translocations in B cell lymphomas. Oncogene. 2001;20:5580-94.
Baluapuri A, Wolf E. Target gene-independent functions of MYC oncoproteins. 2020;21:255-67.
Das SK, Lewis BA, Levens D. MYC: a complex problem. Trends in cell biology. 2023;33:235-46.
Prochownik EV, Vogt PK. Therapeutic Targeting of Myc. Genes Cancer. 2010;1:650-9.

No competing interests reported.

GraphicalAbstract.tif

Download PDF

Version 1

posted

You are reading this latest preprint version

Imatinib mesylate reduces c-Myc translocation in double-hit lymphoma cells by suppressing inducible cytidine deaminase

Status:

Version 1

Abstract

Figures

Highlights

1. Introduction

2. Material and methods

2.1. Patients and cell culture

2.2. Generation of AID knockout stable cell lines

2.3. Immunofluorescence

2.4. Quantitative real-time PCR

2.5. Western blot

2.6 Cell proliferation assay

2.7. Assessment of in vivo antitumor activity

2.8. Immunohistochemistry

2.9. Fluorescence in situ hybridization

2.10. Statistical analysis

3. Results

3.1. AID promotes the occurrence of double-hit lymphoma

3.2. AID controls c-Myc expression in DHL cell lines

3.3. Imatinib mesylate downregulates AID and c-Myc

3.4. Imatinib mesylate inhibits the proliferation of tumor cells

3.5. Imatinib mesylate inhibits the growth of tumor nodules in subcutaneous xenograft models

4. Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1