Preconception maternal gut dysbiosis affects enteric nervous system development and disease susceptibility in offspring

doi:10.21203/rs.3.rs-4408084/v1

Download PDF

Article

Preconception maternal gut dysbiosis affects enteric nervous system development and disease susceptibility in offspring

https://doi.org/10.21203/rs.3.rs-4408084/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Maternal health, specifically changes in the gut microbiota, profoundly affects the health of offspring. However, our understanding of how gut microbiota alterations during preconception period influence their offspring remains limited. In this study, we are dedicated to investigate the impact of preconception maternal gut microbiota disturbance on offspring enteric nervous system (ENS) development in mice and explore the underlying mechanisms. Through in vivo and in vitro experiments, we made a novel discovery that preconception maternal exposure to antibiotics before pregnant leads abnormal development of the offspring’s ENS, increasing their susceptibility to water avoidance stress. Supported by metagenomic, targeted metabolome, and transcriptome analysis, we identified that preconception antibiotic exposure disrupts the expression of genes crucial for embryonic ENS development by altering the composition of the maternal gut microbiota. Furthermore, our multi-omics analysis combined with Limosilactobacillus reuteri (L. reuteri) gestational supplementation illustrated that maternal gut microbiota and metabolites influence embryonic ENS development via the propionate-GPR41-GDNF/RET/SOX10 signaling pathway. Our findings highlight the critical importance of maintaining a healthy maternal gut microbiota during the preconception period for proper ENS development in offspring.

Biological sciences/Developmental biology

Biological sciences/Microbiology/Bacteria/Bacterial host response

Biological sciences/Cell biology/Cell signalling

Health sciences/Diseases/Gastrointestinal diseases

Preconception

Antibiotics

Gut microbiota

Offspring

Enteric nervous system

The maternal gut microbiota plays a crucial role in the health of offspring, particularly influencing brain¹, immune system², and intestinal development³. However, the effects of maternal gut microbiota during preconception period on offspring remains underexplored. A recent study revealed that a disruption in gut microbiota during this critical period can predispose offspring to food allergies⁴. Notably, when gut microbiota is disrupted, it can take up to 3–6 months to recover, often resulting in a significantly altered and less diverse microbial community⁵. Therefore, perturbations in the gut microbiota during preconception period have the potential to persist throughout pregnancy, thereby profoundly affecting the health of mammalian offspring.

The enteric nervous system (ENS), composed of enteric neurons and enteric glia cells (EGC), spans the entirety of the gastrointestinal tract. Its ganglia interconnecting neural fibers form two principal plexuses: the myenteric plexus (MP) and the submucosal plexus (SMP)⁶. The MP predominantly governs muscle contraction and relaxation, whereas the SMP regulates epithelial secretion and local blood flow⁷. Nowadays, it is widely recognized that the ENS’s influence transcends gastrointestinal motility and secretion, encompassing immune modulation^8,9, maintenance and repair of the epithelial barrier¹⁰, interaction with the central nervous system^11,12, and involvement in various pathogenesis conditions, such as Hirschsprung's disease¹³, gut-brain interaction disorders¹⁴, inflammatory bowel disease (IBD)¹⁵, and colorectal cancer¹⁶.

The ENS develops as enteric neuro crest cells (ENCCs) originating from the vagus nerve and sacral neural crest colonize the foregut. These cells then proliferate and migrate throughout the entire intestine¹⁷. As the ENCCs differentiate into enteric neurons and EGCs, they form the MP. Subsequently, the MP migrates inward to constitute the SMP, distributing within the submucosal layer¹⁸. After birth, ENS development is primarily characterized by further refinement, with relatively stable proportions of neuronal subtypes¹⁹. Notably, microorganisms can influence the fetal ENS development within the uterus. For instance, maternal chlamydia infection has been associated with a loss of intestinal neurons and glial cells in the ENS of sheep fetuses²⁰. However, research examining the impact of preconception maternal gut dysbiosis on fetal ENS development and disease susceptibility, particularly in relation to disorders of gut-brain interaction, remains elusive.

In the present study, we created an antibiotics-induced preconception maternal gut microbiota dysbiosis model to explore the characteristics of the ENS in offspring and their disease susceptibility. Our findings reveal that the use of antibiotics during the preconception period significantly affects the development and function of the ENS in offspring, increasing their susceptibility to water avoidance stress (WAS). This preconception antibiotics treatment altered the maternal gut microbiota and metabolic profile during pregnancy, particularly impacting the enrichment of Limosilactobacillus reuteri (L. reuteri) and the cecum propionate level. These changes downregulated the expression of ENS development-related genes by suppressing GPR41 expression in the embryonic colon. Interestingly, supplementation with L. reuteri during gestation could reverse these effects on offspring’s ENS development. This study sheds light on preconception risk factors for gut development and offers valuable insights for preconception health care.

1. Maternal preconception antibiotics exposure leads to ENS dysplasia in juvenile offspring

To explore how preconception maternal gut microbiota dysbiosis might affect the offspring's ENS development, we administered antibiotics (ABX) to female mice. The mice underwent a week of ABX treatment, followed by a withdrawal period before mating, with access to food and water Ad libitum until the birth of their pups (Fig. 1A). In comparison to the control (CON) group, the ABX group exhibited no significant differences in terms of pregnancy rate per cage, pup numbers per dam, and maternal weight during pregnancy, suggesting that the ABX regimen did not compromise the dams’ fertility (Fig. 1B). Since lactation is pivotal for mammalian growth and development, we focused our analysis on the colonic MP of newly weaned 3-week-pups, including both males and females. Our observations revealed a noticeable difference in the proximal colonic MP of the ABX group, which appeared more dispersed and less dense in HuC/D⁺ staining in the juvenile offspring (Fig. 1C). We proceeded to count HuC/D⁺ neurons, S100β⁺ EGCs, and two key neuronal subpopulations: neuronal nitric oxide synthase (nNOS)⁺ (inhibitory neurons) and choline acetyltransferase (ChAT)⁺ (excitatory neurons) within each ganglion. Remarkably, we noted a reduction in HuC/D⁺ neurons and S100β⁺ EGCs in the colonic MP ganglia of juvenile mice from the ABX group (Fig. 1C), along with a decrease in the proportion of ChAT⁺ neurons. However, the ratio of nNOS⁺ neurons remained unaffected (Fig. 1D). Noteworthy, the colonic MP of ABX pups showed a marked increase in nestin⁺ cells, suggesting a heightened reparative response to ENS damage.

Considering the developmental disturbances observed in colonic enteric neurons and their subtypes, we employed an ex vivo colonic muscle strip perfusion system to assess motor functional impairments in ABX pups. Our findings showed that juvenile mice in the ABX group exhibited impaired cholinergic neurotransmission, as indicated by attenuated colonic muscle strip contractions in response to carbachol (a cholinergic agonist) (p = 0.07) and diminished muscle strip relaxation upon administration of atropine (a cholinergic antagonist). To investigate nitric neurotransmission, we used L-NAME (a NO synthases inhibitor) and L-arginine (a NO precursors). The data demonstrated no notable differences in both L-NAME-induced contractions and L-arginine-induced relaxations between the juvenile mice in the CON and ABX group (Fig. 1E). These results suggest a more pronounced impairment in the cholinergic pathway responsible for colonic contraction, potentially causing weakened colonic contractions and slowed transit. Furthermore, we examined the effects of preconception ABX treatment on intestinal mucosal development in weaning offspring. Histological staining of the ileum and colon tissues showed that ABX pups had reduced villus length in the ileum, decreased crypt depth in the colon, and a lower number of goblet cells in colonic crypt compared to the CON pups (Fig. 1F). These findings indicate that preconception maternal ABX treatment not only led to aberrant ENS development and motor function in juvenile offspring but also impacted intestinal mucosal development.

2. Offspring of dams treated with antibiotic exhibit enduring ENS dysplasia and increased disease susceptibility

To explore whether the developmental abnormalities of the ENS observed in juvenile offspring persist into adulthood, we examined the colonic MP of adult offspring from dams treated with antibiotics during preconception period. Given the known association between ENS abnormalities and gastrointestinal function disorders, we employed WAS as a stimulus to evaluate the susceptibility of these offspring to gut-brain interaction disorder’s diseases (Fig. 2A). To eliminate potential biases introduced by female sex hormones on stress models, we limited the WAS study solely on male adult mice. Similarly, we quantified the expression of HuC/D⁺ neurons, as well as nNOS⁺ and ChAT⁺ neurons in each ganglion. Our results indicate that the number of HuC/D⁺ neurons and S100β⁺ EGCs remained reduced in the adult offspring of the ABX group, while the proportion of ChAT⁺ and nNOS⁺ neuron no longer showed significant differences. Exposure to WAS did not alter the counts of HuC/D⁺ neurons and S100β⁺ EGCs, however, it did induce an increase in the proportion of the ChAT⁺ neuronal subtype in both the CON and ABX groups, but no difference between ABX and CON groups (Fig. 2B). Analysis of mRNA expression of TGF-β2 in the colon of adult offspring revealed significantly higher levels in the ABX-WAS group compared to the CON-WAS group (Fig. 2C), suggesting a possible mechanism for the more severe ENS alterations observed. In the ex vivo colonic muscle strip perfusion experiments, we observed that there were no significant differences in the cholinergic neural pathway among adult offspring. However, the NOergic neural pathway was impaired in the ABX offspring. After WAS, the ABX offspring exhibited a more pronounced cholinergic response but a weaker NOergic response compared to the CON-WAS group (Fig. 2D). These findings suggest that preconception ABX-induced ENS dysplasia in offspring may underlie the disrupted intestinal motility observed in response to WAS. Furthermore, we evaluated in vivo small intestine motility using carmine solution propulsion distance, colonic transit capacity through fecal pellet count and bead latency, and colonic secretory function based on fecal water content. Colonic transit was slower in the ABX offspring compared to the CON offspring, while small intestine transit and fecal water content showed no differences (Fig. 2E, F). Following WAS, both the CON and ABX offspring displayed a reduction in colonic transit, with a greater effect in the ABX offspring (Fig. 2E, F). These results confirm persistent colonic ENS abnormalities in offspring of dams exposed to preconception antibiotics, which contribute to weakened colonic contraction and a significant acceleration in response to stress.

Based on our observations of ENS dysplasia and abnormal intestinal mucosa in juvenile offspring of ABX dams, we conducted further investigations into visceral sensitivity, colonic barrier function, and colonic immunity in adult offspring. The application of WAS significantly increased colorectal distension-induced abdominal wall electromyography (CRD-EMG) activity in adult offspring, with a more pronounced response noted in the ABX group (Fig. 3A, B, Extended Data Fig. 1A, B). Using transmission electron microscopy, we examined the ultrastructure of colonic epithelial cells in adult offspring. The offspring from the ABX group showed shorter microvilli, wider tight junctions (TJs) between colonic epithelial cells, shorter lengths of TJs, and a lower density of electron-dense material (Fig. 3C, Extended Data Fig. 1C, D). Modeling with WAS resulting in the shortening of microvilli and widening of TJs in colonic epithelial cells. Notably, the offspring of ABX-WAS displayed even shorter tight junction lengths, decreased areas of electron-dense material, along with indications of bridge granule fragmentation and microvilli deterioration (Fig. 3C, Extended Data Fig. 1C, D). Further analysis revealed a significant downregulation of Occludin mRNA expression in the ABX-sham group compared to the CON-sham group, confirming the presence of abnormal colonic barrier function in the adult offspring of the ABX dams (Fig. 3D). An impaired gut barrier serves as a crucial structural basis for the inflammation. The ABX-WAS offspring exhibited significantly greater changes in mRNA expression of inflammatory markers, including TNF-α and CSF-1, compared to the CON-WAS offspring (Fig. 3E). Mast cells are known to contribute to visceral hypersensitivity. Although the number of colonic mucosal mast cells did not show a significant difference between the CON and ABX offspring; the ABX offspring displayed a more pronounced response to WAS (Fig. 3F). Furthermore, we analyzed the expression of inflammatory factors in the colons of adult offspring. TNF-α and IL-17A presented significant differences between the ABX and CON groups (Fig. 3G). These results align with previous research on IBS and associated mechanisms^21,22. In summary, based on these findings, we propose that adult offspring derived from dams in the preconception antibiotics exposure group exemplify underdeveloped physiological foundations of the colonic ENS and colonic mucosal barrier. When exposed to WAS, they exhibit a more striking ENS response, barrier disruption, and inflammation within the colon, ultimately leading to susceptibility and more severe abnormalities in intestinal motor, sensory, and barrier functions.

3. ENS dysplasia emerges during embryonic development in the offspring of dams treated with antibiotics via RET/GDNF/SOX10 signaling pathways

Given the profound and enduring developmental abnormalities observed in the ENS and intestinal mucosa of offspring from the ABX group, we postulated that these aberrations might originate during the embryonic stage, a crucial period for growth and development. Therefore, we procured intestinal tissues from embryonic day (E) 13.5 and E18.5 from both the CON and ABX groups, aiming to assess the migration and proliferation of the ENS (Fig. 4A). As anticipated, the E13.5 embryos from the ABX group exhibited a notable shorter intestine length from the pylorus to the anus in comparison to the CON group, although the colon width remained unaffected (Fig. 4B). Additionally, the migration distance percentage of Tuj1⁺ nerve fibers in the ABX group's E13.5 embryos was significantly lower compared to the CON group. When further segmenting the intestine into ten equal parts, a discernible decrease in the density of Tuj1⁺ nerve fibers was observed in the fetus of ABX group, particularly significant in the colon (occupying the 80%-100% segment of the intestine) (Fig. 4B). Subsequently, Tuj1⁺ staining was performed on the colon tissue of E18.5 embryos, revealing a substantial diminution on the Tuj1⁺ staining area in the ABX group relative to the CON group (Fig. 4C). It's worth noting that SOX10⁺ cells are recognized as precursor cells crucial for ENS development. Notably, the count of SOX10⁺ cells in the ABX E18.5 embryos was significantly lower than that of CON group (Fig. 4C), indicating a compromised proliferation efficiency of the ENS. To delve deeper into the potential abnormalities in gene expression and the underlying mechanisms associated with colonic ENS and mucosal development in embryos of ABX group, we conducted a transcriptome analysis on colon tissues derived from E18.5 embryos. Our findings revealed 567 differentially expressed genes, of which 154 were upregulated, and 413 were downregulated in the ABX group (Fig. 4D, Extended Data Fig. 2A). Eminently, several genes renowned for their close association with ENS development, such as Mmp2, Ntrk2, Gfra3, and Dcc, demonstrated significant downregulation in the ABX group (Fig. 4D). The Gene Ontology (GO) pathway enrichment analysis revealed a near absence of upregulated genes linked to developmental processes in the ABX group (Extended Data Fig. 2B). Through Cytoscape's expansion of the GO enrichment outcomes, multiple growth and development-related pathways were identified. Interestingly, both “digestive system development” and “nervous system development” featured among the enriched pathways (Fig. 4E). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis highlighted a significant enrichment of the “Wnt signaling pathway” (Fig. 4F), a crucial signaling pathways for hindgut development, corroborating the observed colon developmental abnormalities in the offspring of the ABX group. Further Gene Set Enrichment Analysis (GSEA) demonstrated significant downregulation of multiple pathways enriched in both the GO and KEGG databases, encompassing “nervous system development”, “muscle tissue development”, and the “Wnt signaling pathway” in the E18.5 colon of ABX group fetuses (Fig. 4G, Extended Data Fig. 2C-F). The proliferation, migration, and differentiation of ENS predominantly involve the RET/GDNF signaling pathway and the EDN3/EDNRB signaling pathway, with SOX10 playing a pivotal role as a transcription factor in both. Analysis of mRNA expression for these key molecules in the E18.5 embryonic colon revealed a downregulation of RET, GDNF and SOX10 mRNA expression in the ABX group (Fig. 4H). Interestingly, mRNA expression of EDNRB was significantly upregulated in the colon of ABX fetuses (Fig. 4H), suggesting a compensatory adaptation to counteract the downregulation of the RET/GDNF signaling. These observations implicate that preconception ABX treatment can disrupt normal embryonic colon ENS development, primarily through signaling pathways involving RET/GDNF/SOX10.

4. Preconception antibiotics exposure profoundly influences the maternal gut microbiome and metabolome

To delve into the mechanisms leading to abnormal ENS development in fetal mice from the ABX group, we conducted a comprehensive assessment of the maternal gut microbiota and its metabolites. Fecal samples were collected from dams at E18.5 for metagenomic analysis. Our Findings revealed a notable decrease in alpha diversity, as indicated by the Shannon and Simpson indices, in the microbiota of preconception ABX dams (ABX-DAM) compared to the control group (CON-DAM) (Fig. 5A, Extended Data Fig. 3A). Principal Coordinate Analysis (PCoA) based on the Bray-Curtis distance metrics further confirmed the distinct clustering between the ABX-DAM and CON-DAM group. (Fig. 4B, Extended Data Fig. 3B). Specifically, at the phylum level, significant differences were observed in the abundance of Firmicutes and Bacteroidetes between the two groups, resulting in a significantly decreased F/B ratio in the ABX-DAM group (Extended Data Fig. 3C, D). LEfSe analysis identified Lactobacillus and Paramuribaculum as key genera distinguishing the CON-DAM group, while Bacteroides and Parabacteroides had the most significant impact on the ABX-DAM group (Extended Data Fig. 3E-G). For details, the ABX-DAM group harbored a greater number of unique species, including potentially harmful pathogens such as Escherichia coli and Klebsiella oxytoca (Fig. 5D). Among the common species, many beneficial bacteria were depleted in the ABX-DAM group, such as Lactobacillus intestinalis, Limosilactobacillus reuteri (L. reuteri), and Muribaculum gordoncarteri (M. gordoncarteri). In contrast, species such as Parabacteroides distasonis and Bacteoides acidifaciens were enriched in the ABX-DAM group (Fig. 5E, F). To gain deeper insights into the taxonomy interrelationships within maternal gut microbiota during late pregnancy, we employed a co-occurrence network analysis. Despite the decreased alpha diversity in fecal samples from the ABX-DAM group, their internal microbial interactions were more complex. Saliently, within the predominant species, the interactions within the ABX-DAM group remained intricate and were dominated by negative correlations (Fig. 5G). This underscores the competitive relationships and nuanced regulatory mechanisms within the microbial reconstitution process of the ABX-DAM group. Moreover, our analysis revealed depletion of functional pathways involved in amino acid and nucleotide synthesis in the ABX-DAM group, while certain pathways related to the pentose phosphate pathways showed enrichment (Extended Data Fig. 4A-D). These findings suggest that preconception ABX treatment significantly alters the maternal gut microbiome and metabolome, potentially contributing to the observed abnormalities in ENS development in the offspring.

Due to variations in the abundance of bacteria capable of producing short chain fatty acids (SCFAs) between the CON-DAM and ABX-DAM groups, we evaluated SCFA levels in both the cecal contents and serum of maternal mice at E18.5. In the ABX-DAM group, the concentrations of acetate, propionate, butyrate, and valerate in the cecal contents were notably lower than those in the CON-DAM group, with propionate and valerate showing particularly large fold changes. However, no appreciable differences were observed in the serum levels of these SCFAs (Fig. 5H, I, Extended Data Fig. 5A, B). To investigate whether there were metabolite differences beyond employed a targeted metabolome approach to further analyze the cecal contents and serum of the maternal mice at E18.5. Our metabolome analysis of the cecal contents revealed a distinct separation between the groups based on OPLS-DA analysis (Extended Data Fig. 5C). Using volcano plots and bar plots, we identified key metabolites in the cecal contents, including indoleacetic acid and N6-methyladenosine, both of which were consistently downregulated in the ABX-DAM group and strongly correlated with each other (Fig. 5J, K, Extended Data Fig. 5D). Additionally, KEGG pathway enrichment analysis demonstrated distinct metabolic capabilities between the two groups (Extended Data Fig. 5E). The analysis of the serum metabolome also exhibited a clear separation between the groups, with a tighter intra-group clustering compared to the cecal contents (Extended Data Fig. 5F). The volcano plots and bar plots highlighted corticosterone and cortexolone as the two compounds with the largest downregulated fold changes in the ABX-DAM group, exhibiting a robust correlation (Fig. 5L, M, Extended Data Fig. 5G). Prominently, the concentrations of phenol and caffeine were markedly upregulated in the ABX-DAM group. Furthermore, KEGG pathway enrichment analysis indicated to several significantly downregulated metabolic pathways in the ABX-DAM group (Extended Data Fig. 5H). Although there is minimal overlap in differential metabolites between cecal contents and serum, the trends in concentration changes between the two are consistent. (Fig. 5L). Collectively, our findings highlight substantial modifications in the gut microbiota and its metabolites in the ABX group, which may contribute to the emergence of ENS abnormalities.

5. Multi-omics analysis reveals that L. reuteri, M. gordoncarteri, and propionate significantly influence ENS development.

Utilizing a multi-omics approach, we investigated the key microbial species and metabolites linked to the development of the ENS. Initially, through Spearman correlation analysis, we identified M. gordoncarteri and L. reuteri as core species within the interacting network of differentially abundant bacteria. Additionally, we determined that hyocholic acid, uridine, propionate, and valerate in cecal contents, alone with corticosterone and cortexolone in serum, occupy important positions as core metabolites. Scatter plots illustrated the relationship between propionate and both M. gordoncarteri and L. reuteri (Fig. 6D, E). Furthermore, our analysis uncovered PWY-6527, PWY6317, 1CMET2-PWY, and PWY7977 as core metabolic pathways. Notably, L. reuteri and other Lactobacillus species significantly contributed to the depleted pathways in the antibiotic-treated dams (ABX-DAM), whereas opportunistic pathogens like Escherichia coli contributed more to the enriched pathways, highlighting distinct microbial profiles between the two groups (Extended Data Fig. 6A-E). To pinpoint the crucial metabolites and core bacterial species influencing embryonic ENS development, we correlated differentially abundant maternal bacteria, cecal metabolites, and the mRNA expression levels of five crucial ENS developmental genes in the embryonic colon (previously examined in Fig. 4H). The RET/GDNF pathway and SOX10 exhibited stronger correlations than the EDN3/EDNRB pathway (Fig. 6F). Significant positive correlations were observed between M. gordoncarteri, L. reuteri, propionate, valerate and the expression of RET, GDNF, SOX10 (Fig. 6F). Given the lower concentration of valerate compared to propionate, we identified propionate in cecal content as a key metabolite. Additionally, serum corticosterone and cortexolone levels positively correlated with the mRNA expression of RET and GDNF in the embryonic colon (Extended Data Fig. 7A). Analysis of metabolites receptors in the fetal colon, revealed significant downregulation or decreasing trends of TGR5, TLR2, NR3C1, and NR3C2 in the ABX group, except for TLR4 (Fig. 6I, Extended Data Fig. 7C). Exploring the mechanisms through which maternal metabolites exert their effects, we found consistent positive correlation between metabolite levels and the mRNA expression of corresponding receptors in the embryonic colon. Propionate and valerate showed the strongest correlation with GPR41 (Fig. 6J, Extended Data Fig. 7B). The relationship between GPR41 expression and RET, GDNF, and SOX10 was particularly pronounced (Fig. 6K, Extended Data Fig. 7D), suggesting GPR41’s critical role in embryonic ENS development. Based on these findings, we propose that the core bacterial species M. gordoncarteri and L. reuteri, influence propionate production and facilitate ENS development via GPR41, which impeded by preconception ABX treatment.

6. Limosilactobacillus reuteri plays a crucial role in the ENS development via the propionate-GPR41 signaling pathway

In consideration of M. gordoncarteri is exclusively observed in rodents and may exhibit pathogenicity; we focused on L. reuteri due to its beneficial metabolites, such as SCFAs and tryptophan derivatives, and its profound impact on the microbial community structure. To identify probiotic beneficial for ENS development with potential clinical applications, we chose L. reuteri as an intervention throughout gestation. This was done to mitigate any adverse effects of preconception ABX treatment on embryonic ENS development at early as possible (Fig. 7A). Preconception ABX treatment was found to influence colon length, Tuj1⁺ fiber migration percentage, and density in E13.5 mouse embryos. However, gestational supplementation with L. reuteri demonstrated a remarkable ameliorative effect on the migration and density of the ENS (Fig. 7B). Subsequent staining of E18.5 mouse embryo colons for Tuj1⁺ fibers and SOX10⁺ cells revealed that L. reuteri effectively rescued the Tuj1⁺ staining area affected by preconception ABX treatment, although its impact on SOX10⁺ cell counts was less pronounced (Fig. 7C). mRNA expression analysis of embryonic colons demonstrated that L. reuteri supplementation reinstated the downregulated RET/GDNF pathway induced by preconception ABX treatment. (Fig. 7D). We conducted analyses of SCFAs level in maternal cecal content and serum during the late gestational period. Significant higher levels of acetate and propionate was observed in the ABX^reuteri group, while butyrate and valerate levels exhibited less significant changes (Fig. 7F, Extended Data Fig. 8A). Serum levels of SCFAs showed only an upward trend (Extended Data Fig. 8B). Correlation analysis between the mRNA expression of RET, GDNF, and SOX10 revealed significant correlations with propionate and valerate, surpassing those with acetate and butyrate (Fig. 7G, Extended Data Fig. 8C). Notably, embryonic colon GPR41 mRNA showed a strong correlation with maternal cecum propionate and demonstrated significant recovery in the ABX^reuteri group (Fig. 7H, Extended Data Fig. 8D). Additionally, intervention with L. reuteri rescued the expression of TGR5 (Extended Data Fig. 8E). Furthermore, embryonic colon GPR41 exhibited significant positive correlations with the mRNA expression of RET, GDNF, and SOX10, emphasizing the vital role of propionate in embryonic ENS development. Collectively, our findings suggest that supplementation with L. reuteri after ABX treatment during pregnancy can elevate propionate levels in cecal content. This, in turn, modulate the expression of RET, GDNF, and SOX10 through the GPR41 signaling pathway, promoting the amelioration of ENS dysplasia induced by preconception ABX treatment.

Extensive research has delved into the correlation between maternal gut dysbiosis and the development and disease predisposition of offspring. A significant portion of this exploration has focused on the gestation and lactation phases, while the preconception gut microbiota’s importance remains underexplored. The ENS, a vital component of the digestive tract, plays a pivotal role in various gastrointestinal conditions. However, it remains uncertain whether maternal gut disturbances preceding pregnancy can affect ENS development in offspring, potentially increasing their susceptibility to gastrointestinal diseases. Our findings reveal that preconception maternal antibiotics exposure significantly alters ENS development in both juvenile and adult offspring, predisposing them to conditions like central stress in adulthood. Remarkably, these alterations originate during the embryonic stage. This study indicates that preconception maternal antibiotics exposure impacts both the gut microbiota composition and metabolic signatures in cecal contents and serum. Specifically, antibiotics block the production of propionate by L. reuteri during pregnancy, disrupting the GPR41-RET/GDNF/SOX10 signaling pathway and ultimately impeding embryonic ENS maturation.

Previous studies have established that the maternal gut microbiota influence the development of the digestive, nervous, and immune systems in offspring. For instance, prenatal exposures to food additives or organic pollutants can affect colonic crypt development in offspring by altering the maternal gut microbiota^3,23. Moreover, gut dysbiosis during the preconception period has been linked to immune dysregulation in offspring, although the exact mechanisms remain incompletely understood⁴. It is important to note that prenatal ENS development is susceptible to various maternal factors. Limited protein intake and vitamin A deficiency during gestation can affect the function of ENS in offspring^24,25. In our study, juvenile mice from dams exposed to antibiotics exhibited reduced enteric neurons and EGCs counts per ganglion, accompanied by sluggish colonic motility. This study is the first to demonstrate that imbalances in the gut microbiota of mothers prior to conception can indeed impact ENS development in their offspring.

The ENS continues to mature after birth, relying on enteric neural precursor cells (ENPCs) often marked by nestin²⁶. Our results showed that juvenile mice in the antibiotic-exposed group had a higher count of nestin⁺ cells. However, in adulthood, these mice had fewer enteric neurons and EGCs, resulting in a significant prolongation of colonic transit time. This indicates that the ENS’s self-repair mechanism was inadequate to normalize colonic motility in adult offspring from antibiotic-exposed dams. IBS is a common functional gastrointestinal disorder in which the ENS plays a pivotal role. Visceral hypersensitivity is a crucial pathophysiological mechanism in IBS. Mucosal barrier function and inflammation are associated with visceral hypersensitivity^27,28, and recent studies implicates the involvement of enteric neurons and EGCs^29,30. Our results showed that adult offspring from the antibiotic-exposed group exhibited increased visceral sensitivity, higher susceptibility to WAS, abnormal ENS, compromised colonic mucosal barrier function, and elevated inflammation levels. These findings offer insights into their heightened visceral sensitivity to WAS. These novel discoveries shed light on the intricate relationship between maternal gut microbiota and offspring’s ENS development, suggesting that preconception maternal gut dysbiosis is highly likely to be a risk factor for dysplasia in human offspring.

The embryonic phase holds utmost significance in the development of the ENS. The GDNF/RET pathway plays a pivotal role in ensuring the survival, proliferation, migration, differentiation, and neuronal growth of ENCCs. Likewise, the EDN3/EDNRB pathway is instrumental in regulating the proliferation, differentiation, and migration of these cells. A key component in both pathways is SOX10, a crucial transcription factor that sustains the proliferative state of ENCCs and steers the development of EGCs¹⁷. Our data showed a downregulation of mRNA expression for RET, GDNF, and SOX10 in the colon of embryos from dams treated with antibiotics. This suggests that the abnormal ENS development in embryos from ABX dams is intricately linked to the GDNF/RET/SOX10 pathway. Interestingly, EDNRB mRNA expression was upregulated, possibly as a compensatory mechanism. Moreover, blocking the Wnt pathway disrupts the normal proliferation and differentiation of colonic epithelial tissue³¹. Significantly, our study found the Wnt pathway to be downregulated in offspring from the ABX group, providing an explanation for the intestinal abnormalities and mucosal barrier dysfunction observed in these mice. To our knowledge, this is the first study to delve into the transcriptome analysis of the embryonic colon in response to maternal gut microbiota dysbiosis in mice, thereby advancing our understanding of how maternal microbiota affects embryonic ENS development.

Our study suggests that the gut microbiota of ABX dams during pregnancy experiences a reduction in potential beneficial and neutral bacteria. Among these bacteria, L. reuteri stands out due to its ability to produce various beneficial metabolites vital for bodily functions and its profound impact on the microbial community structure^32,33. Previously studies have shown that L. reuteri can effectively enhance gut and central nervous system development in offspring whose mothers were exposed to high-fat diet, LPS, or antibiotic^34,35. In our multi-omics analysis, L. reuteri emerged as a key species contributing to ENS development. Furthermore, our interventional studies with L. reuteri during pregnancy in ABX dams showed its partial ability to improve ENS density and migration, further validating its importance in ENS development and paving the way for potential clinical probiotic treatment strategies.

Additionally, Lactobacillus is renowned for its ability to counteract pathogens and positively influence the development of the central nervous system, immune system, and metabolism-related systems in offspring³⁶. In our study, a decrease in the abundance of Lactobacillus johnsonii and Lactobacillus intestinalis in the gut microbiota of ABX dams correlated with abnormal intestinal mucosal development in their offspring. The gut microbiota of pregnant ABX dams was dominated by opportunistic pathogens and potentially harmful bacteria. Notably, an increased abundance of Escherichia coli has been associated with abnormal central nervous system development in offspring due to factors such as maternal stress and a high-fat diet^37,38. Klebsiella oxytoca, another opportunistic pathogen, has been linked to the onset and poor prognosis of several diseases³⁹. These findings underscore the detrimental effects of preconception antibiotics treatment on the maternal gut microbiota, which can have far-reaching consequences that impede offspring development.

The analysis of cecal contents revealed significantly reduced levels of SCFAs in ABX dams. Previous studies have documented the profound effects of acetate, propionate, and butyrate in promoting the proliferation and migration of ENCCs in both in vitro and in vivo settings^40,41. Among SCFAs, propionate holds particularly significant as it can be sensed during the embryonic stage, driving the development of the pancreatic autonomic nervous system via GPR41 receptor activation⁴². In our comprehensive multi-omics analysis, propionate emerged as a critical regulator of genes involved in ENS developmental. Further exploration established a robust correlation between embryonic colon GPR41 expression and maternal cecum propionate levels, suggesting that propionate exerts its development influence on the ENS through GPR41 signaling pathway. Consistent with previous reports^43,44, our study also demonstrated that L. reuteri enhances host propionate production. Our intervention with L. reuteri in ABX dams further confirms the pivotal role of the propionate-GPR41-GDNF/RET/SOX10 pathway in ENS development.

However, it’s worth noting that preconception gut microbiota not only shapes the maternal gut microbiota during pregnancy but also has the potential to impact the activity and epigenetic modifications of reproductive cells^45,46, which are challenging to exclude in this study. Moreover, more in-depth research is warranted to delve into the molecular mechanisms by which GPR41 mediates the expression of ENS developmental-related genes.

In conclusion, the findings of this study provide compelling evidence for the significance of preconception gut microbiota health. This bridges a crucial gap in our understanding of the relationship between preconception maternal gut microbiota and the ENS development of offspring. Moreover, we have identified key species and metabolites that foster ENS development during embryogenesis, paving the way for future research directions and potential interventions (Extended Data Fig. 9).

Animals

Female (7 weeks old) and male (9 weeks old) C57BL/6J mice were obtained from the Department of Laboratory Animal Science, Peking University Health Science Center, Beijing, China, reared as specific pathogens free (SPF) mice. All experimental protocols were approved by the Animal Welfare and Ethics Committee of Peking University (LA2022657). The animals were housed in SPF facilities with a 12-hour light-dark cycle (lights on from 6:00 AM to 6:00 PM). Upon entering the SPF facility, all animals underwent a one-week acclimation period before proceeding to the next stage of the experiment. Unless specified, all mice had ad libitum access to sterilized food (Xietong Shengwu, Jiangsu, China) and water.

For the experimental investigation of the impact of gut microbiota dysbiosis on the development of ENS in juvenile and adult offspring, the ABX group of female mice received a daily oral gavage of a mixture containing neomycin (Innochem, Beijing, China) (100 mg/kg), metronidazole (Aladdin, Shanghai, China) (100 mg/kg), and vancomycin (Innochem, Beijing, China) (50 mg/kg) in the morning and evening, along with ad libitum access to ampicillin (Aladdin, Shanghai, China) (1 mg/ml) in drinking water, to simulate the preconception gut microbiota dysbiosis state. The CON group received oral gavage of the vehicle (sterile water). The oral gavage continued for one week, and they were mating with male mice in a 1:1 ratio during the subsequent week. The appearance of a vaginal plug was designated as E0.5. After the observation of a vaginal plug, the pregnant mice were transferred to new SPF cages and provided with ad libitum access to food and water. Weekly body weight measurements were recorded. After parturition, the offspring were also raised on SPF bedding, and their body weights were recorded weekly, while they had ad libitum access to food and water. A subset of the offspring (unspecified for sex) was sacrificed at 3 weeks of age for tissue collection. Considering the influence of hormonal fluctuations on visceral sensitivity, subsequent WAS modeling and subsequent testing and tissue collection were performed only on male mice that were not euthanized. Each individual offspring was considered as one sample size.

For the experimental investigation of the impact of gut microbiota dysbiosis on embryonic ENS development, the ABX group and CON group of female mice underwent the aforementioned ABX or vehicle treatment and were mated accordingly. Fetal mice were collected at E13.5 and E18.5. Additionally, serum, cecal contents, and feces samples were obtained from the dams. The data from all fetal (unspecified for sex) derived from a single dam were averaged to represent one sample size.

For the experimental intervention of L. reuteri in the context of gut microbiota dysbiosis, the treatment procedures for the ABX group and CON group remained unchanged. In the ABX^reuteri group, female mice underwent the aforementioned ABX treatment, and starting from E0.5, they received daily oral gavage of 200 µl of L. reuteri (BNCC, Henan, China) at a concentration of 1×10⁹ CFU/ml until the completion of tissue collection. CON and ABX dams were administered sterile water by gavage. The housing conditions, time of tissue collection, and sample size calculation followed the previously described methods.

WAS

The WAS paradigm was conducted by placing the offspring from the WAS group on a platform (3×6 cm) elevated 10 cm above the ground and fixed in the center of a box (60×50 cm) filled with room temperature water, with the water level reaching 1 cm below the top of the platform. The sham group was not subjected to water filling, while all other conditions remained the same. Each mouse in the WAS group was allowed to stay on the platform for 1 hour at a fixed time in the afternoon, for a duration of 10 consecutive days. During the modeling period, no interventions were made to the mice's behavior, and measures were taken to minimize noise, intense light, and other stimuli. At the end of each day's WAS or sham session, all fecal pellets in the collection container were counted as a measure of colonic motility⁴⁷.

Fecal water content.

The experiment was conducted on the same day as the final WAS session. The mice were individually placed in dry, bedding-free cages for 1 hour. Fecal pellets were collected every 15 minutes and immediately covered with centrifuge tube caps. After 1 hour, the collected fecal pellets were weighed as the wet weight. Subsequently, the fecal pellets were dried in a drying oven at 60°C for 24 hours and then weighed again as the dry weight. The fecal water content was calculated using the wet weight and dry weight to determine the proportion of water in the fecal pellets.

Colonic transit time

The colonic transit speed of mice was assessed using the bead latent test⁴⁸. The experiment was conducted on the second day after WAS. Briefly, mice were fasted (with access to water) for 12 hours. They were then lightly anesthetized using isoflurane (RWD, Guangdong, China), and a 2.5 mm spherical plastic bead coated with glycerol was gently inserted into the distal colon using a glass rod, positioning it 2 centimeters from the anus. Subsequently, the mice were individually placed in bedding-free cages, and the time from bead insertion to expulsion was recorded. The experiment was repeated twice with a 6-hour interval. The average of the two experiments was calculated as the bead expulsion latency.

Small intestinal transit time.

The experiment was conducted following the bead expulsion test. Each mouse was administered 200 µl of carmine red solution (6% carmine (Macklin, Shanghai, China) dissolved in a 0.5% carboxymethylcellulose (Bide, Shanghai, China) water solution) via oral gavage. After 45 minutes, the mice were euthanized using cervical dislocation method. The abdominal cavity was opened, and the small intestine was carefully removed intact from the pylorus to the ileocecal junction, minimizing any stretching of the intestinal tract. The small intestine was laid out in a straight line, and the proportion of the distance traveled by the carmine red solution to the total length of the small intestine was measured to assess intestinal transit function.

Visceral sensitivity test

CRD-EMG was performed following established methods with some modifications⁴⁹. A latex balloon (1 cm wide, 1.5 cm long) attached to a thin catheter (1 mm inner diameter, 1.5 mm outer diameter) at the head was prepared as a pressure-sensitive balloon. Mice were fasted (with access to water) for 24 hours prior to visceral sensitivity testing. After light anesthesia with isoflurane, a glycerol-coated balloon was inserted into the mouse's rectum, positioning its distal end approximately 1 cm from the anus. The catheter connecting the balloon was secured to the base of the mouse's tail using adhesive tape. The distal end of the balloon catheter was connected to a pressure gauge (World Precision Instruments, FL, USA) and a syringe via a three-way stopcock. After a 20-minute adaptation period, the balloon was rapidly inflated with pressures of 20 mmHg, 40 mmHg, and 60 mmHg in a random order, with each inflation maintained for 20 seconds and a 4-minute interval between inflations. Each pressure was repeated three times for measurement. Signals were collected and analyzed using the Biological Signal Acquisition System software (Taimeng, Sichuan, China). Changes in visceral sensation were represented by subtracting the area under the curve (AUC) during the 20 seconds corresponding to the pre-distension baseline from the AUC during the 20 seconds of distension.

Histology, electron microscopy, and immunofluorescence staining.

Histology: H&E staining was used to assess the intestinal mucosal development in the mouse pups. The ileum and colon were fixed in 10% formaldehyde-PBS solution for 24 hours, dehydrated, embedded in paraffin, and sectioned into 5 µm-thick slices. After deparaffinization and hydration procedures, the sections were stained with eosin and hematoxylin (Sigma-Aldrich, MO, USA), mounted with neutral gum (ZSGB-BIO, Beijing, China), and promptly captured for imaging.

PAS staining: PAS staining was performed to evaluate the development of goblet cells in the colons of offspring. Paraffin-embedded colon sections were deparaffinized, followed by incubation in 1% periodic acid solution (Sigma-Aldrich, MO, USA) for 10 minutes. Subsequently, the sections were stained with Schiff's reagent (Sigma-Aldrich, MO, USA) for 40 minutes, followed by counterstaining with Harris hematoxylin solution (Sigma-Aldrich, MO, USA) for 2 to 5 minutes. After each step, the stained sections were rinsed with PBS solution. Finally, the sections were mounted with neutral gum and promptly captured for imaging.

Transmission electron microscopy (TEM): Colon slices measuring 3mm × 3mm were fixed in 4% paraformaldehyde for 24 hours, followed by fixation with 1% osmium tetroxide. The tissues were embedded in neutral resin and sectioned into thin slices. The sections were stained with uranyl acetate and lead citrate, and then stored under dry conditions for imaging purposes, which were promptly conducted.

Whole mounts staining of longitudinal muscle-containing myenteric plexus (LMMP): The colon tissue was opened along the mesentery and fixed with 4% paraformaldehyde solution in a culture dish containing silica gel, with the serosal side facing down. The fixation was carried out at 4°C for no more than 6 hours. Then, a 20% sucrose solution (Aladdin, Shanghai, China) was added for dehydration, and the samples were stored at 4°C until further processing. Subsequently, under a dissecting microscope, the samples were dissected by gently scraping off the mucosa and separating the submucosal and circular muscle layers to obtain the LMMP. Afterward, the samples were incubated at room temperature for 2 hours in a blocking solution containing 0.3% Triton X-100 (Aladdin, Shanghai, China) and 10% donkey serum (Solarbio, Beijing, China) in PBS. Following the blocking step, the primary antibody was applied and incubated at 4°C for 48 hours. After removing the primary antibody solution, the samples were washed with PBS (3 times, 15 minutes each) and incubated with the secondary antibody at room temperature for 4 hours. Subsequently, the samples were co-incubated with Hochest33342 (Solarbio, Beijing, China) for 5 minutes to label the cell nuclei, followed by PBS washes (5 times, 10 minutes each). The whole mounts were placed on adhesive-coated glass slides, covered with a fluorescence mounting medium, and stored in the dark at -20°C for further analysis. For fetal mouse intestinal nerve whole mounts, no microdissection step was required. The primary antibody was incubated at 4°C for 24 hours, and the remaining steps were the same as for the myenteric plexus whole mounts. All antibodies were diluted in a PBS solution containing 0.3% Triton X-100 and 10% donkey serum.

Immunofluorescence staining of cryosections: Immunofluorescence staining of cryosections was performed to assess the number of mast cells in adult mouse offspring. Intestinal tissue was fixed in 4% paraformaldehyde for 6 hours at 4°C. After washing with PBS, the tissue was immersed in 20% sucrose solution in PBS at 4°C for 24 hours, followed by transfer to 30% sucrose solution at 4°C for another 24 hours. Subsequently, the tissue was embedded in O.C.T. compound (SAKURA, CA, USA) and stored at -80°C. Cryosections of 8 µm thickness were cut and mounted on adhesive-coated glass slides, equilibrated to room temperature, and incubated at room temperature for 1 hour for blocking. Then, the primary antibody was added to the blocking solution and incubated overnight at 4°C. The next day, the sections were washed with PBS (3 times, 5 minutes each) and incubated with the secondary antibody at room temperature for 1 hour. Following that, the sections were co-incubated with Hoechst33342 for 5 minutes to label the cell nuclei, washed with PBS (3 times, 5 minutes each), and finally covered with an anti-fade mounting medium for fluorescence and stored at -20°C in the dark for further analysis.

Image acquisition and analysis

Whole-slide scanning was performed using a NanoZoomer (Hamamatsu, Shizuoka, Japan) for H&E and PAS-stained sections. Image acquisition of E18.5 fetus and offspring's ENS staining was carried out using confocal microscope (Zeiss, Badenwalburg, Germany). Fluorescence imaging of E13.5 ENS staining and adult offspring's mast cells was performed using inverted fluorescence microscope (Zeiss, Badenwalburg, Germany). TEM images of adult offspring's ultrathin sections were acquired using TEM (JEOL, Tokyo, Japan) at 120 kV. All samples were exposed for the same duration using the same equipment. For the assessment of postnatal intestinal development, 20 randomly selected villi/crypts were measured for length and cell count in each animal's section. The results for each sample were derived from the average values of the length of 20 villi/crypts. For the counting of postnatal neurons and glial cells, 10 randomly selected ganglia were counted in each slide. The results for each animal were obtained from the average counts of 10 ganglia. For the calculation of positive area and positive cell count, 10 images were selected at 20x objective magnification for each sample, and Image J software was used to analyze and measure the pixel number or cell count of positive immunolabeled regions of interest (ROI). The results for each sample were derived from the average values of positive area counts from 10 fields of view. For electron microscopy, at least 5 fields of view were studied in each sample using a magnification of ×5000. The experimental results were evaluated by an observer blinded to the experimental conditions.

In vitro intestinal motility assessment.

In vitro assessment of intestinal motility was performed using a validated method with some modifications⁵⁰. Juvenile or adult mouse colonic segments (approximately 1 cm) were obtained after euthanasia by cervical dislocation. The segments were mounted in an organ bath filled with Krebs buffer solution and continuously introduced with 95% O₂ and 5% CO₂ at 37°C for 20 minutes or until a stable baseline was reached, followed by the application of 0.3 g tension. Muscle contraction and relaxation levels before and after drug treatment were measured using the tension sensor system (Taimeng, Sichuan, Chine). Between each drug treatment, the colonic segments were washed three times with Krebs solution. Each colonic segment underwent two repeated tests. During the process, the Krebs solution was changed every 15 minutes. The following drug concentrations were used: 10 µM carbachol (Aladdin, Shanghai, China), 50 µM atropine (Aladdin, Shanghai, China), 2 mM L-NAME (Macklin, Shanghai, China), and 15 mM L-arginine (Macklin, Shanghai, China). The result is calculated by g tension/ g dry tissue weight.

Quantitative real-time PCR

Quantitative real-time PCR detection was performed to analyze the total RNA extracted from embryonic or offspring colons using the Tiangen RNA Extraction Kit (TIANGEN, Beijing, China). Following the determination of RNA concentration, cDNA amplification was carried out using a cDNA synthesis kit (Absin, Shanghai, China). The cDNA, qPCR MIX (Toyobo, Osaka, Japan), and corresponding primers were mixed and subjected to reaction in a QuantStudio 5 (Thermo Fisher Scientific, MA, USA). mRNA expression was normalized using Gapdh as the reference gene, and the mRNA levels were calculated using the 2^−ΔΔCt method.

	Forward sequence (5’–3’)	Reverse sequence (5’-3’)
Gapdh	GGTGCTGAGTATGTCGTGGA	CCTTCCACAATGCCAAAGTT
Ret	GAAAACGCCTCCCAGAGTGAG	GGAGATGAGGTCACCCATGGT
Gdnf	GCCACCATTAAAAGACTGAAAAGG	GCCTGCCGATTCCTCTCTCT
Sox10	GCCCGTGCCATGCTAACTCT	CAAGGGGCCCGTGTGCTA
Edn3	AGGCCACAACTGATGCTTCT	CAGGGAGAGCAGGTGAAGTC
Tlr2	CAGCTGGAGAACTCTGACCC	CAAAGAGCCTGAAGTGGGAG
Tlr4	TGAGATTGCTCAAACATGGC	CGAGGCTTTTCCATCCAATA
Gpr43	AGGTTTGCTACTGATCCGC	GTACCCCTTCTGCTTGACTTC
Gpr41	ACGGCGGTGAGCATCGAACG	TTCCACCCCCTCCTGCGGTC
Gpr109a	GGCGTGGTGCAGTGAGCAGT	GGCCCACGGACAGGCTAGGT
Ednrb	GGGCTGCAGGTTTCGACC	CTGCAAACGCTAATATCGCC
Tgr5	GAGCGTCGCCCACCACTAGG	CGCTGATCACCCAGCCCCATG
Gpr109a	GGCGTGGTGCAGTGAGCAGT	GGCCCACGGACAGGCTAGGT
Nr3c1	TGGAGAGGACAACCTGACTTCC	ACGGAGGAGAACTCACATCTGG
Nr3c2	ATGGAAACCACACGGTGACCT	AGCCTCATCTCCACACACCAAG
Tnfa	ACCCTCACACTCAGATCATCTTC	TGGTGGTTTGCTACGACGT
Occludin	CTTATCTTGGGAGCCTGGACAT	GATTGGGTTTGAATTCATCAGGT
Tgfb2	CCAGGGGGAAGGAGGTCATA	CTTCGGCAGACACGTGTTTG
Csf1	AGTATTGCCAAGGAGGTGTCAG	ATCTGGCATGAAGTCTCCATTT

Transcriptome sequencing.

The dams in the CON and ABX groups were sacrificed at E18.5 due to cervical dislocation, and colons were dissected from their embryos. Total RNA was extracted using the Tiangen RNA Extraction Kit. Subsequently, cDNA amplification was performed using a cDNA synthesis kit, followed by mRNA library construction. After the initial library construction, the concentration of the library was detected using a Qubit 4.0 fluorescence quantifier, and the fragment size was assessed using a Qsep400 high-throughput biofragment analyzer. Finally, the library's effective concentration was accurately quantified using Q-PCR. Sequencing was performed by Metware Biotechnology Co., Ltd. (Wuhan, China) using the NovaSeq 6000 platform (Illumina, CA, USA), generating 150-bp paired-end reads. Fastp v0.23.2 and HiSAT2 v2.2.1 were used for quality filtering and sequence alignment, respectively. Differential expression analysis was conducted using DESeq2 v1.38.3. Differential expression genes were subjected to GO enrichment analysis using DAVID v2023q4. KEGG pathway enrichment analysis and GSEA for KEGG and GO were performed using clusterProfiler v4.6.0.

Luminex liquid suspension array chip.

The MILLIPLEX Mouse High Sensitivity T Cell Magnetic Bead Panel kit (Millipore, MA, USA) was used according to the manufacturer's instructions. In brief, the protein supernatant extracted from adult offspring's colon tissue was incubated overnight in a 96-well plate embedded with microbeads. Subsequently, the plate was incubated with detection antibodies for 1 hour. Streptavidin Phycoerythrin was then added to each well for 30 minutes, and the values were read using a calibrated Luminex 200 system (Luminex Corporation, Austin, TX, USA).

Metagenomic sequencing

Total microbial DNA from preconception dams was extracted using the QIAamp PowerFecal Pro DNA Kit (Qiagen, NRW, Germany), and the DNA concentration was measured. The NEBNext® Ultra™ DNA Library Preparation Kit (NEB, MA, USA) was used to generate sequencing libraries. DNA samples were sonicated to 350 bp, followed by end-polishing, A-tailing, and ligation. Subsequently, sequencing was performed by Novogene (Novogene, Tianjin, China) on the Novaseq 6000 platform.

The quality of the filtered read pairs was assessed using FastQC (V.0.11.8). Bowtie2 (V.2.5.1)⁵¹ was used to remove host DNA. The remaining high-quality reads were used for further analysis. All samples were subjected to species-level analysis using MetaPhlAn4 (V.4.0.6)⁵², with the mpa (V.Oct22.CHOCOPhlAnSGB.202212) marker gene database. Functional analysis was performed using HUMAnN3 (V.3.7)⁵² with UniRef90 mode. Detected genes were further grouped into gene families and pathways, and then sum-normalized within HUMAnN3.

Alpha diversity was estimated using the Shannon and Simpson indices. Beta diversity was analyzed using the Bray-Curtis distance algorithm and visualized through Principal Coordinate Analysis (PCoA). These analyses were conducted using corresponding computation and plotting scripts within the Parallel-Meta Suite⁵³. Linear discriminant analysis Effect Size (LEfSe)⁵⁴.analysis was applied on the relative abundance of species and pathways to identify group-associated biomarkers. Features with linear discriminant analysis (LDA) score > 2.0 and p-value < 0.05 were considered as statistically significant. The Spearman analysis was used to calculate the correlation between species.

M650 targeted metabolome.

M650 targeted metabolome analysis was conducted following the standardized workflow of APExBIO (APExBIO, TX, USA). In brief, serum samples (50 µl) or cecal contents (50 mg) were mixed with a pre-cooled solution of methanol/acetonitrile/water (2:2:1, v/v), vortexed, subjected to 30 minutes of low-temperature ultrasonication, and then kept at -20°C for 10 minutes. After centrifugation at 14,000 g and 4°C for 15 minutes, the supernatant was collected for further analysis. Following the preparation of external and internal standards for 650 common metabolites, separation was performed using an Agilent 1290 Infinity LC Ultra-High-Performance Liquid Chromatography system (UHPLC) (Agilent, CA, USA) with HILIC (2.1 mm × 100 mm × 1.7 µm) and C18 (2.1 mm × 100 mm × 1.7 µm) columns. Mass spectrometry analysis was conducted using an AB 6500 QTRAP mass spectrometer (AB SCIEX, MA, USA). The MRM raw data were processed using MultiQuant software (AB SCIEX, MA, USA) for peak extraction, obtaining peak areas and the ratio of internal standard peak areas. Quantification was performed based on standard curves. OPLS-DA analysis and enrichment of KEGG pathways were conducted using MetaboAnalyst v6.0 analysis software.

Measurement of SCFAs.

Four SCFAs (acetate, propionate, butyrate, and valerate) were prepared as standard solutions in water, 15% phosphoric acid, l-ethyl ether, and internal standards to create 10 concentration gradients. Serum samples (50 µl) or cecal contents (50 mg) were mixed with 15% phosphoric acid and a combination of internal standards and ethyl ether. The mixture was centrifuged at 12,000 rpm and 4°C for 10 minutes to obtain the supernatant. Separation was performed using a Thermo Trace 1300 gas chromatography system (Thermo Fisher Scientific, USA) with an Agilent HP-INNOWAX capillary column (30 mm × 0.25 mm × 0.25 µm). Mass spectrometry analysis was conducted using a Thermo ISQ 7000 mass spectrometer (Thermo Fisher Scientific, USA). The Proteowizard v.3.0.8789 software was used to calculate the content of SCFAs in the samples.

Statistical analysis.

The data are presented as mean ± SEM. The Shapiro-Wilk and Kolmogorov-Smirnov tests were used to assess the normal distribution of the data. Unpaired two-tailed Student's t-test or non-parametric tests (Mann-Whitney) were applied for analysis between two groups. For data involving more than two groups, one-way analysis of variance (ANOVA) followed by Tukey's multiple comparison test was performed. Two-way ANOVA was used for analysis involving two variables, followed by Tukey's or Sidak's multiple comparison test. Correlation analysis was conducted using the Spearman test. The specific statistical tests employed for each panel in the figures are described in the figure legends. The value of 'n' varied in the experiments and is specified in each figure legend. Bar graphs represent individual biological replicates as single points. A p-value of < 0.05 was considered statistically significant. Statistical analysis was performed using GraphPad Prism 8 software (GraphPad Software, CA, USA).

Morel C, Martinez Sanchez I, Cherifi Y, Chartrel N, Diaz Heijtz R (2023) Perturbation of maternal gut microbiota in mice during a critical perinatal window influences early neurobehavioral outcomes in offspring. Neuropharmacology 229:109479. 10.1016/j.neuropharm.2023.109479
Zhang X et al (2021) An Antibiotic-Impacted Microbiota Compromises the Development of Colonic Regulatory T Cells and Predisposes to Dysregulated Immune Responses. mBio 12, 10.1128/mBio.03335-20
Dai X et al (2020) Maternal sucralose intake alters gut microbiota of offspring and exacerbates hepatic steatosis in adulthood. Gut Microbes 11:1043–1063. 10.1080/19490976.2020.1738187
Aizawa S, Uebanso T, Shimohata T, Mawatari K, Takahashi A (2023) Effects of the loss of maternal gut microbiota before pregnancy on gut microbiota, food allergy susceptibility, and epigenetic modification on subsequent generations. Biosci Microbiota Food Health 42:203–212. 10.12938/bmfh.2022-093
Raymond F, Déraspe M, Boissinot M, Bergeron MG, Corbeil J (2016) Partial recovery of microbiomes after antibiotic treatment. Gut Microbes 7:428–434. 10.1080/19490976.2016.1216747
Furness JB, Callaghan BP, Rivera LR, Cho HJ (2014) The enteric nervous system and gastrointestinal innervation: integrated local and central control. Adv Exp Med Biol 817:39–71. 10.1007/978-1-4939-0897-4_3
Spencer NJ, Hu H (2020) Enteric nervous system: sensory transduction, neural circuits and gastrointestinal motility. Nat Rev Gastroenterol Hepatol 17:338–351. 10.1038/s41575-020-0271-2
Liu J et al (2023) GABAergic signaling between enteric neurons and intestinal smooth muscle promotes innate immunity and gut defense in Caenorhabditis elegans. Immunity 56:1515–1532e1519. 10.1016/j.immuni.2023.06.004
Schill EM, Floyd AN, Newberry RD (2022) Neonatal development of intestinal neuroimmune interactions. Trends Neurosci 45:928–941. 10.1016/j.tins.2022.10.002
Jarret A et al (2020) Enteric Nervous System-Derived IL-18 Orchestrates Mucosal Barrier Immunity. Cell 180:813–814. 10.1016/j.cell.2020.02.004
Schneider KM et al (2023) The enteric nervous system relays psychological stress to intestinal inflammation. Cell 186:2823–2838e2820. 10.1016/j.cell.2023.05.001
Ahn EH et al (2020) Initiation of Parkinson's disease from gut to brain by δ-secretase. Cell Res 30:70–87. 10.1038/s41422-019-0241-9
Mueller JL, Goldstein AM (2022) The science of Hirschsprung disease: What we know and where we are headed. Semin Pediatr Surg 31:151157. 10.1016/j.sempedsurg.2022.151157
Fried S, Wemelle E, Cani PD, Knauf C (2021) Interactions between the microbiota and enteric nervous system during gut-brain disorders. Neuropharmacology 197:108721. 10.1016/j.neuropharm.2021.108721
Meroni E, Stakenborg N, Viola MF, Boeckxstaens GE (2019) Intestinal macrophages and their interaction with the enteric nervous system in health and inflammatory bowel disease. Acta Physiol (Oxf) 225:e13163. 10.1111/apha.13163
Holland AM, Bon-Frauches AC, Keszthelyi D, Melotte V, Boesmans W (2021) The enteric nervous system in gastrointestinal disease etiology. Cell Mol Life Sci 78:4713–4733. 10.1007/s00018-021-03812-y
Kang YN, Fung C (2021) Vanden Berghe, P. Gut innervation and enteric nervous system development: a spatial, temporal and molecular tour de force. Development 148. 10.1242/dev.182543
Rao M, Gershon MD (2018) Enteric nervous system development: what could possibly go wrong? Nat Rev Neurosci 19:552–565. 10.1038/s41583-018-0041-0
Foong JP (2016) Postnatal Development of the Mouse Enteric Nervous System. Adv Exp Med Biol 891:135–143. 10.1007/978-3-319-27592-5_13
Heymans C et al (2020) Corrigendum: Chronic Intra-Uterine Ureaplasma parvum Infection Induces Injury of the Enteric Nervous System in Ovine Fetuses. Front Immunol 11:672. 10.3389/fimmu.2020.00672
Norlin AK et al (2021) Fatigue in irritable bowel syndrome is associated with plasma levels of TNF-α and mesocorticolimbic connectivity. Brain Behav Immun 92:211–222. 10.1016/j.bbi.2020.11.035
Bennet SM et al (2016) Global Cytokine Profiles and Association With Clinical Characteristics in Patients With Irritable Bowel Syndrome. Am J Gastroenterol 111:1165–1176. 10.1038/ajg.2016.223
Liu Y, Yu G, Zhang R, Feng L, Zhang J (2023) Early life exposure to low-dose perfluorooctane sulfonate disturbs gut barrier homeostasis and increases the risk of intestinal inflammation in offspring. Environ Pollut 329:121708. 10.1016/j.envpol.2023.121708
Uribe RA, Hong SS, Bronner ME (2018) Retinoic acid temporally orchestrates colonization of the gut by vagal neural crest cells. Dev Biol 433:17–32. 10.1016/j.ydbio.2017.10.021
Aubert P et al (2019) Maternal protein restriction induces gastrointestinal dysfunction and enteric nervous system remodeling in rat offspring. Faseb j 33:770–781. 10.1096/fj.201800079R
Fan M et al (2023) BMSCs Promote Differentiation of Enteric Neural Precursor Cells to Maintain Neuronal Homeostasis in Mice With Enteric Nerve Injury. Cell Mol Gastroenterol Hepatol 15:511–531. 10.1016/j.jcmgh.2022.10.018
Hasler WL, Grabauskas G, Singh P, Owyang C (2022) Mast cell mediation of visceral sensation and permeability in irritable bowel syndrome. Neurogastroenterol Motil 34:e14339. 10.1111/nmo.14339
Nozu T, Miyagishi S, Ishioh M, Takakusaki K, Okumura T (2022) Peripheral apelin mediates visceral hypersensitivity and impaired gut barrier in a rat irritable bowel syndrome model. Neuropeptides 94:102248. 10.1016/j.npep.2022.102248
Collins JM et al (2022) Supplementation with milk fat globule membrane from early life reduces maternal separation-induced visceral pain independent of enteric nervous system or intestinal permeability changes in the rat. Neuropharmacology 210:109026. 10.1016/j.neuropharm.2022.109026
McClain JL et al (2023) Sexually Dimorphic Effects of Histamine Degradation by Enteric Glial Histamine N-Methyltransferase (HNMT) on Visceral Hypersensitivity. Biomolecules 13. 10.3390/biom13111651
Kaur P et al (2022) Wnt Signaling Rescues Amyloid Beta-Induced Gut Stem Cell Loss. Cells 11, 10.3390/cells11020281
AlOlaby RR et al (2022) Differential Methylation Profile in Fragile X Syndrome-Prone Offspring Mice after in Utero Exposure to Lactobacillus Reuteri. Genes (Basel) 13. 10.3390/genes13081300
Bender MJ et al (2023) Dietary tryptophan metabolite released by intratumoral Lactobacillus reuteri facilitates immune checkpoint inhibitor treatment. Cell 186:1846–1862e1826. 10.1016/j.cell.2023.03.011
Lee H et al (2022) Limosilactobacillus reuteri DS0384 promotes intestinal epithelial maturation via the postbiotic effect in human intestinal organoids and infant mice. Gut Microbes 14:2121580. 10.1080/19490976.2022.2121580
Lu J et al (2023) Limosilactobacillus reuteri normalizes blood-brain barrier dysfunction and neurodevelopment deficits associated with prenatal exposure to lipopolysaccharide. Gut Microbes 15:2178800. 10.1080/19490976.2023.2178800
Sun N et al (2020) Probiotic Lactobacillus johnsonii BS15 Prevents Memory Dysfunction Induced by Chronic High-Fluorine Intake through Modulating Intestinal Environment and Improving Gut Development. Probiotics Antimicrob Proteins 12:1420–1438. 10.1007/s12602-020-09644-9
Lee YM et al (2021) Microbiota control of maternal behavior regulates early postnatal growth of offspring. Sci Adv 7. 10.1126/sciadv.abe6563
Fåk F, Karlsson CL, Ahrné S, Molin G, Weström B (2012) Effects of a high-fat diet during pregnancy and lactation are modulated by E. coli in rat offspring. Int J Obes (Lond) 36:744–751. 10.1038/ijo.2011.118
Jang HM et al (2022) Enterococcus faecium and Pediococcus acidilactici deteriorate Enterobacteriaceae-induced depression and colitis in mice. Sci Rep 12:9389. 10.1038/s41598-022-13629-9
Tian D et al (2023) Fecal microbiota transplantation enhances cell therapy in a rat model of hypoganglionosis by SCFA-induced MEK1/2 signaling pathway. Embo j 42:e111139. 10.15252/embj.2022111139
Yang LL et al (2020) Enteric short-chain fatty acids promote proliferation of human neural progenitor cells. J Neurochem 154:635–646. 10.1111/jnc.14928
Kimura I et al (2020) Maternal gut microbiota in pregnancy influences offspring metabolic phenotype in mice. Science 367. 10.1126/science.aaw8429
Calvigioni M et al (2023) HPLC-MS-MS quantification of short-chain fatty acids actively secreted by probiotic strains. Front Microbiol 14:1124144. 10.3389/fmicb.2023.1124144
Liu Y et al (2022) Limosilactobacillus reuteri and caffeoylquinic acid synergistically promote adipose browning and ameliorate obesity-associated disorders. Microbiome 10:226. 10.1186/s40168-022-01430-9
Mikkelsen EM et al (2023) Preconception use of antibiotics and fecundability: a Danish prospective cohort study. Fertil Steril 120:650–659. 10.1016/j.fertnstert.2023.04.030
Nohesara S, Abdolmaleky HM, Zhou JR, Thiagalingam S (2023) Microbiota-Induced Epigenetic Alterations in Depressive Disorders Are Targets for Nutritional and Probiotic Therapies. Genes (Basel) 14. 10.3390/genes14122217
Zhang J et al (2019) Beneficial effect of butyrate-producing Lachnospiraceae on stress-induced visceral hypersensitivity in rats. J Gastroenterol Hepatol 34:1368–1376. 10.1111/jgh.14536
Yarandi SS et al (2020) Intestinal Bacteria Maintain Adult Enteric Nervous System and Nitrergic Neurons via Toll-like Receptor 2-induced Neurogenesis in Mice. Gastroenterology 159:200–213e208. 10.1053/j.gastro.2020.03.050
Larauche M et al (2009) Cortagine, a CRF1 agonist, induces stresslike alterations of colonic function and visceral hypersensitivity in rodents primarily through peripheral pathways. Am J Physiol Gastrointest Liver Physiol 297:G215–227. 10.1152/ajpgi.00072.2009
Liu G et al (2023) Amyloid-β mediates intestinal dysfunction and enteric neurons loss in Alzheimer's disease transgenic mouse. Cell Mol Life Sci 80:351. 10.1007/s00018-023-04948-9
Langmead B, Salzberg SL (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods 9:357–359. 10.1038/nmeth.1923
Blanco-Míguez A et al (2023) Extending and improving metagenomic taxonomic profiling with uncharacterized species using MetaPhlAn 4. Nat Biotechnol 41:1633–1644. 10.1038/s41587-023-01688-w
Chen Y et al (2022) Parallel-Meta Suite: Interactive and rapid microbiome data analysis on multiple platforms. iMeta 1, 10.1002/imt2.1
Segata N et al (2011) Metagenomic biomarker discovery and explanation. Genome Biol 12:R60. 10.1186/gb-2011-12-6-r60

There is NO Competing Interest.

SupplementaryInformation.docx
Supplementary Information

Download PDF

Version 1

posted

You are reading this latest preprint version

Preconception maternal gut dysbiosis affects enteric nervous system development and disease susceptibility in offspring

Status:

Version 1

Abstract

Figures

Main

Results

1. Maternal preconception antibiotics exposure leads to ENS dysplasia in juvenile offspring

2. Offspring of dams treated with antibiotic exhibit enduring ENS dysplasia and increased disease susceptibility

4. Preconception antibiotics exposure profoundly influences the maternal gut microbiome and metabolome

Discussion

Methods

Animals

WAS

Colonic transit time

Visceral sensitivity test

Image acquisition and analysis

Quantitative real-time PCR

Metagenomic sequencing

Statistical analysis.

References

Additional Declarations

Supplementary Files

Status:

Version 1