NEGR1 can influence symptom severity in fluoxetine treated major depression disorder patients

doi:10.21203/rs.3.rs-4421084/v1

Download PDF

Article

NEGR1 can influence symptom severity in fluoxetine treated major depression disorder patients

https://doi.org/10.21203/rs.3.rs-4421084/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

NEGR1 (neuronal growth regulator 1) is a cell adhesion molecule of the immunoglobulin (Ig) superfamily related to IgLON subgroup. NEGR1 promotes cell-cell adhesion and stimulates neurite growth of hypothalamic neurons and inhibits synapse formation. NEGR1 is one of the genomic regions significantly associated with major depression disorder (MDD). The functional role of NEGR1 on MDD is still unknown. Fluoxetine, a selective serotonin reuptake inhibitor, is used in the treatment of MDD. Thus, we aimed to investigate the effects of fluoxetine on NEGR1 expression in MDD and to examine correlations between NEGR1 levels and symptom severity. In this study, mRNA expression of NEGR1 in fluoxetine-treated and non-treated cultured peripheral blood mononuclear cells (PBMC) were detected by qPCR in 40 patients with MDD and 40 age‑matched healthy controls. The protein levels of NEGR1 in cultured PBMCs were detected by ELISA method. Hamilton Rating-Scale for Depression (HRSD) and Beck Depression Inventory (BDI) were used to evaluate depressive symptom severity. PBMC of MDD patients exhibited elevated NEGR1 protein levels when compared with healthy controls in both fluoxetine treated and non-treated groups (p = 0.01). Besides, a positive correlation was found between NEGR1 protein levels and Beck scores in fluoxetine treated MDD group (r = 0.33, p = 0.036). However, no significant relationship was observed in NEGR1 mRNA levels between MDD patients and controls in both fluoxetine treated and non-treated group (p > 0.05). Fluoxetine had no effect on the protein levels of NEGR1 directly. On the other hand, NEGR1 protein levels may affect symptom severity in MDD patients treated with fluoxetine.

Health sciences/Diseases/Psychiatric disorders/Depression

Biological sciences/Neuroscience/Molecular neuroscience

Major depression disorder

NEGR1

fluoxetine

Beck depression inventory

Major depressive disorder (MDD) is a psychiatric disorder characterized by sadness, loss of interest or pleasure, feelings of guilt, low self-esteem, sleep disorders or appetite feeling, fatigue and poor concentration [1]. The prevalence of depression is constantly increasing every year. According to WHO, MDD ranked as third concerning disease burden in 2018, and is predicted to rank first by 2030 [2]. The prevalence of depression was reported as 4.4% in Turkey [3]. A particular correlation has been indicated between MDD occurrence and social development [4]. Another study indicated that MDD arises at a younger age because of increased life pressure and economical challenges. Also, the incidence of MDD is twice as high in women than in men [5]. The molecular pathology of MDD is quite complex and pharmacological therapeutic strategies are relatively limited. Genetic, psychological, and social factors can be related with the incidence rate and molecular pathogenesis of MDD.

Several studies have identified certain genetic loci, including neuronal growth regulator 1 (NEGR1), significantly associated with MDD [6–8], formerly reported to have associations with obesity and body mass index [9–14]. The synaptic adhesion molecule NEGR1 (IgLON4), a member of IgLON (Immunoglobulin LSAMP, OBCAM, Neurotrimin) family has three Ig domains and is anchored to the membrane by a glycosylphosphatidylinositol (GPI) moiety [15]. NEGR1, found on the surface of neurons and oligodendrocytes, regulates neurite outgrowth, and participate in synapse formation [16]. NEGR1 is highly expressed in the cerebral cortex, hippocampus, and cerebellum during postnatal development in rats [17, 18]. 1p31.1 to 1p31.3 deletion on NEGR1 leads to hyperactivity disorder, learning disability, speech, and language development [19], dyslexia [20]. A case study was also reported on two siblings with interstitial microdeletion of 1p31.1 involving NEGR1 presented learning and behavioural problems, hypotonia, hypermobility, scoliosis, and aortic root dilation [21]. NEGR1 was also associated with white matter integrity [22], Niemann–Pick disease type C2 (NPC2) [23], and eating disorder [24].

MDD therapy mainly involves pharmacological treatment with antidepressants belonging to various classes commonly addressing the monoaminergic circuits [25]. Formerly used tricyclic antidepressants mainly target noradrenaline and serotonin transporters. One of the newer generation antidepressants, selective serotonin reuptake inhibitors (SSRI), specifically address serotonergic reuptake. Fluoxetine is one of the SSRIs commonly used in MDD treatment. On the other side, recent genome-wide association studies (GWAS) have identified NEGR1 as a genetic locus for the susceptibility of MDD(6–8) and its expression has been reported in brain tissue [26]. Moreover, a recent study, investigated whether antidepressants affect the expression of Negr1-Fgfr2 pathway genes in rodents and reported NEGR1 expression was down-regulated by fluoxetine in the hippocampal dentate gyrus of corticosterone-treated mice [27]. Therefore, it may be critical to understand the effects of pharmacological agents commonly used in the treatment of MDD on genes associated with its pathogenesis.

Little is known about the effects of pharmacological agents used in the treatment of MDD on the genes that contribute to the pathogenesis of the disease. The SSRI, fluoxetine, can modulate NEGR1 expression in MDD patients. Therefore, we aimed to assess expression levels of NEGR1 with its effects on symptom severity in MDD patients and the modulation of NEGR1 expression on fluoxetine treated peripheral blood mononuclear cells.

Study Design

Eighty-six participants (age range 19–60 years) comprising 42 MDD patients and 44 healthy controls were included in this case-control study. Blood samples were collected from patients admitted to the Psychiatry Department, Cerrahpaşa Faculty of Medicine, Istanbul, Türkiye. Two blood samples from the MDD group and four blood samples from the healthy controls were excluded from the study because they were of low quality to continue the experiments.

Diagnostic assessments using The Structured Clinical Interview for DSM-5 (SCID-5) [1] were performed by two clinicians. Depression severity was evaluated by using Beck Depression Inventory (BDI) [28] and the 21-item Hamilton Rating Scale for Depression (HAMD) [29]. This study was conducted by the principles of the Declaration of Helsinki and was approved by the Local Ethics Committee of the Cerrahpaşa Faculty of Medicine, Istanbul University-Cerrahpaşa (issue #16789). Written informed consent was obtained from the participants before involvement in the study.

The patient group was selected from those who were diagnosed with MDD for the first time and had never received SSRI treatment before. Information about smoking status, family history for mental disorders and neurological disorders, alcohol consumption, drug use and any pharmacological treatment status was acquired from the participants through personal communication by the physicians. Patients having past or current diagnosis of any psychiatric disorder, pharmacological treatment other than oral contraception, a positive family history of neurologic diseases or mental disorders, cancer or organ failure, any ongoing chemotherapy, radiotherapy and drug or alcohol addiction were excluded from the study. Patients taking medication before and during sample collection were excluded.

Control group was selected from age and sex matched healthy volunteers admitted to Cerrahpaşa Faculty of Medicine Hospital for common health screenings. The exclusion criteria for the control group were having any psychiatric and neurological diagnosis or psychopharmacological therapy,

Beck depression inventory (BDI)

Beck depression inventory, mostly used psychometric tests for measuring depression severity, is a self-report statement used for quantifying depression levels. It includes mood, pessimism, feelings of failure, self-dissatisfaction, suicidal plan, irritability, insomnia, guilt, crying, weight loss, self-accusation symptoms of patients. It has two parts; the first part includes psychological symptoms, and the second section evaluates physical symptoms. BDI, a 21-item self-report inventory, was revised in 1996 and formatted as BDI-II. The BDI-II also has 21 questions, scored as 0–3. It is also associated with Hamilton Depression Rating Scale [30].

Hamilton rating scale for depression (HRSD)

The Hamilton Rating Scale for Depression (HRSD) exhibits clinician rated measures of depression severity. The rating is performed to specify adult depression degree by examining mood, emotion of guilt, suicide plan, insomnia, agitation, retardation, anxiety, weight loss, and somatic symptoms. Hamilton’s original scale had 17 items, was scored on a 3- or 5-point scale, depending on the item, and the total score is analyzed to the corresponding descriptor. A score of 0–7 is ordinary. Scores of ≥ 20 indicate moderate, severe, or very severe depression, and generally require clinical treatment [29].

Blood sampling, peripheral blood mononuclear cell (PBMC) culture and RNA extraction

Venous blood samples of MDD patients (10 males, 30 females) and healthy controls (13 males, 27 females) were collected into heparin tubes and immediately used for lymphocyte separation. PBMCs were obtained from 10 mL of sodium heparin-treated venous blood samples by Ficoll-Hypaque (Sigma-Aldrich) gradient centrifugation. The PBMCs were frozen at -80°C with DMSO (Biomatik). The cells were kept at -80°C and resuspended in LymphoPrime (Capricorn) supplemented with fetal bovine serum (FBS), streptomycin/penicillin and phytohemagglutinin (PHA). PBMCs were cultured for 72 hours at 37°C. Each PBMC cell culture included 1 mM fluoxetine or distilled water. Cell viability testing of PBMC cell cultures was checked with Trypan blue exclusion method.

Cell suspensions, T-lymphocyte-rich lymphoid cells, were used for gene expression and ELISA. Patient and control samples were divided into two sub-groups. The study groups were as follows: MDD group (treated with dH₂O), MDD + fluoxetine treated group, healthy control group (treated with dH₂O), and healthy control + fluoxetine treated group. Total RNA was extracted from the four group PBMCs by using the PureLink RNA Mini Kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s instructions.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

NEGR1 expression levels were assessed using RT-qPCR with total RNA collected and cultured from lymphocyte samples obtained from both patients and controls. The concentration and quality of the RNA samples were measured using spectrophotometric analysis. Total RNA (100 ng) was reverse‑transcribed into complementary cDNA with random hexamers as primers using the Transcriptor High Fidelity cDNA Synthesis kit (Roche Diagnostics), according to the manufacturer's protocol. LightCycler® 1.5 detection system (Roche Applied Science, Pleasanton, CA, USA) with TaqMan probe technology (TIB Molbiol GmbH, Berlin, Germany) was used to determine NEGR1 expression. NEGR1 mRNA levels were normalized to endogenous reference gene ACTB utilizing the 2^−ΔΔCt method [31]. Primers were designed as follows: ACTB, forward 5'‑AGAGCTACGAGCTGCCTGAC‑3' and reverse 5'‑CGTGGATGCCACAGGACT‑3', NEGR1, forward: 5'- GGCCCTCGGACAGAGTGAAATCA-3' and reverse: 5'-GTACAGTCAGGACTGATAAAATGGG − 3' [32].

Determination of NEGR1 protein levels by ELISA

NEGR1 protein levels were determined by ELISA following the manufacturer’s instructions (Elabscience® Human NEGR1, Houston, Texas, USA). The levels of NEGR1 were determined by benchmark with the standard curve generated from the standards supplied by the manufacturer. The levels of NEGR1 were presented as pg/ml. Optical density (O.D.) measurements were analyzed with a microplate reader ELx800 (BioTek® Instruments, Winooski, Vermont, USA) at 450 nm. Total protein was measured by Lowry-Hertrea modified method [33].

Statistical Analysis

Quantitative values were expressed as mean and range values and categorical values were expressed as number of observations (n) and percentage (%). Categorical variables in the MDD and control groups were compared using chi-square (χ2) or Fisher's exact test. Continuous variables were compared using Student's t test or Mann-Whitney U test and data are expressed as the mean ± standard deviation (SD). Relative mRNA levels were evaluated using the 2^−ΔΔCt method and results were analyzed by Student’s t-test. Relative gene expression levels and biochemical parameters were also compared using Pearson’s correlation test. Significance was evaluated at p ≤ 0.05 level. All evaluations were performed using SPSS 21.0 program (IBM Corp, Armonk, NY, USA).

Demographic data

The demographic and clinical characteristics of MDD patients and healthy controls were presented in Table 1. There were no statistically significant differences between the groups regarding gender (p = 0.45) or age (p = 0.52). No statistically significant differences were observed between the groups in biochemical parameters including TSH, total cholesterol, HDL- and LDL-cholesterol, triglycerides, and the anthropometric measurement body mass index (p > 0.05). MDD and controls demonstrated significant differences in exercise (p < 0.01), psychiatric comorbidity (p = 0.01), marital status (p < 0.01) and family history in psychiatric disease (p < 0.001) (Table 1). MDD patients were also examined in terms of BDI and HRSD scores with respect to gender. No significant difference was observed in depression symptom severity among male and female patients (p > 0.05) (Table 2).

Table 1

Demographic and clinical characteristics of MDD patients and controls
Parameter	MDD (n = 40)	Controls (n = 40)	p
Age (y, mean ± SD)	34.45 ± 11.45	32.75 ± 12.46	0.52
Age of onset (mean ± SD)	31.38 ± 11.12	-
Gender (M/F, %)	10/30 (25.0/75.0)	13/27 (32.5/67.5)	0.45
Marital status Single/Married (n, %)	16 (40.0)/24 (60.0)	28 (70.0)/12 (30.0)	< 0.01
Family history of psychiatric disease (+/-, %)	0 (0.0)/40 (100.0)	6 (15.0)/34 (85.0)	< 0.001
Psychiatric comorbidity (+/-, %)	6/34 (15.0/85.0)	0/40 (0.0/100.0)	0.01
TSH (mIU/mL)	2.51 ± 2.74 (n = 18)	2.16 ± 1.20 (n = 18)	0.62
Total Cholesterol (mg/dL)	183.63 ± 25.69 (n = 8)	206.5 ± 55.38 (n = 20)	0.27
HDL Cholesterol (mg/dl)	46.43 ± 10.06 (n = 7)	56.00 ± 16.26 (n = 20)	0.15
LDL Cholesterol (mg/dl)	118.71 ± 19.23 (n = 7)	135.80 ± 45.14 (n = 20)	0.34
Triglycerides (mg/dl)	117.63 ± 65.19 (n = 8)	147.05 ± 119.18 (n = 19)	0.51
BMI (kg/m²)	25.73 ± 5.06	24.62 ± 4.35	0.29
Smoking status (n, %) Nonsmoker 1–25 cigarettes per day 25–50 cigarettes per day	22 (55.0) 13 (32.5) 5 (12.5)	28 (70.0) 11 (27.5) 1 (2.5)	0.16
Alcohol consumption (n, %) None ( 1–2 drinks per month 2–3 drinks per month	35 (87.5) 3 (7.5) 2 (5.0)	28 (70.0) 4 (10.0) 8 (20.0)	0.10
Exercise (walking) (n, %) None 1 day a week 2 days a week 3 days a week 5 days a week	34 (85.0) 3 (7.5) 2 (5.0) 1 (2.5) 0 (0.0)	10 (25.0) 26 (65.0) 1 (2.5) 2 (5.0) 1 (2.5)	< 0.01
Sleeping status (n, %) 1–4 hours a day 4–7 hours a day 7–10 hours a day 10–12 hours a day	8 (20.0) 18 (45.0) 10 (25.0) 4 (10.0)	2 (5.0) 24 (60.0) 13 (32.5) 1 (2.5)	0.08
BMI: body mass index

Table 2

Characteristics of MDD patients with respect to gender
Parametre	Male (n = 10)	Female (n = 30)	p
Age (y, mean ± SD)	34.20 ± 12.70	34.53 ± 11.24	0.88
Age of onset (y, mean ± SD)	29.20 ± 11.12	32.10 ± 11.21	0.55
BDI Scores (mean ± SD)	35.10 ± 10.35	38.37 ± 8.43	0.33
HRSD Scores (mean ± SD)	27.90 ± 6.08	30.13 ± 8.41	0.14
BDI: Beck depression inventory; HRSD: Hamilton Rating Scale for Depression

NEGR1 mRNA and protein levels and the effects of fluoxetine on NEGR1 expression

Relative mRNA expression of NEGR1 exhibited higher levels in MDD patients compared to healthy controls however this difference was not statistically significant (p = 0.11). Besides this, MDD patients exhibited significantly higher NEGR1 protein levels when compared with healthy controls (p = 0.01). Fluoxetine-treated cells of MDD group also presented elevated NEGR1 protein levels when compared with healthy control cells treated with fluoxetine (p = 0.01) (Table 3). The mRNA and protein levels of fluoxetine treated MDD group demonstrated a statistically positive correlation with each other (Fig. 1). No statistically significant difference was observed in NEGR1 mRNA and protein expressions between fluoxetine non-treated and treated cells of MDD patients (p > 0.05, results not shown). When NEGR1 expression was analyzed in terms of gender in the patient group, no statistically significant difference was observed between NEGR1 gene and protein expression and gender in the MDD group (p = 0.76, p = 0.43 respectively).

Table 3

Relative expression of *NEGR1* mRNA and NEGR1 protein levels in MDD patients and healthy controls
Parameter	MDD – FLX (-)	Controls – FLX (-)	p
NEGR1 mRNA expression Range	1.68 ± 3.51 0.0112–14.6900 (n = 17)	0.27 ± 0.35 0.0193-1.2400 (n = 33)	0.11
NEGR1 protein expression (pg/ml) Range	107.26 ± 190.50 6.268-773.263 (n = 40)	30.29 ± 36.16 10.713-197.993 (n = 40)	0.01
	MDD – FLX (+)	Controls – FLX (+)	p
NEGR1 mRNA expression Range	1.41 ± 2.01 0.0088-7.0000 (n = 12)	0.36 ± 9.44 0.0092-1.8800 (n = 30)	0.10
NEGR1 protein expression (pg/ml) Range	102.25 ± 156.16 5.666-590.691 (n = 40)	37.99 ± 36.78 9.495-213.728 (n = 40)	0.01
FLX: Fluoxetine. Student's t test was performed. Data presented as mean ± SD. P values were confirmed with the nonparametric Wilcoxon test.

MDD symptom severity with respect to NEGR1 expression

Furthermore, positive correlation was found between NEGR1 protein levels and the psychiatric scale Beck scores in fluoxetine treated cells of MDD group (r = 0.33, p = 0.036) (Fig. 2). However, no significant difference was observed between NEGR1 levels and HRSD scores in the MDD group (r = 0.27, p = 0.086).

Comparison of NEGR1 expression with anthropometric and biochemical parameters

A correlation analysis revealed a significant positive relationship between NEGR1 protein expression and TSH levels in the MDD fluoxetine non-treated group (r = 0.62, p = 0.06). Meanwhile, there was no significant association between NEGR1 protein expression and total cholesterol levels (r = -0.30, p = 0.46) and also LDL-cholesterol levels (r = -0.26, p = 0.57). Moreover, a significant positive correlation between NEGR1 mRNA expression and BMI was observed in fluoxetine treated cells of control group (r = 0.49, p = 0.004).

Major depressive disorder (MDD) is a common disorder worldwide. The prevalence of MDD varies between 2–5% [34]. With the understanding that MDD shows a multifactorial inheritance pattern, it is thought that multiple genes with small effects are involved in the development of MDD and that the combination of genetic factors and environmental components cause MDD. With the better understanding of the pathophysiology of MDD and the increase in genome-related studies, genes involved in neurogenesis have come to the fore. It is thought that genes involved in neurogenesis may be candidates for MDD [7]. One of the genes involved in neurogenesis is NEGR1 [35]. In a study, 15 gene regions related to MDD were identified and one of these genes was NEGR1. NEGR1 rs11209948 and rs2422321 SNPs were shown as potential candidates for MDD development [36]. A meta-analysis of genome-wide association studies (GWAS) revealed 44 important genes associated with MDD. Among these genes, the NEGR1 rs1432639 variant was found to be a potential risk factor for MDD [7]. In our study, we investigated the relationship of NEGR1 between the MDD patients and healthy controls besides the relationship of these groups with fluoxetine.

In a study conducted with 101 patients with MDD and 106 healthy individuals, a significant relationship was found between MDD and TSH (Thyroid Stimulating Hormone) [37]. In another study, phenotype characteristics of NEGR1 gene deletion were determined by taking detailed anamnesis of 2 siblings with interstitial microdeletion in the p31.1 region of chromosome 1. As a result of partial deletion in NEGR1 gene, hypothyroidism was observed in one of the siblings [21]. Also, in our study, there was a significant correlation between NEGR1 protein expression and TSH levels in MDD patients demonstrating that endocrine parameters can be in close relationship with the molecular development of MDD. This finding was consistent with the studies of Gupta et al. and also Genovese et al. Recent studies also reported an association between low lipid levels and MDD [38, 39]. In our study MDD patients also demonstrated low total-cholesterol and LDL-cholesterol levels. However, due to our small sample size these relationships were not in statistically significance.

In a study conducted with brain tissue samples from 37 post-mortem schizophrenia patients and 37 controls without a history of psychiatric diagnosis, gene expression analysis was applied to the patient and control groups. At the same time, 6 of the schizophrenia patients were reported to have comorbidity with MDD. As a result of gene expression analysis, the relationship between the IgLON family and schizophrenia was examined and reported that NEGR1 gene expression levels increased in schizophrenia patients compared to the control group. When the expression levels of IgLON transcripts were compared with gender, it was found that gender difference had no effect on IgLON transcripts [40]. In our study, NEGR1 gene expression levels increased in MDD patients compared to the control group. However, our results did not reach the limit of statistical significance. Besides, when NEGR1 mRNA levels were compared with gender, no difference was observed between the two groups demonstrating an accordance with Karis et al. In addition, no correlation was found when NEGR1 protein levels were compared with gender.

In a study conducted with 54 male Wistar rats, NEGR1 mRNA levels were measured using AAV (Adeno-associated virus) technology to manipulate NEGR1 expression in vivo and it was observed that NEGR1 mRNA levels increased. As a result of augmented NEGR1 mRNA levels, decreased locomotor activity and body temperature were observed [41]. Besides that, in a study conducted by measuring the motor activity of 12 patients with MDD for 1 week, it was shown that there is a relationship between low motor activity and the pathophysiology of MDD [42]. In our study, when exercise activity in the MDD and control groups were compared, a relationship between low exercise activity and MDD was found. However, no significant relationship was found when NEGR1 levels were compared with the exercise activity performed per week by the patient and control groups.

In a study with control, bipolar, schizophrenia and MDD patients, CSF expression levels for fifty nine proteins were analyzed in cerebrospinal fluid (CSF) from patients. Sixteen proteins were identified that could be distinguished with 90% certainty between at least two study groups. When the control group and MDD group were compared, it was found that NEGR1 protein level was higher in the MDD group compared to the control group [43]. In our study, NEGR1 protein level was found to be higher in the MDD group compared to the control group. Our findings are in parallel with the findings of Maccarrone et al.

In a study, the risk of developing MDD were reported to be increased 2–3 times among first-degree relatives [8]. In our study, when the family history of the MDD and control groups was analyzed, a significant relationship was found between family history and MDD. The data obtained in our study are in parallel with the data of Hyde et al.

Integral membrane proteins play an important role in the establishment of functional neuronal circuits during development. The assembly of neuronal circuits requires cell surface molecules that first sense the extracellular environment and activate signalling cascades. Cell surface integral proteins are involved in the growth, guidance, and stabilization of neuronal structures (axons and dendrites) [35]. A study in mice has shown that the integral membrane protein NEGR1 contributes to axon growth in the entorhinal cortex [44]. As a result of the study in rat cortical neuron culture, it was observed that when NEGR1 expression is decreased, it causes a significant decrease in the number and length of mature cortical neurons. It has been reported that NEGR1 expression level is associated with neuronal maturation and controls the proper development of neurite arborization (budding) and dendritic spines [35]. In a study conducted with hippocampal neuron culture, NEGR1 was found to be present in the dendritic postsynaptic regions of mature neurons and overexpression of NEGR1 in mature neurons increased the number of dendritic synapses [45]. Moreover, a recent study, investigated whether antidepressants affect the expression of Negr1-Fgfr2 pathway genes in rodents and reported NEGR1 expression was down-regulated by fluoxetine in the hippocampal dentate gyrus of corticosterone-treated mice [27]. In our study, when the MDD and control groups were compared in terms of NEGR1 protein levels, it is considered that the high levels of NEGR1 protein in the MDD group may affect the pathophysiology of MDD. A significant relationship was found between MDD and control groups in terms of NEGR1 protein levels. There was a statistically significant correlation between NEGR1 mRNA expression and protein levels in the MDD group treated with fluoxetine which may reflect mRNA levels are a major contributor to protein abundance. There were no significant differences in NEGR1 protein levels between fluoxetine-treated MDD and non-treated MDD groups. Fluoxetine did not affect NEGR1 in the MDD group fluoxetine non-treated group so the drug did not contribute to NEGR1 expression. This may be due to both post-transcriptional and post-translational modifications of NEGR1. Transcription dynamics can affect protein trafficking in different conditions. On the other hand, a positive correlation was detected between NEGR1 protein levels and the psychiatric scale Beck scores in the MDD group treated with fluoxetine suggesting NEGR1 levels are actually associated with fluoxetine and may affect disease severity. Our study is the first investigating NEGR1 mRNA expression and protein levels in PBMCs obtained from MDD patients. We suggest that fluoxetine has an effect on NEGR1 protein levels directly and there was correlation between NEGR1 protein levels and Beck scores in fluoxetine-treated MDD group. Based on our findings, since NEGR1 protein was found to be enhanced in MDD patients compared to the controls, it may contribute to the molecular pathogenesis of MDD and be considered as a biomarker candidate for MDD. The small number of patient and control samples in our study group and the insufficient number of biochemical data belonging to the groups are among the limitations of our study. Another limitation is that our study group was predominantly composed of women. In the future, mRNA-protein interactions and artificial intelligence algorithms will be included in our study and more comprehensive studies will be useful in elucidating the molecular pathogenesis of MDD.

Conflicts of Interest

The authors report no conflicts of interest.

Acknowledgements

We sincerely thank the Department of Psychiatry, Istanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine Hospital for their help in the collection of blood samples. This study was funded by the Scientific Research Projects Coordination Unit of Istanbul University-Cerrahpasa. Project numbers: 24637 and 27858.

APA APA. Diagnostic and statistical manual of mental disorders. The American Psychiatric Association. 2013;
Malhi GS, Mann JJ. Depression. The Lancet. 2018;392(10161):2299–312.
Estimates GH. Depression and Other Common Mental Disorders Global Health Estimates. world health organization. 2017;
Albert KM, Newhouse PA. Estrogen, Stress, and Depression: Cognitive and Biological Interactions. Vol. 15, Annual Review of Clinical Psychology. 2019.
Kessler RC, Wai TC, Demler O, Walters EE. Prevalence, severity, and comorbidity of 12-month DSM-IV disorders in the National Comorbidity Survey Replication. Vol. 62, Archives of General Psychiatry. 2005.
Sullivan P, Wray N, The PGC MDD Consortium. Genome-Wide Association Analyses Identify 44 Risk Variants And Refine The Genetic Architecture Of Major Depressive Disorder. European Neuropsychopharmacology. 2019;29.
Wray NR, Ripke S, Mattheisen M, Trzaskowski M, Byrne EM, Abdellaoui A, et al. Genome-wide association analyses identify 44 risk variants and refine the genetic architecture of major depression. Nat Genet. 2018;50(5).
Hyde CL, Nagle MW, Tian C, Chen X, Paciga SA, Wendland JR, et al. Identification of 15 genetic loci associated with risk of major depression in individuals of European descent. Nat Genet. 2016;48(9).
Berndt SI, Gustafsson S, Mägi R, Ganna A, Wheeler E, Feitosa MF, et al. Genome-wide meta-analysis identifies 11 new loci for anthropometric traits and provides insights into genetic architecture. Nat Genet. 2013;45(5).
Bradfield JP, Taal HR, Timpson NJ, Scherag A, Lecoeur C, Warrington NM, et al. A genome-wide association meta-analysis identifies new childhood obesity loci. Nat Genet. 2012;44(5).
Locke AE, Kahali B, Berndt SI, Justice AE, Pers TH, Day FR, et al. Genetic studies of body mass index yield new insights for obesity biology. Nature. 2015;518(7538).
Speliotes EK, Willer CJ, Berndt SI, Monda KL, Thorleifsson G, Jackson AU, et al. Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. Nat Genet. 2010;42(11).
Thorleifsson G, Walters GB, Gudbjartsson DF, Steinthorsdottir V, Sulem P, Helgadottir A, et al. Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. Nat Genet. 2009;41(1).
Willer CJ, Speliotes EK, Loos RJF, Li S, Lindgren CM, Heid IM, et al. Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. Nat Genet. 2009;41(1).
Vanaveski T, Singh K, Narvik J, Eskla KL, Visnapuu T, Heinla I, et al. Promoter-Specific expression and genomic structure of Iglon family genes in mouse. Front Neurosci. 2017;11.
Hashimoto T, Maekawa S, Miyata S. IgLON cell adhesion molecules regulate synaptogenesis in hippocampal neurons. Cell Biochem Funct. 2009;27(7).
Schäfer M, Bräuer AU, Savaskan NE, Rathjen FG, Brümmendorf T. Neurotractin/kilon promotes neurite outgrowth and is expressed on reactive astrocytes after entorhinal cortex lesion. Molecular and Cellular Neuroscience. 2005;29(4).
Lee AWS, Hengstler H, Schwald K, Berriel-Diaz M, Loreth D, Kirsch M, et al. Functional inactivation of the genome-wide association study obesity gene neuronal growth regulator 1 in mice causes a body mass phenotype. PLoS One. 2012;7(7).
Tassano E, Gamucci A, Celle ME, Ronchetto P, Cuoco C, Gimelli G. Clinical and Molecular Cytogenetic Characterization of a de novo Interstitial 1p31.1p31.3 Deletion in a Boy with Moderate Intellectual Disability and Severe Language Impairment. Cytogenet Genome Res. 2015;146(1).
Veerappa AM, Saldanha M, Padakannaya P, Ramachandra NB. Family-based genome-wide copy number scan identifies five new genes of dyslexia involved in dendritic spinal plasticity. J Hum Genet. 2013;58(8).
Genovese A, Cox D, Butler M. Partial Deletion of Chromosome 1p31.1 Including only the Neuronal Growth Regulator 1 Gene in Two Siblings. J Pediatr Genet. 2015;04(01).
Dennis EL, Jahanshad N, Braskie MN, Warstadt NM, Hibar DP, Kohannim O, et al. Obesity gene NEGR1 associated with white matter integrity in healthy young adults. Neuroimage. 2014;102(P2).
Kim H, Chun Y, Che L, Kim J, Lee S, Lee S. The new obesity-associated protein, neuronal growth regulator 1 (NEGR1), is implicated in Niemann-Pick disease Type C (NPC2)-mediated cholesterol trafficking. Biochem Biophys Res Commun. 2017;482(4).
Gamero-Villarroel C, González LM, Gordillo I, Carrillo JA, García-Herráiz A, Flores I, et al. Impact of NEGR1 genetic variability on psychological traits of patients with eating disorders. Pharmacogenomics Journal. 2015;15(3).
Park LT, Zarate Jr CA. Depression in the primary care setting. New England Journal of Medicine. 2019;380(6):559–68.
Gerring ZF, Gamazon ER, Derks EM. A gene co-expression network-based analysis of multiple brain tissues reveals novel genes and molecular pathways underlying major depression. PLoS Genet. 2019;15(7).
Carboni L, Pischedda F, Piccoli G, Lauria M, Musazzi L, Popoli M, et al. Depression-Associated Gene Negr1-Fgfr2 Pathway Is Altered by Antidepressant Treatment. Cells. 2020;9(8).
Beck AT, Rial WY, Rickels K. Short form of depression inventory: cross validation. Psychol Rep. 1974;34(3).
HAMILTON M. A rating scale for depression. J Neurol Neurosurg Psychiatry. 1960;23.
Beck AT, Steer RA, Brown GK. Manual for the beck depression inventory The Psychological Corporation. San Antonio, TX. 1996.
Livak KJ, Schmittgen TD. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. Methods. 2001;25(4).
Kim H, Hwang JS, Lee B, Hong J, Lee S. Newly identified cancer-associated role of human neuronal growth regulator 1 (NEGR1). J Cancer. 2014;5(7).
LOWRY OH, ROSEBROUGH NJ, FARR AL, RANDALL RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193(1).
Diagnostic A. Statistical Manual of mental disorders. Washington, DC: American Psychiatric Association; 1994.
Pischedda F, Szczurkowska J, Cirnaru MD, Giesert F, Vezzoli E, Ueffing M, et al. A cell surface biotinylation assay to reveal membrane-associated neuronal cues: Negr1 regulates dendritic arborization. Molecular and Cellular Proteomics. 2014;13(3).
Lohoff FW. Overview of the genetics of major depressive disorder. Vol. 12, Current Psychiatry Reports. 2010.
Gupta S, Mukherjee A, Biswas S, Bose S, Nath S, Das H. Evaluation of endocrine parameters as predictor of major depressive disorder. Indian J Psychol Med. 2017;39(6).
Xu K, Zheng P, Zhao S, Wang M, Tu D, Wei Q, et al. MANF/EWSR1/ANXA6 pathway might as the bridge between hypolipidemia and major depressive disorder. Transl Psychiatry. 2022;12(1).
Xu K, Zhao S, Ren Y, Zhong Q, Feng J, Tu D, et al. Elevated SCN11A concentrations associated with lower serum lipid levels in patients with major depressive disorder. Transl Psychiatry [Internet]. 2024;14(1):202. Available from: https://doi.org/10.1038/s41398-024-02916-w
Karis K, Eskla KL, Kaare M, Täht K, Tuusov J, Visnapuu T, et al. Altered expression profile of igLON family of neural cell adhesion molecules in the dorsolateral prefrontal cortex of schizophrenic patients. Front Mol Neurosci. 2018;11.
Boender AJ, van Gestel MA, Garnerv KM, Luijendijk MCM, Adan RAH. The Obesity-Associated gene NEGR1 regulates aspects of energy balance in rat hypothalamic areas. Physiol Rep. 2014;2(7).
Bewernick BH, Urbach AS, Bröder A, Kayser S, Schlaepfer TE. Walking away from depression-motor activity increases ratings of mood and incentive drive in patients with major depression. Psychiatry Res. 2017;247.
Maccarrone G, Ditzen C, Yassouridis A, Rewerts C, Uhr M, Uhlen M, et al. Psychiatric patient stratification using biosignatures based on cerebrospinal fluid protein expression clusters. J Psychiatr Res. 2013;47(11).
Singh K, Loreth D, Pöttker B, Hefti K, Innos J, Schwald K, et al. Neuronal growth and behavioral alterations in mice deficient for the psychiatric disease-associated negr1 gene. Front Mol Neurosci. 2018;11.
Hashimoto T, Yamada M, Maekawa S, Nakashima T, Miyata S. IgLON cell adhesion molecule Kilon is a crucial modulator for synapse number in hippocampal neurons. Brain Res. 2008;1224.

The authors have declared there is NO conflict of interest to disclose

Download PDF

Version 1

posted

You are reading this latest preprint version

NEGR1 can influence symptom severity in fluoxetine treated major depression disorder patients

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Study Design

Beck depression inventory (BDI)

Hamilton rating scale for depression (HRSD)

Blood sampling, peripheral blood mononuclear cell (PBMC) culture and RNA extraction

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Determination of NEGR1 protein levels by ELISA

Statistical Analysis

Results

Demographic data

NEGR1 mRNA and protein levels and the effects of fluoxetine on NEGR1 expression

MDD symptom severity with respect to NEGR1 expression

Comparison of NEGR1 expression with anthropometric and biochemical parameters

Discussion

Declarations

Conflicts of Interest

Acknowledgements

References

Additional Declarations

Status:

Version 1