Patient selection:
Six acute ICH samples and six normal brain samples were collected from the department of neurosurgery of the First Affiliated Hospital of Zhengzhou University. The Ethics Committee for human experiments of Zhengzhou University approved all procedures (Approval number: 2021-KY-0156). Informed consent was obtained and approved by the University Review Board. The study was performed in accordance with the Helsinki Declaration. Six patients presenting with acute ICH and basal ganglia hematoma volumes exceeding 40 ml underwent minimally invasive surgery under microscopic guidance. Informed consent was obtained for the collection of peri-hematomal tissue samples. As controls, six normal brain tissue samples were harvested from patients with deep-seated meningiomas during non-functional tissue resection, with written consent explicitly provided for this purpose. No significant differences in general data were found between the two groups.
Animals:
All experimental procedures involving animal study were approved by the Institutional Animal Care and Use Committee (IACUC) of Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences (Approval number: SIAT-IACUC-231116-FMZ-A2385). Adult male C57BL/6J mice (8–10 weeks, 20-25g, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were used in this study. All mice were housed in barrier facilities in a 12 h light/dark cycle with free access to standard mouse diet and water.
ICH models: The ICH model was induced by Collagenase in mice as previously studies. Briefly, the mice were anesthetized by inhalation isoflurane (1.5%, RWD, China) and then placed on a stereotaxic frame. Collagenase VII-S (sterile-filtered, 0.15U in 0.5 µl of sterile saline, Sigma, St. Louis, MO, USA) was injected into the right basal ganglia of mice (coordinates: 0.3 mm anterior, 2.3 mm lateral and 3.8 mm ventral to the bregma) through a Hamilton syringe at a rate of 0.2 µl/min. The needle was remained for 10 min and then withdrawn slowly. The surgical incision was sutured after blocking the skull burr hole with bone wax. The mice were closely monitored until full recovery from anesthesia. Sham surgery was executed following the same procedure without the Collagenase infusion.
Drug administration:
The mice were randomly assigned into four groups: (A) Sham, (B) ICH, (C) ICH + Vehicle, (D) ICH + PF543. ICH model mice received Vehicle (DMSO 10 µl diluted in saline 190 µl) or PF543 (10 mg/kg/d, dissolved in 10 µl DMSO and then diluted in saline 190 µl, Selleck, USA) via intraperitoneal injection at 1 hour after ICH and subsequently received every 24 hours beginning on the second day after ICH, with total 3 days.
Cell culture experiments:
The immortalized mouse brain endothelial cell line bEnd.3 was obtained from American Type Culture Collection (Manassas, VA, USA). bEnd.3 cells were grown in DMEM (Cytiva, China) supplemented with 10% fetal bovine serum (FBS), 100 units/mL of penicillin and 100 µg/mL of streptomycin. bEnd.3 cells were cultured in a constant temperature incubator at 37°C with 5% CO2 and 95% air. All experiments were employed when the density of cells was 90–100%. Hemin exposure and hypoxia: the media of bEnd.3 cells was added with Hemin (1 µM, sigma, USA), then cell plates were placed in a hypoxia chamber (Billups-Rothenberg Inc., USA), and the air was replaced with mix gas of 95% N2 and 5% CO2 by flushing, simulating an ICH stimulation in vitro. Cells were exposed to the in vitro ICH condition for 12 h at 37℃ for the following experiments. For pyroptosis inhibition experiments, bEnd.3 cells were treated with PF543 (2 µM, 5 µM), si-Sphk1#1 (sequences: 5’-CGCCGUGAAAUUGAGCAAATT-3’(forward) and 5’-UUUGCUCAAUUUCACGGCGTT-3’ (reverse) ), si-Sphk1#2 (sequences: 5’-GGCAGAGAUAACCUUUAAATT-3’(forward) and 5’-UUUAAAGGUUAUCUCUGCCTT-3’ (reverse)), respectively. Cell samples were collected for RT-qPCR after 24 h inhibition or for Western blot after 48 h inhibition.
Neurobehavioral tests:
The longa test, bederson’s scale, limb placement, corner turn test and beam walking test were used to evaluate neurological functions as previously described[55, 56]. Longa test was employed to assess forelimb walking and limb motor symmetry, with a maximum score of 4, with higher scores indicating more severe neurological deficits. The bederson’s scale was performed to assess tactile proception, axial sensation and forelimb activity. The limb placement test was used for the selective obstruction of cortical sensory-motor areas including visual induction, tactile induction, and proprioception-induced limb placement response, testing the anterior and lateral limb placement response function in mice. In the corner turn test, the mice were allowed to enter into a 30°corner, the count of turns to the left or right was recorded and repeated 10 times, and the average percentage of left turns was calculated. The beam-walking test was performed by apparatus consisted of a long strip of wood, which was suspended at a height of 60 cm, with the other end attached an enclosed box. After training of crossing the beam to the enclosed box, the mice were placed at the initial 20 cm of the beam, and the time taken to cross the beams and the number of foot slips off the beam were recorded.
Hemorrhage volume and brain water content:
Brain hematoma volume and cerebral edema were measured based on a previous report[57]. In short, in mouse brain slices, the area of the hematoma was multiplied by the thickness of the hematoma volume of each brain slice, and then the sum of all hematoma volumes was calculated. Brain water content was calculated as (wet weight - dry weight)/wet weight ×100%.
Magnetic resonance imaging (MRI) examination:
MRI was used to estimate brain swelling at 72 h after ICH. Mice were anesthetized with 1.5% isoflurane and placed on a scanning bracket. The body temperature, cardiac rhythm and blood oxygen saturation were monitored during scanning. MRI scanning was performed using a 9.4T MRI scanner (uMR930, United Imaging, China). MRI images were acquired using a fast spin-echo (FSE) sequence to calculate a T2 map. During MRI acquisition, the following parameters were used: Zoom: 1.00, KF: SM, IF: sm, Fix TP: 0, SP: H3.5, field of view (FOV) = 19*19 mm, 0.5 mm slice thickness, Matrix:384×384, TRA > COR 5.0 > SAG − 1.1, WW: 411 and WL: 207. Brain swelling was calculated as: (ipsilateral brain area - contralateral brain area) /ipsilateral brain area × 100%.
Evans blue extravasation:
To prepare 2% Evans blue (EB) dye, EB powder (Sigma-Aldrich, USA) was re-suspended in normal saline. Each mouse was intravenously injected with 100 µl 2% EB dye. After 4 h circulation, mice were transcardially perfused with ice PBS to remove the intravascular dye. The brains were divided into ipsilateral hematoma hemispheres and contralateral non-hematoma hemispheres, and then were homogenized in 1 ml of 50% trichloroacetic acid and centrifuged (10,000 rpm, 20 min). After centrifugation, the supernatant was diluted fourth fold with ethanol, then the concentration of EB was measured with a fluorescent reader (Thermo Fisher Scientific, USA) at 620 nm excitation.
HRP extravasation:
HRP type II (0.5 mg/g body weight, Sigma Aldrich, USA) was dissolved in 0.2 ml PBS and then was injected into tail caudal vein. After circulation of 30 min, mouse brains were dissected to 3-mm slices and were fixed by 4% paraformaldehyde. Followed dehydration by sucrose, brain samples were further sliced into 30 µm-thick coronal sections and were incubated for 10 min at room temperature with DAB solution (Solarbio, China) to visualize the extravasation of HRP.
Transmission electron microscopy (TEM):
TEM were performed as previously described[58]. Briefly, mice brain sections were dehydrated in graded ethanol and embedded in epoxy resin. After cut from the block surface, the ultrathin sections (80 nm) were collected on copper grids, stained with uranyl acetate and Reynold’s lead citrate. A JEM-1400Plus transmission electron microscope (JEOL, Tokyo, Japan) was used to scan BBB ultrastructure.
Western blot:
Western blot was performed as previously described[59]. Briefly, the mice were deeply anesthetized with isoflurane, followed by intracardial perfusion with iced PBS. The peri-hematomal area of ipsilateral hemispheres were collected and frozen with liquid nitrogen, then stored in a -80℃ freezer until use. All collected samples were homogenized in RIPA lysis (Solarbio, China) buffer with a protease inhibitor for 15 min and centrifuged at 12,000 g (4℃, 15 min), followed by supernatant collection. Protein concentration was measured using a BCA assay (Solarbio, China). Equal amounts of proteins were loaded onto SDS-PAGE gels, followed by electrophoresis and transference on PVDF membranes. The PVDF membrane was blocked with 5% nonfat milk (Thermo Fisher Scientific, USA) for 2 h and incubated at 4℃ overnight with the following primary antibodies: anti-Sphk1 (1:1000, cat. #10670-1-AP, proteintech, China), anti-Claudin-5 (1:1000, cat. #34-1600, Thermo Fisher Scientific, USA), anti-Occludin (1:1000, cat. #33-1500, Thermo Fisher Scientific, USA), anti-ZO-1 (1:1000, cat. #40-2200, Thermo Fisher Scientific, USA), anti-Mfsd2a (1:1000, cat. #ab307690, Abcam, USA), anti-Caveolin-1 (1:2000, cat. #3267S, Cell Signaling Technology, USA), anti-Nlrp3 (1:1000, cat. #15101S, Cell Signaling Technology, USA), anti-Gasdermin D (1:1000, cat. #39754S, Cell Signaling Technology, USA), anti-Cleaved Gasdermin D (1:1000, cat. #10137S, Cell Signaling Technology, USA), anti-Caspase-1 (1:1000, cat. #83383S, Cell Signaling Technology, USA), anti-cleaved-Caspase-1 (1:1000, cat. #89332S, Cell Signaling Technology, USA), anti-IL-1β (1:800, cat. #ab283822, Abcam, USA), anti-IL-18 (1:800, cat. #ab240376, Abcam, USA), anti-ERK1/2 (1:1000, cat. #4695S, Cell Signaling Technology, USA), anti-Phospho-ERK1/2 (1:1000, cat. #4370S, Cell Signaling Technology, USA), anti-Akt (1:1000, cat. #9272S, Cell Signaling Technology, USA), anti-Phospho-Akt (1:1000, cat. #4060S, Cell Signaling Technology, USA), anti-SAPK/JNK (1:1000, cat. #9252S, Cell Signaling Technology, USA), anti-Phospho-SAPK/JNK (1:1000, cat. #4668S, Cell Signaling Technology, USA), anti-β-Actin (1:1500, cat. #66009-1-Ig, proteintech, China), anti-GAPDH (1:2000, cat. #60004-1-Ig, proteintech, China). The next day, the species-specific secondary antibodies (1:2000, cat. #7074P2, cat. #7076P2, Cell Signaling Technology, USA) were used to incubate membranes at room temperature for 1 h. An ECL plus chemiluminescence reagent kit (Amersham bioscience, USA) was selected for immunoblots visualization. Image J (NIH, Bethesda, USA) was used to quantify the density of band, and the results were normalized to β-Actin or GAPDH.
Immunofluorescence staining:
Immunofluorescence staining was performed as previously described[60]. Briefly, mice were perfused intracardially with ice-cold PBS, and brain samples were collected and followed by fixation in 4% paraformaldehyde overnight at 4℃ and then dehydrated sequentially by 15% and 30% sucrose solutions. After being frozen in OCT, the brain samples were sliced into 10 µm-thick coronal sections by a freezing microtome (Leica CM 1950, Germany). Followed by washing three times with PBST for 10 min per time, the brain sections were incubated with 5% goat serum at room temperature for 1 h and then incubated at 4℃ overnight with the following primary antibodies: anti-Sphk1 (1:50, cat. #10670-1-AP, proteintech, China), anti-Iba-1 (1:200, cat. #GB15105-100, Servicebio, China), anti-GFAP (1:1000, cat. #PA1-10004, Thermo Fisher Scientific, USA), anti-NeuN (1:500, cat. #94403, Cell Signaling Technology, USA), anti-CD31 (1:500, cat. #MAB1398Z, Merck, Germany), anti-Claudin-5 (1:100, cat. #34-1600, Thermo Fisher Scientific, USA), anti-Occludin (1:100, cat. #33-1500, Thermo Fisher Scientific, USA), anti-ZO-1 (1:100, cat. #21773-1-AP, proteintech, China), anti-Mfsd2a (1:1000, a homemade rabbit polyclonal antibody validated in our previous study)[61], anti-Cavoelin-1 (1:1000, cat. #3267S, Cell Signaling Technology, USA), anti-cleaved-Caspase-1 (1:100, cat. #89332S, Cell Signaling Technology, USA), anti-GSDMD (1:100, cat. #39754S, Cell Signaling Technology, USA). In the following day, the brain slices were incubated with fluorescence-conjugated secondary antibodies (1:500, Jackson Immuno Research, USA) for 1 h at room temperature. Slides were mounted in anti-fade reagent with DAPI (cat. #S2110, Solarbio, China) and imaged with a fluorescence microscope (Zeiss Axio Imager Z2 with Apotome.2).
Enzyme-linked immunosorbent assay (ELISA):
Enzyme-linked immunosorbent assay was performed according to manufacturer’s instructions. Serum from humans and mice were obtained by centrifugation of blood at 4℃ for 20 min, and the supernatant was used for subsequent experiments. The levels of S1P were measured using commercial ELISA kits (cat. #RXJ106471H, Ruixin, China).
Real-time qPCR (RT-qPCR):
Total mRNA was extracted from tissues and cells with the kits according to the manufacturer's instructions (Vazyme, China), followed by cDNA conversion using a high-capacity cDNA reverse transcription kit (Vazyme, China). The mRNA expression of each gene was analyzed by RT-qPCR using SYBR Green Mix (Vazyme, China) and the LightCycler 96 instrument (Roche, Swiss). Data were normalized to internal control gene β-Actin. The following primer sequences were used: Human: SPHK1 forward primer: TCTGCTTGGTCCAATGTGCAA, SPHK1 reverse primer: GGAACAGTTCGTGTCATCCTC. NLRP3 forward primer: GATCTTCGCTGCGATCAACAG, NLRP3 reverse primer: CGTGCATTATCTGAACCCCAC. ACTB forward primer: GCTGCATTTAGTGGCCTCATT, ACTB reverse primer: GCAAGGCATAACCTGATGTGG. Mouse: Sphk1 forward primer: GCAACGTGGAATCACCACTGA, Sphk1 reverse primer: CAGCCAGTAGTCTGTGGACTC. Nlrp3 forward primer: ATTACCCGCCCGAGAAAGG, Nlrp3 reverse primer: TCGCAGCAAAGATCCACACAG. Actb forward primer: ATGACCCAAGCCGAGAAGG, Actb reverse primer: CGGCCAAGTCTTAGAGTTGTTG.
RNA-seq analysis:
Human peri-hematomal brain tissue that was confirmed by computed tomography and intraoperation were used for RNA-sequencing. According to a previous report[62], RNA extraction and quantification were executed, followed by sequencing of the total RNA profile with HiSeq 4000 (Illumina, USA).
Statistical analysis:
Data analysis was employed by GraphPad Prism (Graph Pad Software, USA). All data were expressed as the mean and standard error of the mean (mean ± SEM). Difference significance of two groups was assessed using Student’s t test or non-parametric Mann-Whitney test. For comparisons of three or more groups, one-way ANOVA followed by Tukey’s post hoc test was used to compare the difference significance among multi groups. Statistical significance was defined as p < 0.05.