Patient Dataset Analysis. Human colon cancer patient scRNA-Seq data sets (GEO accession: GSE17834139), human breast cancer patient scRNA-Seq data sets (GEO accession: GSE17607840), human melanoma patient scRNA-Seq data sets (GEO accession: GSE12057541), and all correlations were extracted and analyzed from the Broad Institute Single Cell Portal.
Human Tumor Specimens. Human pancreatic carcinoma tumor specimens and matched non-neoplastic pancreatic tissues were provided by Tianjin Medical University Cancer Institute & Hospital
Mice. Female C57BL/6 mice were purchased from Huafukang, Beijing, China. All mice used in this study were between 7–8 weeks old at the start of the experiment. All studies involving use of mice were covered by a protocol approved by the Institutional Animal Care and Use Committees of Tianjin University.
Cell lines. The mouse pancreatic tumor PANC02 cell line was obtained from Jisidenuo, Shanghai, China. Cell lines are mycoplasma-free at the time of use.
Immunohistochemistry. Tissue sections were stained as previously described19. The sections were stained with anti-WDR5 antibody (sc-393080. Santa Cruz Biotechnology) and mounted in VectaMount Permanent Mounting Medium (Vector Lab, Burlingame, California, USA)
CRISPR-Based Gene Knockout. HEK293T cells were co-transfected with psPAX2 (Addgene #12260), pCMV-VSVG (Addgene #8454), and lentiCRISPRv2 (Genscript, Piscataway, NJ, USA) plasmids containing scramble (GAAGACTTAGTCGAATGAT), mouse WDR5-specific sgRNA1-coding sequence (AGGGAATATCTGATGTAGCG) or mouse WDR5-specific sgRNA2-coding sequence (ACTTGCCAACCATTCCCCAT) using Lipofectamine (Cat# T101-01, Vazyme, Nanjing, China). Cell culture supernatants (virus particles) were collected and used to infect PANC02 cells. Stable cell lines were established using puromycin (Cat# BS111, Biosharp, Hefei, China) selection and then stained with anti- TriMethl-Histone H3-K4 mAb (Cat# A22146, Abclonal, MA, USA) and analyzed by Western blotting.
Western blotting analysis. Cells were lysed in NETN buffer, measured for protein concentration by Bradford Assay Kit (Cat# MA0079, Meilunbio, Dalian, China), and cell lysates were separated in 4–20% SDS-polyacrylamide gels (Bio-Rad, Hercules, CA, USA) and blotted to PVDF membranes (Bio-Rad). The antibodies are listed in Table S1.
Gene expression Analysis. qPCR analysis was performed as previously described18. The sequences of primers are listed in Table S2.
Cell viability assay. Cell viability assays were performed using Good Laboratory Practice bioscience Cell Counting Kit-8 (Cat#GK10001, GLPBIO, Shanghai, China) according to the manufacturer’s instructions.
Flow cytometry. For cell lines, cells were firstly harvested, centrifuged, and washed in PBS. The cell pellets were resuspended in 100 µL PBS and stained with fluorescent dye conjugated antibodies. The suspension was then washed by PBS and resuspended in 300 µL PBS. For tumor, tissues were collected and digested in collagenase solution (1 mg/mL collagenase, 0.1 mg/mL hyaluronidase, and 30 U/mL DNase I) and passed through a 100 µm cell filter. Cells were then lysed with red cell lysis buffer, stained with fluorescent dye-conjugated antibodies. All antibodies were obtained from Biolegend and listed in TableS1. Stained cells were analyzed by flow cytometry. All flow cytometry data were analyzed using FlowJo program.
In Vivo Tumor Mouse Model and Treatments. To establish tumor-bearing mouse model, PANC02 scramble, PANC02 WDR5 KO cells (1.5×107 cells/mouse) and PANC02 WT cells (1×106 cells/mouse) were subcutaneously injected to the right flank of C57BL6 mice. The PANC02 WT tumor-bearing mice were then treated with solvent and WDR5-47 (20mg/kg body weight) by i.p. injection 17 days after tumor cell injection daily for a total of 9 times.
WDR5-47 Synthesis. WDR5-47 was synthetized according to the reported literature. 2-Fluoro-5-nitroniline was reacted with N-methyl piperazine to generate the corresponding amino intermediate, which was then reacted with 2-chloro-4-fluoro-3-methylbenzoyl chloride to the yield the target compound WDR5-4717.
Chromatin immunoprecipitation (ChIP) Assay. ChIP assays were carried out using the Chromatin Immunoprecipitation Assay Kit (Cat# 17–295, Merck, NJ, USA). Briefly, Cells (1×106 cells) were harvested, cross linked by 1% formaldehyde (Cat# F809702, Macklin, Shanghai, China), washed in PBS, resuspended in SDS Lysis Buffer and sonicated, centrifuged. The sonicated cell supernatant was diluted ten fold in ChIP Dilution Buffer (reserve 5% diluent as input), added the immunoprecipitating antibody and incubated overnight. The beads were then washed in Low Salt Immune Complex Wash Buffer, High Salt Immune Complex Wash Buffer, LiCl Immune Complex Wash Buffer, TE Buffer, respectively, and eluted in 500 µL Elution Buffer. The eluants were reversed and recovered DNA by phenol/chloroform/isoamyl alcohol (Cat# P59330, Acmec, Shanghai, China). The irf2 and cd279 promoter DNA were detected by Real-Time Quantitative PCR using promoter DNA-specific primers as listed in Table S2.
Statistical Analysis. All statistical analysis were performed by two-sided Student t test using the GraphPad Prism program (GraphPad Software, Inc.). p < 0.05 is considered as statistically significant.