Patient recruitment
We conducted a retrospective cohort study of pregnant women with oligohydramnios in Sun Yat-sen Memorial Hospital. In 2017, the number of deliveries in the Obstetric Department of Sun Yat-sen Memorial Hospital was 2667. Among them, 45 cases were pregnant women with oligohydramnios. Due to emergency cesarean section of pregnant women, part of fetal membrane tissues was lost due to failure to freeze in liquid nitrogen within 15 min. Finally, the fetal membrane tissues of 20 pregnant women with oligohydramnios and 19 normal amount of amniotic fluid pregnant women (Normal) were collected and used in this study. The age of all pregnant women was between 21-37 years. Both groups of pregnant women had no secondary diseases, intrauterine infection, smoking, alcohol, fetal developmental abnormalities, acute chorioamnionitis, premature rupture of membranes, and drugs used, including angiotensin converting enzyme inhibitor, angiotensin II receptor blockers, non-steroidal anti-inflammatory drugs during pregnancy. The blood pressure in the two groups of pregnant women was within the normal range.
Diagnostic criteria for oligohydramnios
Pregnant women who meet the following standard criteria are diagnosed with oligohydramnios: amniotic fluid volume in the third trimester of pregnancy with less than 300 mL, an SDP of ≤ 2 cm or an AFI of ≤ 5 cm [5-8]. Simultaneously, when the AFI is less than 8 cm, it is considered to be less amniotic fluid volume [18]. The mean values of the AFI and SDP for pregnant women with oligohydramnios, which were detected and diagnosed by the same sonographer through ultrasound and the pregnant women with oligohydramnios were re-examined by ultrasound again at the internal of 2-4 days, were 53.81 ± 13.82 and 26.95 ± 7.51 mm, respectively. And the content of amniotic fluid estimated by the obstetrician in pregnant women with oligohydramnios during delivery was about 194.29 ± 50.06 mL, which was less than 300 mL. The fetal membrane tissues of pregnant women with AFI ≤ 5 cm were used for microarray analysis. The fetal membrane tissues of pregnant women with AFI of 53.81 ± 13.82 mm and SDP of 26.95 ± 7.51 mm were used for real-time quantitative PCR (qPCR) verification. Simultaneously, the obstetric outcomes (Table 1) and pregnancy complications (Table 2) of pregnant women were also analyzed.
Tissue collection
When giving birth in an operating room or a maternity room, after the placentas were delivered, the fetal membrane tissues 2 cm from the periphery of the umbilical cord were cut. The cut fetal membrane tissues, which were washed with sterile phosphate buffered saline (PBS) and then dried with sterile gauze, were about 4cm*4cm in size. All samples were immediately frozen in liquid nitrogen within 15 min and then transferred to -80°C refrigerator for storage for later use.
RNA isolation
The membranes were washed prior to being homogenized. Approximately 1 cm3 of the tissue block was resected for grinding. Samples were ground in a motor-driven homogenizer. Trizol (Invitrogen, CA, USA) was used to extract total RNA from the tissues in accordance with the manufacturer’s protocol. The concentration and qualification of the isolated total RNA was assessed by a Nanodrop 2001 spectrophotometer (Thermo Fisher Scientific, MA, USA).
LncRNA and mRNA microarray analysis
Total RNA from the fetal membranes, which were obtained from five OP and five Normal, were used for microarray analysis. The Human LncRNA Array V4.0 (8 × 60k) was performed by KangChen Bio-tech Inc. (Shanghai, China) according to the manufacturer standard protocols. The microarray analyses included 40,173 lncRNAs and 20,730 mRNAs.
Bioinformatics
Agilent Feature Extraction software (version 11.0.1.1) was used to analyze the acquired array images. Quantile normalization and subsequent data processing were performed with the GeneSpring GX v11.5.1 software package (Agilent Technologies). Differentially expressed lncRNAs and mRNAs between two conditions were identified through fold change filtering. Heatmaps and scatter plots were generated for differentially expressed genes using the R package (version 3.1.0) [19]. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was performed using an online tool (http://www.genome.jp/kegg/). KEGG pathways that met the requirement of False Positive Discovery (FDR) ≤ 0.001 were considered significantly enriched.
To explore the potential role of lncRNA, a lncRNA–miRNA–mRNA interaction network was constructed. We used miRNA target gene prediction software (miRanda) to predict miRNA targets on lncRNA. The overlap miRNAs that harbored both lncRNA and mRNA binding targets were used to construct the lncRNA–miRNA–mRNA interaction network. The sub-network that contained predicted targets of lncRNA and was differentially expressed in OP was included. The network was visualized using Cytoscape_V2_8_3 (https://www.innatedb.ca/cytoscape-v2.8.3/plugins/) software.
qPCR
The relative expression of lncRNA between 20 OP and 19 Normal was measured by qPCR. Total RNA was reverse transcribed to cDNA using PrimeScript RT Master Mix (Takara, Dalian, China). cDNAs were then amplified and quantified on an ABI 7500 real-time PCR system (Applied Biosystems, CA, USA) with a SYBR Real time PCR Master Mix Kit (TOYOBO, Osaka, Japan). The program for cDNA amplification was as follows: the first step, 95 °C for 120 s; the second step, 95 °C for 15 s and 60 °C for 30 s, for 40 cycles; the third step, for melting curve generation, 60 °C to 95 °C. The relative expression of lncRNA was analyzed using the 2−ΔΔCt method. GAPDH was used as an internal control. The primers were shown in Table 3.
Table 3. Primers used in this study.
Primer name
|
Sequence (5’ to 3’)
|
Production size
|
LINC00515F
|
TCAAGGCAGCAGTGGCAGAG
|
142
|
LINC00515R
|
AGTCACAGGCGTGGAGGTCA
|
|
RP11-388P92F
|
ATTTGCCAGCTTCTCCTTTGA
|
145
|
RP11-388P92R
|
TTGGCAGAATGAGACATCAAG
|
|
GAPDHF
|
GAGTCAACGGATTTGGTCGT
|
185
|
GAPDHR
|
GAGTCAACGGATTTGGTCGT
|
|
Statistical analysis
Student’s t-test was used to analyze the significant differences by the SPSS 18.0 software package in the study. Three biological replicates were performed in the study. A P-value of < 0.05 defined the significant differences between the two groups.