Alterations in CYP51 of Cercospora beticola and their effects on DMI sensitivity

doi:10.21203/rs.3.rs-4432488/v1

Download PDF

Research Article

Alterations in CYP51 of Cercospora beticola and their effects on DMI sensitivity

https://doi.org/10.21203/rs.3.rs-4432488/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Cercospora leaf spot disease (CLS) caused by the ascomycete Cercospora beticola is the most widespread fungal leaf disease in sugar beet. Fungicides of two active ingredient classes, quinone-outside inhibitors (QoIs) and demethylation inhibitors (DMIs), were important tools for CLS control. Over the years, C. beticola has become resistant to QoIs and a sensitivity shift has been reported for DMIs. In this study the mechanisms causing variation in DMI sensitivity in C. beticola isolates from Europe were analyzed. The CYP51 mutations I387M, Y464S, and L144F were detected in many isolates and most isolates carried the L144F in combination with mutation I309T. Furthermore, single isolates with other mutation combinations have been found. Wildtype isolates were found in low frequency in all European countries. Isolates that contained L144F showed higher EC₅₀ values than those without L144F. Ranges of EC₅₀ values of different CYP51 haplotypes were overlapping, an indication that other resistance mechanisms are present. Mutation L144F is more frequently encoded by codon TTC (96%) than by TTT (4%), and the usage of codon TTC was correlated with increased EC₅₀ values, this being more pronounced for difenoconazole than for mefentrifluconazole. In addition, it could be observed that the usage of codon GAG for E at amino acid position 170, instead of GAA, was more frequently found in isolates with a higher adaptation compared with haplotypes that did not contain L144F. Overall, GAA was present in 67% of all isolates and GAG in 33%, with an unequal distribution within the haplotypes. These data indicate that target site mutations, especially L144F haplotypes, influence DMI sensitivity, and that in L144F haplotypes, L144F codon usage might be responsible for variations within L144F haplotypes. The codon usage for E170 may influence sensitivity and increase EC₅₀ variation of wildtype isolates and isolates with “weak” mutations, but not in L144F haplotypes.

Cercospora leaf spot

codon usage

silent mutation

demethylation inhibitors

The most important fungal disease on sugar beet in many regions worldwide is Cercospora leaf spot (CLS), caused by Cercospora beticola. CLS can reduce the exploitable sugar content of beets by as much as 50% (Shane and Teng 1992; Rangel et al. 2020). In addition to agricultural measures, fungicide applications play an important role in effective CLS control. These rely mainly on demethylation inhibitors (DMIs), multisite acting fungicides, and more recently, succinate dehydrogenase inhibitors.

C. beticola is classified as a medium-risk pathogen by the Fungicide Resistance Action Committee (FRAC 2019). This indicates that there is a medium risk for this pathogen to develop fungicide resistances. In previous seasons, C. beticola developed resistance to QoIs, mediated by the G143A mutation in cytochrome b (Bartlett et al. 2002; Bolton et al. 2013). Mutation G143A is now widely and frequently distributed in Europe (FRAC 2023). As a consequence, the importance of DMIs as efficient CLS control tools has increased, which triggered the need to intensify DMI sensitivity monitoring. A minor increase in EC₅₀ values in European populations was reported by Muellender et al. (2021), who identified several point mutations in the DMI target gene sterol 14α-demethylase (CYP51). In addition to the detection of point mutations in the target gene that lead to an amino acid exchange (Kumar et al. 2021; Muellender et al. 2021), CYP51 overexpression (Nikou et al. 2009; Muellender et al. 2021), variable codon usage, and a silent mutation (Spanner et al. 2021) have also been discussed as mechanisms for DMI adaptation in C. beticola. In their studies with isolates from the United States, Spanner et al. (2021) reported that the phenylalanine of mutation L144F can be encoded by two different base triplets, TTT or TTC, both of which are associated with increased EC₅₀ values for tetraconazole. They observed a stronger decrease of tetraconazole sensitivity mediated by codon TTC, which was also found more frequently within the investigated isolates. Furthermore, they found a silent (synonymous) mutation at E170, where the third base in the codon of glutamic acid is changed from A to G (GAA ◊ GAG). Although the EC₅₀ values of isolates with only E170 were quite variable, it seems that E170 also contributes to DMI shifting of C. beticola to some extent (Rangel et al. 2020). However, DMIs are still very effective against C. beticola, thus the DMI shift only comes with a slight adaptation to DMIs.

Sensitivity monitoring is an important part of CLS fungicide resistance management. To assess the actual DMI sensitivity of C. beticola populations in Europe, a sensitivity monitoring survey was conducted in 2021 and 2022. Over 400 isolates were obtained from infected leaf material, and their sensitivity to the DMIs difenoconazole (DFA) and mefentrifluconazole (MFA) was assessed. The CYP51 gene of all isolates was sequenced to examine the target gene for point mutations, and codon usages for L144F and E170. EC₅₀ values were correlated with the respective CYP51 haplotypes to evaluate the influence of different non-synonymous point mutations and of the synonymous mutation at E170.

Isolates

Leaves infected with C. beticola were collected in Europe by BASF in 2021 (92 samples) and 2022 (56 samples) and provided to EpiLogic GmbH - A Tentamus Company (Freising, Germany) for sensitivity analysis. EpiLogic prepared two to five monosporic isolates from infected leaf samples, which included 205 in 2021, and 201 in 2022. Isolates were cultivated on potato dextrose agar and incubated in the dark at 25°C. After 6 days, isolates were transferred onto V8 agar (2% agar, 15% vegetable juice, 0,3% CaCO3) for conidial production. Isolates from 2021–2022 (all = 406) were from Austria (18), Czech Republic (24), France (106), Germany (51), Lithuania (24), Poland (115), Romania (20), Switzerland (18), Türkiye (9) and UK (21).

Microtiter plate test

Sensitivity tests in 96 well plates that were conducted by EpiLogic were adapted from methods in Muellender et al. (2021), and were performed to assess the sensitivity (EC₅₀ values) of monosporic isolates to the fungicides mefentrifluconazole (MFA) and difenoconazole (DFA). Conidia suspensions were prepared from ten-day-old plates by rinsing off the conidia with double concentrated YBG liquid medium (YBG dc). Conidia density was adjusted to 2 x 10⁴ conidia/ ml. DFA and MFA were used as commercially available formulations Score (250 g difenoconazole/ l SC, Syngenta Crop Protection AG, Basel, Switzerland) and: Revystar (100 g mefentrifluconazole/ l EC, BASF SE, Limburgerhof, Germany). The tested dilutions were 50, 10, 2, 0.4, 0.08, 0.016, and 0.0032 mg/ l for DFA and 100, 20, 4, 0.8, 0.16, 0.032, and 0.0064 mg/ l for MFA. Deionized, autoclaved water was used for dilutions and served as a negative control (0 mg/ l). Growth of the isolates was measured after six days of incubation in the dark at 18°C. The average of three replicates was calculated, and the blank was subtracted. Growth inhibition and EC₅₀ values were calculated.

DNA extraction and sequencing of the Cyp51 gene

DNA of each isolate was extracted from the mycelium of seven-day-old cultures with the NucleoSpin Plant II Kit (Macherey–Nagel, Dueren, Germany), following the manufacturer’s instructions for DNA extraction from plants. PCRs for the CYP51 were performed in a total reaction volume of 25 µl, this contained 12.5 µl Phusion Hot Start High-Fidelity DNA polymerase master mix (Finnzymes OY, Espoo, Finland), 7.5 µl Millipore water, 1.25 µl (10 pmol/ µl) of each primer, and 2.5 µl genomic DNA. The primers used were KES 2215 (fw, GACACCGCAGAGTGATGTAT), and KES 2216 (rv, TCAAAGGTCTCGAGAAAAGA). Amplification parameters were 98°C for 2 min for initial denaturation, followed by 35 cycles at 98°C for 10 s, 60°C for 30 s, and 72°C for 1 min, with a final extension of 5 min at 72°C, and then cooling down to 8°C. The amplification success for each DNA sample was controlled by visualizing 5 µl of each PCR product on a 1% agarose gel stained with pegGREEN DNA/RNA dye (VWR Peqlab, Darmstadt, Germany) in TAE buffer and UV light. The remaining 20 µl PCR product was purified with the NucleoSpin Gel and PCR Clean-up Kit (Macherey–Nagel, Dueren, Germany) and sequenced at Seqlab-Microsynth (Göttingen, Germany) with the same primers used for the PCR. Sequences were verified and aligned with the complete wildtype cDNA sequences of the CYP51 gene of C. beticola with Geneious Prime Version 2020.1.2 (Biomatters, Ltd., New Zealand).

To evaluate the level of DMI adaptation of C. beticola in Europe, and to monitor the development of target site mutations correlated with DMI shifting, over 406 isolates from 148 field samples collected in 2021 and 2022 were analyzed for their DMI sensitivity by means of microtiter plate tests. Furthermore, the CYP51 gene of all isolates was sequenced and analyzed for synonymous and non-synonymous mutations.

Sequencing of the Cyp51 gene of C. beticola

Table 1 shows the frequency of the different CYP51 haplotypes with amino acid exchanges and wildtype found. The wildtype haplotype (WT) was detected in 4.8% in 2021 and 3% in 2022. In both years, double mutant L144F + I309T was the most frequent haplotype, with 45% in 2021 and 50% in 2022. The single mutation L144F was found in 44 isolates from 2021 and in 41 isolates from 2022. With 28 isolates in 2021 and 27 isolates in 2022, the haplotype with mutation Y464S was the third most frequent, followed by haplotype I387M, with 20 isolates in 2021 and 25 isolates in 2022. Mutation C291R was only detected once in one isolate from 2022. Other double- and triple mutations were found only once or twice in 2021.

Table 1

Number of isolates from 2021 and 2022 with the respective CYP51 haplotypes
Haplotype	2021	2022
L144F	44	41
M289I	1	-
C291R	-	1
I387M	20	25
Y464S	28	27
L144F + M145L	1	-
L144F + H306R	2	-
L144F + I309T	93	101
L144F + I387M	1	-
L144F + D461E	2	-
L144F + I309T + I387M	1	-
WT	12	6
∑	205	201

Influence of CYP51 target site mutations on DMI sensitivity

A positive correlation between the EC₅₀ values of C. beticola for DFA and MFA was observed both in 2021 (r = 0.46) and 2022 (r = 0.49) (Fig. 1A and B). The WT isolates showed low EC₅₀ values (< 1 ppm) for both DMIs in both years, with the exception of one isolate in 2021 with EC₅₀ values > 1 ppm for both DMIs. Haplotypes I387M and Y464S showed low adaptation to DMIs, with the majority of the EC₅₀ values falling between 0.1 and 1.0 ppm (mean EC₅₀ for MFA = 0.45 ppm, mean EC₅₀ for DFA = 0.36 ppm). All haplotypes possessing mutation L144F showed higher EC₅₀ values (mean EC₅₀ for MFA = 2.9 ppm, mean EC₅₀ for DFA = 2.52 ppm), with a maximum of 10.8 ppm for MFA in 2021 and 25.4 ppm for DFA in 2022. The highest EC₅₀ values were reached in both years with haplotype L144F + I309T.

Codon usage for L144F and E170

Out of 286 isolates that carried mutation L144F (n = 144 in 2021, n = 142 in 2022), the amino acid phenylalanine was encoded by the codon TTC in 269 isolates (96%), and by TTT in 17 isolates (4%). All haplotypes carrying mutation L144F showed a tendency toward higher EC₅₀ values for MFA when codon TTC was used instead of TTT (Fig. 2). This trend toward a higher adaptation in the presence of codon TTC was more pronounced for DFA, where isolates with a TTC encoded L144F mutation had significantly higher EC₅₀ values than TTT encoded ones (Fig. 3). None of the 194 isolates with the strong double mutation L144F + I309T used codon TTT to encode phenylalanine.

The silent mutation E170 (codon GAG) was found in 133 of the 406 isolates from 2021 and 2022 (Fig. 4). In combination with different haplotypes, the GAG codon for E170 showed various effects. WT isolates with GAG showed increased EC₅₀ values compared to WT isolates without the silent mutation. The rather sensitive haplotypes I378M and Y464S showed only a tendency toward increased EC₅₀ values when combined with GAG for E170. The opposite effect was observed when stronger DMI adapted haplotypes were combined with GAG for E170, such as L144F or L144F in combination with other mutations. Similar effects regarding sensitivity were observed for DFA (Fig. 5). GAG occurred more frequently (96%) in rather sensitive haplotypes (I387M, Y464S, C291R, M289I), except the wildtype. In stronger DMI adapted haplotypes, GAG was only present in 30% of cases. None of the isolates with the haplotype L144F + I309T, which is associated with stronger DMI adaptation, had GAG simultaneously. The correlation with the codon usage at 144 showed that GAA at 170 was only in combination with TTC at 144 (n = 257), never with TTT (n = 0), whereas GAG at codon 170 was found in combination with TTC at 144 (n = 12) or TTT (n = 17) (Table 2). GAA and GAG at 170 were found in all isolates from the sampled countries (Fig. 6).

Table 2

Correlation of codon usages for E170 and F144
	F144 (TTC)	F144 (TTT)	Sum
E170 (GAA)	257	0	257
E170 (GAG)	12	17	29
Sum	269	17	286

A European sensitivity monitoring survey was conducted in 2021 and 2022, this included microtiter plate tests and the sequencing of the CYP51 gene of 406 isolates. Sequencing and analysis of the CYP51 gene identified the already known point mutations I387M, Y464S, L144F and I309T, alone or in different combinations (Muellender et al. 2021; Spanner et al. 2021). Furthermore, the previously unknown point mutations M145L, M289I and D461E were found in 2021, as well as mutation C291R in 2022, but all were observed at very low frequency and with a low to moderate influence on DMI sensitivity. In addition, single isolates that carried the new mutation combinations L144F + M145L, L144F + H306R, L144F + I387M, L144F + D461E, and the triple combination L144F + I309T + I387M were detected and analyzed. Overall, a higher adaptation was observed when isolates had mutation L144F occurring alone or in different combinations with other mutations, this is in line with results from other studies (Muellender et al. 2021; Spanner et al. 2021).

In both years, the double mutation L144F + I309T showed the highest adaptation, it was also the most frequent haplotype, with 45% in 2021 and 50% in 2022. Muellender et al. (2021) reported that the haplotype L144F + I309T was also very frequent, however, a study of North American isolates indicated that the double mutation L144F + I309T was rather uncommon (Spanner et al. 2021). This would indicate that there are geographic differences between C. beticola populations in Europe and US. In this study, the single mutation L144F was found in 44 isolates from 2021 and in 41 isolates from 2022. With 28 isolates in 2021 and 27 isolates in 2022, the haplotype with mutation Y464S was the third most frequent. Interestingly, the mutation Y464S showed only low to moderate adaptation to MFA and DFA in this study but had the highest EC₅₀ values to tetraconazole in Spanner et al. (2021). This again emphasizes that different DMIs are differently affected by different CYP51 target site mutations. Furthermore, Y464S is quite frequent in Europe (this study,(Muellender et al. 2021), but seems to be rather uncommon in the US (Spanner et al. 2021). The two new target site mutations M289I and C291R did not have an influence on DMI sensitivity in C. beticola, as isolates with these mutations had similar EC₅₀ values to the sensitive wildtype isolates. Wildtype isolates and sensitive samples were uncommon in Europe in 2021 and 2022, this is similar to other fungal pathogens undergoing DMI selection pressure over decades, such as Venturia inaequalis (Hoffmeister et al. 2021), Ramularia collo-cygni (Rehfus et al. 2019) or Zymoseptoria tritici (Huf et al. 2018).

In the European CLS populations from 2021 and 2022, both codons (TTC and TTT) for the phenylalanine in mutation L144F were used, as it has been reported for CLS populations from Minnesota, North Dakota, and Idaho (Spanner et al. 2021). Out of 286 isolates with the mutation L144F, phenylalanine was encoded by the codon TTC in 269 isolates (96%), which is more frequent than that observed by Spanner et al. (2021), who reported 70%, but in line with the general codon usage of C. beticola (Kasuza Codon Usage Database(Nakamura 2007). All haplotypes that carried mutation L144F showed a tendency toward higher EC₅₀ values when codon TTC was present instead of TTT. This tendency was more pronounced for DFA than for MFA. This is in accordance with Spanner et al. (2021), who reported that both versions of L144F were associated with increased tetraconazole EC₅₀ values, but that the TTC codon had a significantly higher mean EC₅₀ value than the TTT codon. Interestingly, none of the 194 isolates with the strong double mutation L144F + I309T investigated in this study used codon TTT to encode phenylalanine.

In addition to non-synonymous mutations and the codon usage for L144F, the synonymous mutation E170 was also analyzed in this study. Codon GAG for E170 is a silent mutation without an amino acid change; here the third base in base triplet 170 is exchanged and codon GAG is used instead of GAA. Both codons were found in all European regions. The codon GAG was found in 133 (33%) and GAA in 273 (67%) of the 406 isolates from 2021 and 2022. Thus, GAG is less often present than it was observed in other studies, that reported an almost 50:50 situation (Spanner et al. 2021). Considering all isolates GAG at amino acid position 170 had only a limited effect on DMI sensitivity, compared to target site mutations. A thorough investigation into different haplotypes demonstrates that the silent mutation affects the different haplotypes in different ways. Wildtype isolates showed enhanced EC₅₀ when combined with the codon usage GAG at 170. The rather sensitive haplotypes I378M and Y464S still showed a tendency toward increased EC₅₀ values when combined with GAG. Conversely, EC₅₀ values of the stronger DMI adapted haplotypes, such as L144F alone or L144F in combination with other mutations, seemed to decrease. This differs from Spanner et al. (2021), who reported that the presence of silent mutation E170 was associated with a significant increase in EC₅₀ values for tetraconazole. In this study, the synonymous mutation GAG most frequently occurred with rather sensitive haplotypes (95%). In stronger DMI adapted haplotypes, codon GAG was only present in 30% of the cases. Surprisingly, no isolate with the double mutation L144F + I309T, which represented 48% of all isolates, carried the GAG codon at 170 at the same time. The reasons for this unequal distribution of the silent mutation at 170 between the CYP51 haplotypes could not be addressed in this study.

The shifting of C. beticola to DMIs has been discussed for more than two decades (Karaoglanidis et al. 2001; Karaoglanidis et al. 2002). DMI shifting is known from many other pathogens such as Z. tritici, Erysiphe necator or V. inaequalis, which could ultimately lead to a significant reduction in field performance of long-used DMI compounds. In many cases, however, new DMIs have been developed to control such shifted populations, which is one of the reasons why DMIs are such a successful mode of action group of fungicides for the control of many diseases over several decades. For a better understanding and optimization of disease and resistance management, it is mandatory to follow sensitivity development and to understand underlying resistance mechanisms. The mechanisms for the shifting in CLS were elucidated step by step over recent years (Muellender et al. 2021; Spanner et al. 2021), with the result that alterations of the CYP51 (mutations, codon usage, overexpression) are considered to be the main mechanisms. Results of the studies reported here contribute to a better understanding of DMI shifting in European CLS populations by using a high number of European isolates from two growing seasons. The evolution of DMI adaptation mechanisms followed a similar direction in the US and Europe and had a comparable outcome. Differences in frequencies of CYP51 haplotypes and codon usages for L144F and E170 in US and Europe could be explained by the fact that DMIs are affected differently by different haplotypes and the use of different fungicides in the two regions. For example, whereas epoxiconazole was intensively used in Europe but not in the US, triphenyltin hydroxide in the US but not in Europe. To avoid further adaptation to DMIs which are newly introduced for CLS control, such as mefentrifluconazole, effective resistance management strategies should be followed. Alternation and combination of different modes of action are effective measures, therefore SDHIs and multisite acting fungicides, such as sulphur and copper, could be considered in spray regimes for CLS control.

Ethical responsibility

The authors followed the ethical standard of the JPDP.

Authors contributions

Anja Hinson made isolates from leaf samples and analyzed the DMI-sensitivity these isolates. Mascha Hoffmeister and Jonas Schorer sequenced the CYP51 gene and analyzed the effects of the CYP51 alterations on the sensitivity. Gerd Stammler organized the monitoring and the molecular genetic analysis of isolates.

Acknowledgement

The authors thank Xenia Weilacher for excellent technical assistance, and Walter Hinson for critical reading of the manuscript.

Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M, Parr-Dobrzanski B (2002) The strobilurin fungicides. Pest Manag Sci 58:649–662. 10.1002/ps.520
Bolton MD, Rivera V, Secor G (2013) Identification of the G143A mutation associated with QoI resistance in Cercospora beticola field isolates from Michigan, United States. Pest Manag Sci 69:35–39. 10.1002/ps.3358
FRAC (2019) Pathogen Risk List. https://www.frac.info/docs/default-source/publications/pathogen-risk/frac-pathogen-list-2019.pdf?sfvrsn=caf3489a_2. Accessed 4 May 2023
FRAC, use recommendations of the SDHI Working Group of the Fungicide Resistance Action Committee (FRAC) (2023) Protocol of the discussions and. https://www.frac.info/docs/default-source/working-groups/sdhi-fungicides/sdhi-meeting-minutes/minutes-of-the-2023-sdhi-meeting-with-recommendations-for-2023-from-17-18th-jan-2023.pdf?sfvrsn=d74c4e9a_2. Accessed 7 May 2023
Hoffmeister M, Zito R, Böhm J, Stammler G (2021) Mutations in Cyp51 of Venturia inaequalis and their effects on DMI sensitivity. J Plant Dis Prot 128:1467–1478. 10.1007/s41348-021-00516-0
Huf A, Rehfus A, Lorenz KH, Bryson R, Voegele RT, Stammler G (2018) Proposal for a new nomenclature for CYP51 haplotypes in Zymoseptoria tritici and analysis of their distribution in Europe. Plant Pathol 67:1706–1712. 10.1111/ppa.12891
Karaoglanidis GS, Loannidis PM, Thanassoulopoulos CC (2002) Changes in sensitivity of Cercospora beticola populations to sterol-demethylation‐inhibiting fungicides during a 4‐year period in northern Greece. Plant Pathol 51:55–62. 10.1046/j.0032-0862.2001.x-i2
Karaoglanidis GS, Thanassoulopoulos CC, Ioannidis PM (2001) Fitness of Cercospora beticola field isolates – resistant and – sensitive to Demethylation Inhibitor Fungicides. Eur J Plant Path 107:337–347
Kumar R et al (2021) Characterization of the Molecular Mechanisms of Resistance against DMI Fungicides in Cercospora beticola Populations from the Czech Republic. J Fungi (Basel) 7. 10.3390/jof7121062
Muellender MM, Mahlein AK, Stammler G, Varrelmann M (2021) Evidence for the association of target-site resistance in cyp51 with reduced DMI sensitivity in European Cercospora beticola field isolates. Pest Manag Sci 77:1765–1774. 10.1002/ps.6197
Kazusa Codon Usage Database (2007) https://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=122368. Accessed 11/05/2023
Nikou D, Malandrakis A, Konstantakaki M, Vontas J, Markoglou A, Ziogas B (2009) Molecular characterization and detection of overexpressed C-14 alpha-demethylase-based DMI resistance in Cercospora beticola field isolates. Pestic Biochem Physiol 95:18–27. 10.1016/j.pestbp.2009.04.014
Rangel LI et al (2020) Cercospora beticola: The intoxicating lifestyle of the leaf spot pathogen of sugar beet. Mol Plant Pathol 21:1020–1041. 10.1111/mpp.12962
Rehfus A, Matusinsky P, Strobel D, Bryson R, Stammler G (2019) Mutations in target genes of succinate dehydrogenase inhibitors and demethylation inhibitors in Ramularia collo-cygni in Europe. J Plant Dis Prot 126:447–459. 10.1007/s41348-019-00246-4
Shane WW, Teng PS (1992) Impact of Cercospora leaf spot on root weight, sugar yield, and purity of Beta vulgaris. Plant Dis 76:812–820
Spanner R et al (2021) Genome-Wide Association and Selective Sweep Studies Reveal the Complex Genetic Architecture of DMI Fungicide Resistance in Cercospora beticola. Genome Biol Evol 13. 10.1093/gbe/evab209

Download PDF

Reviewers agreed at journal
21 May, 2024
Reviewers invited by journal
21 May, 2024
Editor assigned by journal
18 May, 2024
First submitted to journal
16 May, 2024

You are reading this latest preprint version

Alterations in CYP51 of Cercospora beticola and their effects on DMI sensitivity

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Isolates

Microtiter plate test

DNA extraction and sequencing of the Cyp51 gene

Results

Influence of CYP51 target site mutations on DMI sensitivity

Codon usage for L144F and E170

Discussion

Declarations

Ethical responsibility

Authors contributions

Acknowledgement

References

Status:

Version 1