Animals
C57BL/6J male mice,8 weeks of age, were purchased from SPF (Beijing) Biotechnology Co., Ltd. The STING KO mice (Cat No. T012747) were purchased from Jiangsu Gempharmatech, China. All animal were fed in Specific pathogen free (SPF) class animal houses at the First Hospital of the Naval Medical University, all animal experiments were approved by the Ethics Committee of Shanghai Chinghai Hospital under number CHEC2021-006.
Drug Administration
For deplete macrophages in mice, the mice were given 200 µl of Clodronate Liposomes (YEASEN, Shanghai, China) by intravenous Injection on 6 hours before surgery and 150 µl of Clodronate Liposomes by intravenous Injection on days 2, 4 and 6 after surgery. The efficiency of macrophages depletion was evaluated by Flow Cytometry.
For inhibit STING in mice, the mice were given C176(5mg/kg, Selleck, USA) by intraperitoneal injection on 2 hours before modeling 、days 2, 4 and 6 after modeling.
For inhibit P-STAT3 in mice, the mice were given Stattic(10mg/kg, Med-Chem Express, USA) by intraperitoneal injection on 2 hours before modeling 、days 2, 4 and 6 after modeling.
Cell culture and treatment
Bone marrow-derived macrophages (BMDMs) were isolated and cultured as described previously[32]. BMDMs were cultured with RPMI-1640 medium (10% FBS, 1% penicillin, and streptomycin) and 25 ng/mL M-CSF (HY-P7085, Med-Chem Express, USA). The mouse tracheal DNA were extracted by Tissue DNA Isolation Mini Kit (DC102, Vazyme, CHINA) and then stimulate BMDMs by transfection. Nucleic acids were transfected using Lipofectamine 3000. For DNase I Treatment, a total of 100 µg/mL DNase I (Sigma 10104159001) was added to cell culture medium with added transfection reagents and the reaction kept at 37°C for 1 hour.
Mouse tracheal fibroblasts were purchased from Procell (CP-M008), and were treated with C176(1µm, Selleck, USA) and DMXAA (75µg/ml, Selleck, USA) for 6 hours. To explore the effect of inflammatory factors secreted by macrophages on fibroblasts, fibroblasts and BMDMs were cocultured in a Transwell culture system, the fibroblasts were seeded into the bottom of a 6-well plate while the BMDMs were seeded into the 6-well culture inserts. Prior to coculture, the BMDMs were treated with transfection. The pretreated BMDMs were then cocultured with fibroblasts.
Surgical Procedure
The mouse model of BAS was Induced by Scraping of the tracheal mucosa. Firstly, the pretracheal tissue is cut layer by layer to expose the trachea, then the trachea was incised transversely along the two tracheal cartilages below the cricoid cartilage, and with an incised length of two thirds of the circumference .Next a diameter of 1 mm small brush was inserted through cannula of safety IV catheter 20G (B|BRAUN Medical) into the trachea 6 mm deep, then pull the cannula out of the trachea by pulling the line tied to cannula, leaving the brush in the trachea and scraping for three times to cause damage to the tracheal wall and thus create tracheal stenosis, the incised trachea was then closed with 6 − 0 sutures and the subcutaneous tissue and skin were closed with 3 − 0 sutures.
Measurement of dsDNA in mouse trachea
Benign airway stenosis mice were collected for tracheal tissue 24 hours after modelling. The interior of the trachea was then irrigated three times with 50 µl of TE buffer and the trachea lavage fluid was collected. dsDNA was measured in the trachea lavage fluid using Picogreen dsDNA Quantitation Reagent (YEASEN, Shanghai, China), according to the manufacturer's protocol.
Histology, Immunohistochemistry
The tracheas were fixed in 4% buffered formaldehyde for 24h, paraffin-embedded, Slides were made from 3-µm-thick sections cut through in an axial plane,which were then stained with hematoxylin-eosin,Masson trichrome reagents and Sirius staining. The thickness of LP and fibrosis area were measured using ImageJ software. For measurement of LP thickness, three thickest sites were selected for each specimen and the mean LP thickness was calculated for each specimen. Measurements were taken from the medial side of the cartilaginous ring of the trachea to the basement membrane of the airway epithelium[33].
For immunohistochemistry (IHC), the antigen was retrieved by incubation at 95°C in citric acid antigen repair solution for 30 min, the slides were immunestained with STING (1:100, #13647S, Cell Signaling Technology) and Phospho-Stat3(1:100, #9145T, Cell Signaling Technology) at 4°C overnight. Binding antibodies were detected using biotinylated goat anti-rabbit secondary antibodies and incubated for 1h at room temperature. The sections were then developed with DAB solution, and counterstained with hematoxylin.
Immunofluorescence staining of tracheal and cells
Tracheal tissues were fixed in 4% buffered formaldehyde for 24 h, embedded in paraffin, and sectioned at 3µm. Antibodies were used for immunofluorescence staining in the study:
STING (1:400, #78827, Cell Signaling Technology), Phospho STING (1:50, #62912, Cell Signaling Technology), F4/80(1:400,#30325,Cell Signaling Technology), Phospho Stat3(1:200, #9145,Cell Signalling Technology), Collagen I (1:100,#ab316222,Abcam), αSMA(1:200,#19245,Cell Signaling Technology), FN1 (1:100,#ab268020,Abcam),Phospho Histone H2A.X(1:200,#9718,CellSignalingTechnology),IL6(1:200,#12912, Cell Signaling Technology ) ,dsDNA Marker (1:100#sc-58749,Santa Cruz Biotechnology).
Cells were fixed in 1% paraformaldehyde for 15 min, permeabilized with 0.3% Triton-X100/PBS, and blocked with 4% BSA. Cells were then incubated with in blocking buffer. Subsequently, the coverslips were incubated with secondary antibodies for 1 h at room temperature and finally stained with DAPI for 5 min at room temperature. Antibodies were used for immunofluorescence staining in the study: Phospho-STING(1:200,#62912,Cell Signaling Technology),Phospho-Stat3(1:100,#9145,Cell Signaling Technology) ,αSMA (1:200,#19245, Cell Signaling Technology)
RT-PCR
To obtain mRNA, we use a RNeasy extraction kit (Vazyme) to extract mRNA from tracheal tissues and intracellular components. cDNA was generated with a One-step iScript cDNA Synthesis Kit (Vazyme), and RT-PCR was performed using SYBR green Master Mix (Vazyme) on QuantStudio™ 3 System(Thermo Fisher Scientific). The GAPDH gene was used as the control Data were analyzed using the comparative analysis of relative expression by ΔΔCt methods. The mouse-specific (m) primer sequences used are as follows:
mouse GAPDH forward: AGGTCGGTGTGAACGGATTTG;
mouse GAPDH reverse: TGTAGACCATGTAGTTGAGGTCA;
mouse IL6 forward: TAGTCCTTCCTACCCCAATTTCC;
mouse IL6 reverse: TTGGTCCTTAGCCACTCCTTC;
mouse IL1β forward: GCAACTGTTCCTGAACTCAACT;
mouse IL1β reverse: ATCTTTTGGGGTCCGTCAACT;
mouse CXCL10 forward: CCAAGTGCTGCCGTCATTTTC;
mouse CXCL10 reverse: GGCTCGCAGGGATGATTTCAA;
mouse αSMA forward: GTCCCAGACATCAGGGAGTAA
mouse αSMA reverse: TCGGATACTTCAGCGTCAGGA
mouse Col1a1 forward: GCTCCTCTTAGGGGCCACT
mouse Col1a1 reverse: CCACGTCTCACCATTGGGG
Western blotting
Mouse tracheal tissues and cellular proteins were extracted using a lysis buffer prepared by proportionally mixing RIPA buffer, protease inhibitor, and phosphatase inhibitor. Protein concentration was determined using the BCA method, and samples were mixed with loading buffer and boiled at 100°C for 10 minutes. A 10-well polyacrylamide gel with sodium dodecyl sulfate (SDS) was prepared, and equal amounts of protein samples were loaded into the wells for electrophoresis (at 80–120 V for 60 minutes). A methanol-based transfer buffer was prepared, and proteins were transferred onto a 0.45µm PVDF membrane, followed by blocking in a blocking solution. The membrane was incubated overnight at 4°C with primary antibodies, including STING (1:1000, #13647S,Cell Signaling Technology), Phospho-STING(1:1000,#72971S,Cell Signaling Technology), TBK1(1:1000, #38066S,Cell Signaling Technology), Phospho-TBK1 (1:1000,#5483S,Cell Signaling Technology), NF-κB p65(1:1000,#8242T, Cell Signaling Technology), Phospho-NF-κB p65(1:1000, #3033T,Cell Signaling Technology),αSMA(1:1000,#19245T, Cell Signaling Technology),Collagen I(1:1000,#ab316222, Abcam),GAPDH(1:5000,# 10494-1-AP, Proteintech). Next, the membrane was incubated with HRP-conjugated Goat anti-rabbit IgG༈1:8000, #SA00001-2, Proteintech༉. After scanning the membrane with an automated protein blotting system (Tanon, Shanghai, China), protein bands were analyzed using ImageJ software.
Micro CT and Measurement method of tracheal stenosis in imaging
On the seventh day post-modeling, the mouse airways were examined by micro CT(90 kV, 0.065 mA, PINGSHENG Healthcare)scanning, and the tracheal area was measured within the adipose window. The degree of narrowing at the most constricted level was measured using the following formula: (1 - s/S) * 100%, where s represents the area of the most constricted level of the trachea and S represents the average of the areas at the normal levels 3mm above and below the most constricted level. SYNPASE 3D༈SYNAPSE 3D V4.4,Fujifilm Medical, Tokyo, Japan༉was utilized for measuring the mouse tracheal area and performing 3D reconstruction of the trachea.
Flow Cytometry
Mouse tracheal tissue was dissociated and cleaned with PBS, placed in dissociation enzyme solution (Liberase 100 ug/ml, Roche 5401119001, DNase I 40 ug/ml, Sigma 10104159001) in DMEM at 37℃ for 45 minutes, Then cut the undissociated tissue and continue to bathe at 37 for 60min, After the dissociation, wash with 10ml pre-cooled PBS, filter with 70um screen, centrifuge 500g for 5min.After centrifugation, the supernatant was poured away and cell precipitates were collected[34]. Then, perform cell staining using LIVE/DEAD Stain (#564406, BioLegend) and cell surface marker antibodies. After surface staining, fix and permeabilize using the BD Fixation/Permeabilization Kit(#554714,BD Pharmingen), followed by intracellular cytokine staining. Finally, it was detected by flow cytometry༈Celesta BD Biosciences༉. Cells were stained with antibody to the following markers:CD45(#557659,BioLegend),CD11b(#552850,BioLegend),F4/80(#557659,BioLegend), CD86(#105008,BioLegend), STING༈#78827S, Cell Signaling Technology༉.
Inflammatory factor analysis
After tracheal tissue isolation, Luminex multiplex cytokine arrays (BIO-RAD, Hercules, CA, USA, 12009159) were used to detect inflammatory cytokines (n = 6/control group, n = 10/BAS group) and were performed by LabEx (Shanghai, China) using the Luminex X-200, according to the manufacturer’s protocol (Luminex, Austin, TX, USA).
Enzyme-linked immunosorbent assay was performed for the measurement of IL6(EK206, LIANKE) in cell culture supernatant according to the manufacturer’s instructions.
RNA-seq analysis
Mouse tracheal tissues were collected, and each trachea was an independent sample. The total RNA was extracted using Trizol reagent (thermofisher,15596018) following the manufacturer's procedure. The total RNA quantity and purity were analysis of Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA,5067 − 1511), high-quality RNA samples with RIN number > 7.0 were used to construct sequencing library. After total RNA was extracted, mRNA was purified from total RNA (5ug) using Dynabeads Oligo (dT) (Thermo Fisher, CA, USA) with two rounds of purification. Following purification, RNA fragments were reverse transcribed and amplified to generate cDNA libraries. The average insert size for the final cDNA librarys were 300 ± 50 bp. At last, we performed the 2×150bp paired-end sequencing (PE150) on an Illumina Novaseq™ 6000 (LC-Bio Technology CO., Ltd., Hangzhou, China) following the vendor's recommended protocol.
Single-cell RNA sequencing (scRNA-seq)
Collect three tissues: healthy tracheal rings, granulation tissue from three days post-tracheal intubation, and scar tissue obtained two years post-tracheostomy. The tissue was cut into small pieces of 0.5mm2 and then washed with 1xPBS to dissociate the tissue into individual cells in dissociation solution. Overall cell viability exceeded 85%, as confirmed by trypan blue exclusion. Single-cell suspensions were counted using a Countess II automated cell counter, and the concentration was adjusted to 700 to 1200 cells /µl prior to single-cell analysis.
Single-cell suspensions were loaded to 10x Chromium to capture single cell according to the manufacturer’s instructions of 10X Genomics Chromium Single-Cell 3’ kit (V3). The following cDNA amplification and library construction steps were performed according to the standard protocol. Libraries were sequenced on an Illumina NovaSeq 6000 sequencing system (paired-end multiplexing run,150bp) by LC-Bio Technology co.ltd., (HangZhou, China) at a minimum depth of 20,000 reads per cell.
Sequencing results were demultiplexed and converted to FASTQ format using Illumina bcl2fastq software(version2.20). Sample demultiplexing, barcode processing and single-
cell 3’gene counting by using the cell ranger pipelines(https://support.10xgenomics.com/single-cell-geneexpression/ software/pipelines/latest/what-is-cell-ranger, version 3.1.0). The scRNA-seq data were then aligned to the Ensembl genome GRCm38 reference genome
and further dimensionality reduction, clustering, and analysis were performed using Seurat (version 3.1.1). To visualize the data, we further reduced the dimensionality of all 19,468
cells using Seurat and used t-SNE to project the cells into 2D space.
Statistical analysis
All dates are presented as mean ± SEM. GraphPad Prism 9 was used for statistical analysis (GraphPad software, San Diego, California, USA). Differences between two groups were identified using the Student t test and multiple groups using one- or two-way ANOVA analysis. P values of less than 0.05 were considered statistically significant.