2.1. Mice
Female C57BL/6 mice aged 6–8 weeks were procured from Guangdong Experimental Animal Center (Guangzhou, China). They were housed in the animal facility of Guangdong Medical University under controlled conditions at 25.0 ± 2°C with a 12 h/12 h light-dark cycle. All animal procedures strictly adhered to the Guidelines for the Care and Use of Laboratory Animals of Guangdong Medical University. The Institutional Animal Care and Use Committee of Guangdong Medical University reviewed and approved all experimental protocols (GDY2002326).
2.2. Cell culture and nanoparticles uptake
Human bronchial epithelial (HBE) cells were cultured in RPMI1640 medium (Gibco, NY), supplemented with 10% fetal bovine serum (FBS, Gibco), 100 U/mL penicillin, and 100 µg/mL streptomycin, and maintained in a humidified atmosphere containing 5% CO2 at 37℃. To assess nanoparticle uptake, HBE cells were cultured in DMEM with 10% FBS. Following a 24-hour stimulation with 50 µg/mL house dust mite (HDM, Dermatophagoides farina, Greer Laboratories), naked Cou6-TP/NPs or Cou6-PM@TP/NPs were introduced into the culture medium for an additional 2 hours. Subsequently, fluorescence microscopy (Olympus IX70 Inverted Microscope) was utilized to capture images of HBE cells. Nanoparticle uptake was quantified using flow cytometry. HBE cells were exposed to either naked Cou6-TP/NPs or Cou6-PM@TP/NPs, then washed twice with PBS to eliminate unbound nanoparticles, and subsequently subjected to trypsinization. Flow cytometry analysis (LSRFortessaTM X-20, BD) was employed for data collection and analysis, with results expressed as the mean fluorescence intensity (MFI) of Cou6 within the cells.
2.3. Preparation of TP-loaded nanoparticles (TP/NPs)
The TP/NPs were synthesized using emulsification and evaporation methods as previously described with minor adjustments [17]. In brief, 20 mg of TP (Sigma-Aldrich, USA) and 160 mg of PLGA-PEG (lactide: glycolide 50:50, Sigma-Aldrich, USA) were co-dissolved in 5 mL of dichloromethane, serving as the oil phase (O). Meanwhile, 20 mL of PVA solution (1%, w/w, Sigma-Aldrich, USA) acted as the water phase (W). The oil phase was first emulsified using ultrasonication for 40 s at 100 Watts on ice. Subsequently, the emulsified oil phase was added dropwise into the water phase, and a second emulsification was achieved by ultrasonication for an additional 40 s. To incorporate the nanoparticle fluorescence marker, 250 µg of Coumarin 6 (Cou6, Sigma, USA) was introduced into the oil phase. Finally, the nanoparticles were collected via centrifugation at 12,000 rpm for 20 min, followed by three washes with ultra-pure water.
2.4. Synthesis of platelet membrane (PM)-coated TP-loaded NPs (PM@ TP/NPs)
Fresh whole blood was obtained from 8-week-old normal mice by cardiac puncture. Platelets were then isolated from mouse blood using gradient centrifugation following established protocols [16]. Initially, the supernatant of mouse whole blood (0.5 mL) was centrifuged at 200 g for 10 min to yield platelet-rich plasma (PRP). Subsequently, PRP was separated from the supernatant by centrifugation at 1800 g for 20 min, resulting in the precipitation of platelets. After washing the platelet precipitates twice with PBS, they were resuspended in water containing a protease cocktail inhibitor and stored at -80 ℃. Prior to use, platelets were thawed at room temperature. This freeze-thaw process was repeated three times to ensure uniformity. Finally, the mixture of platelets and TP/NPs was obtained, forming uniform particles.
2.5. Characterization of PM@TP/NPs
The particle size of the TP/NPs was determined using dynamic light scattering (DLS). Surface characteristics of TP/NPs were analyzed via scanning electron microscopy (SEM). Optical properties were assessed using ultraviolet-visible (UV-Vis) spectroscopy. TP/NPs encapsulating platelet membrane proteins underwent evaluation via SDS-PAGE. Protein samples, including platelet membrane proteins and PM@TP/NPs, were loaded onto a 10% SDS-PAGE gel, followed by staining with Coomassie Blue and imaging after overnight gel decolorization. Additionally, platelet membrane proteins in both platelets and PM@TP/NPs were identified via Western blot using the platelet membrane protein P-selectin (CD62).
2.6. Cell viability assay
A CCK-8 assay was conducted to assess the cell viability of HBE cells. Briefly, HBE cells were seeded at a density of 5 × 10^3 cells per well in 96-well plates and incubated overnight at 37°C in a 5% CO2 atmosphere. Subsequently, the culture medium was replaced with varying concentrations of TP, and the cells were further incubated for 24 hours at 37°C. Cell viability was then evaluated using a CCK-8 kit (Beyotime, China) following the manufacturer’s protocol.
2.7. Hemolysis test
To assess the in vivo biosafety of TP/NPs, a hemolysis test was conducted using red blood cells treated with various formulations of TP nanoparticles [18]. Red blood cells were obtained from normal C57BL/6J mice and separated via centrifugation at 3500 rpm for 5 minutes. Subsequently, a 4% red blood cell suspension (v/v in PBS) was mixed with 1 mL of prepared TP and its corresponding nanoparticle solutions (100 µg/mL). After incubation for 4 hours at 37°C, the supernatants were collected via centrifugation at 3500 rpm for 5 minutes, and the optical density of all samples was measured at 550 nm using a microplate reader. PBS and pure water served as negative and positive controls, respectively. Additionally, images of the red blood cell suspension in 12-well plates were captured using a Living Cell Imaging System (EVOSFL Auto, Invitrogen, USA).
2.8. IVIS imaging
Following the induction of asthma in C57BL/6 mice via HDM exposure, 50 µL of various TP/NPs (100 µg/mL) and Cou6-PM@TP/NPs (100 µg/mL) as fluorescent markers were administered intranasally. Subsequently, images of the mice were captured two hours after intranasal nanoparticle administration, and their fluorescence intensities were quantified using the Kodak Multi-Mode Imaging
2.9. HDM-induced mouse asthma model
The HDM-induced mouse asthma model used in this study was previously described in our publications [16, 19]. In brief, the mouse model of HDM-induced asthma was conducted following the protocol outlined in Fig. 5A. Eight-week-old female C57BL/6 mice were intranasally sensitized with HDM (200 µg HDM in 50 µL saline per mouse; Mite Dust D. pteronyssinus, Greer Laboratories) on days 0 and 2. Subsequently, these mice were intranasally stimulated with HDM (30 µg in 50 µL saline per mouse) on day 14 for five consecutive days. The HDM + TP group and the HDM + PM@TP-NPs group of mice were intranasally administered (dose: 10 mg TP per kg body weight) 1 h before HDM stimulation from day 14 to day 21. Normal mice treated intranasally with saline served as the basal control group in this experiment. Forty-eight hours after the final HDM stimulation on day 21, bronchoalveolar lavage fluid (BALF), sera, and lung tissues were collected for further analysis.
2.10 Flow cytometry analysis of bronchoalveolar lavage fluid (BALF) and lung leukocytes
After the mouse was anesthetized, bronchoalveolar lavage fluid (BALF) was collected using 5X cold PBS (1 mL) and subjected to flow cytometry analysis. Lung leukocytes were isolated following a previously described method [19]. In brief, lung tissues were minced and digested with 1 mg/mL Collagenase IV (Life Technologies) in RPMI1640 medium containing 5% FBS at 37°C for 45 minutes. Subsequently, lung mononuclear cells were isolated using a 38% Percoll gradient (GE Healthcare Life Sciences), and cells located at the bottom of the tube were collected. Red blood cells were lysed using ammonium-chloride-potassium lysis buffer (Life Technologies), and the resultant cells were harvested for flow cytometry analysis.
For flow cytometric examination, cells were surface-stained with antibodies in PBS containing 1% FCS (Sigma-Aldrich) on ice for 30 minutes. For intracellular cytokine staining, cells were stimulated with 50 ng/mL PMA (Sigma-Aldrich) and 1 µM ionomycin (Sigma-Aldrich) for 5 hours in the presence of Golgistop (BD Biosciences). Flow cytometric data were acquired using LSRFortessaTM X-20 and analyzed using FlowJo software (BD Bioscience).
2.11. ELISA for the determination of cytokines in sera
Mouse whole blood obtained from the mouse heart was centrifuged at 4 ℃ at 5000 rpm for 10 min. The serum collected from the blood supernatant was aspirated for ELISA analysis. The concentrations of IgE in BALF and IL-4, IL-5, and IL-13 in mouse serum were measured respectively using ELISA kits (Invitrogen) following the manufacturer's instructions.
2.12. Histological analysis
After perfusion with cold PBS, the mouse organs (lung, heart, liver, spleen, and kidney) were fixed in 4% paraformaldehyde (PFA) at room temperature overnight. Subsequently, they were embedded in paraffin, sectioned into 5 µm slices, and subjected to hematoxylin and eosin (HE) analysis.
2.13. ROS detection
HBE cells (1x10^6 cells per well) were seeded in 6-well plates and cultured overnight. Following incubation with TP (100 µg/mL) and PM@TP/NPs (100 µg/mL) for 2 hours, the cells were stimulated with HDM (100 µg/mL) for 24 hours. Subsequently, the cells were treated with DCFH-DA at room temperature for 30 minutes according to the manufacturer's instructions. After washing the cells twice with PBS, the fluorescence intensity of DCF-HA within the cells was examined using a flow cytometer with a FITC channel. For the detection of reactive oxygen species (ROS) levels in lung tissues, lungs were dissected from both normal mice and asthmatic mice, immediately washed with PBS, and then immersed in DMEM medium containing 100 µM DCFH-DA at 37°C for 30 minutes. After washing the lung tissues twice with DMEM medium, the fluorescence intensity of the tissues was visualized using a Small Animal Live Imaging System (Eastman Kodak Co, USA).
2.14. RT-qPCR
Total RNAs from lung tissues and cells were isolated using TRIzol reagent (Invitrogen) following established protocols[20]. Briefly, 1 µg of total RNA was reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa) according to the manufacturer's instructions. Quantitative PCR (qPCR) was performed with SYBR Green Master Mix (YEASEN) using The LightCycler® 96 Instrument (Roche, Germany). The relative expression levels were calculated using the comparative Ct value method, with mRNA levels normalized to Gapdh. The primers utilized for RT-qPCR in this study are listed in Table 1.
Table 1
List of primers used for RT-qPCR.
Gene Forward primer Reverse primer Mouse Il4 GGTCTCAACCCCCAGCTAGT GCCGATGATCTCTCTCAAGTGAT Il5 CTCTGTTGACAAGCAATGAGACG TCTTCAGTATGTCTAGCCCCTG Il13 CCTGGCTCTTGCTGCCTT GGTCTTGTGTGATGTTGCTCA Il6 ATGAAGTTCCTCTCTGCAAGAGACT CACTAGGTTTGCCGAGTAGATCTC Tnfα CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG Ccl2 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT Ccl20 AAGACAGATGGCCGATGAAG AGGTTCACAGCCCTTTTCAC Il25 ACAGGGACTTGAATCGGGTC TGGTAAAGTGGGACGGAGTTG Muc5ac GGACTTCAATATCCAGCTACGC CAGCTCAACAACTAGGCCATC Muc5b GCCGAGGCAAGTACCTGTC ACAGCCCTTATACCGCAAGAC Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA |
Human Ccl2 ATGAAAGTCTCTGCCGCCCT GGCATTGATTGCATCTGGCTG Ccl20 CAAGAGTTTGCTCCTGGCTGCTGC AGTCAAAGTTGCTTGCTTCTGAT Il25 CCCCCTGGAGATATGAGTTGG GAGCCTGTCTGTAGGCTGAC Gapdh ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC |
2.15. Immunoblot analysis
Immunoblot analysis was conducted following established procedures [21]. In brief, the samples were lysed with RIPA buffer supplemented with a proteinase inhibitor cocktail (Roche, USA) for 30 minutes on ice. The supernatants were collected by centrifugation at 12,000 g for 20 minutes. Protein concentrations were determined using a BCA assay. Subsequently, 40 µg of protein samples were separated by 10% SDS-PAGE and electro-transferred onto a PVDF membrane (Millipore, Billerica, USA). The membranes were then blocked and immunoblotted with primary antibodies (P-selectin/CD62p antibody, Proteintech Inc. USA; p-Erk1/2, p-P38, and GAPDH antibodies; Cell Signaling Technology Inc. USA). Finally, the blots were visualized using enhanced chemiluminescent reagents (Millipore) and imaged with an AI600 software (GE Healthcare, USA).
2.16. Statistical analysis
All statistical analysis was performed by unpaired Student’s t-tests or ANOVA using GraphPad Prism 5. P < 0.05 was considered for the statistical significance. Results represent mean ± standard deviation (SD).