Study Area
Oyo State is in the South-West geopolitical zone of Nigeria with Ibadan city as the capital. This State has 33 Local Governments Areas (LGAs) and 29 Local Council Development Areas (LCDAs) and a projected population of 9,233,010 with an annual growth rate of 3.4 according to the National Population Commission 2019 report.
Study Location
Human and entomological surveillance took place in 10 high-risk LGAs in Oyo State where confirmed cases of an arboviral or viral haemorhagic infection(s) had been reported by researchers, the State Ministry of Health and the Nigerian Centre for Disease Control (NCDC).
Study Design
This was a cross sectional study that involved human and entomological surveillance for DENV. The duration of study for human sampling was Jan 2022 to April 2023 while the entomological surveillance took place from April 2022 to April 2023.
Population of the Study
The study population were drawn from febrile in and out-patients attending selected healthcare facilities in the selected LGAs based on case definitions for DF which asserts that a DF suspected case is “anybody with acute febrile illness of 2-7 days duration with at least one or more of the following symptoms: headache, myalgia, arthralgia, rash, vomiting, anorexia, haemorhhagic manifestations and, leucopenia. Febrile patients with confirmed diagnosis of other infections and those outside study areas and non-consenting patients were excluded from the study.
Sampling Techniques
A purposive sampling technique was used in the enrollment of study participants for this study.
This involves active case search in communities and health facilities involving house-to-house case finding, health facilities records, etc.
Data Collection Techniques
A quantitative approach using structured tools was adopted for data collection. Semi-structured interviewer-administered questionnaires were used to obtain information from selected consenting participants
Sample Collection, Transportation, and Storage
Five (5) mls of whole blood was aseptically collected via venipuncture into Ethylene Diamine Tetraacetic Acid (EDTA) anticoagulant bottle and transported from the field to the laboratory using a triple packaging system in a geostyle at +20C to 40C. The samples were centrifuged for 5mins at 3000 rpm to obtain the plasma which was aliquoted into two parts for serology and molecular testing and then stored frozen at -200C.
Laboratory analysis
All laboratory processes were performed at the Center for Human Virology and Genomics, Nigerian Institute of Medical Research (NIMR), Yaba, Lagos, Nigeria.
RNA Extraction Process: Following manufacturer’sinstructions, RNA was extracted from human plasma and mosquitoes (mechanically crushed) using Jena Bioscience Viral DNA+RNA purification Kit (Jena, Germany).Extracted RNAs were Stored at -20oC for further processing.
Real-Time PCR Analysis: One-step reverse transcriptase (RT) real-time (qPCR) was carried out to detect the pathogen using Quant Studio5 machine. The amplification steps encompass denaturation, primer annealing and elongation. Optimization of the PCR conditions was done for optimum amplification of the genes. Positive and negative controls were set up and run along with the test.
PCR Mix Components: The PCR mix was made up of 25µl containing 10 µl enzyme mix, 0.8µl of forward and reverse primers; 0.4 µl for probes, 6 µl of nuclease free water and 5 µl of RNA template was set up. A Ctvalue of <38 was adjudged to be positive for viral pathogen.
Cycling Conditions: Initial denaturation at 94˚C for 5mins, then by 36 cycles of denaturation at 94˚C for 30 sec, annealing at 55˚C for 30 secs and elongation at 72˚C for 45 sec. Followed by a final elongation step at 72˚C for 7 minutes and hold temperature at 10 ˚C.
Primer and Probe used for the Detection of DENV
Forward AAACCGCGTGTCGACTGTGC
Reverse TAGGAAACGAAGGAATGCCACC
Probe FAM-5’CACTTGGAATGCTGCAGGGACGAGGACC
Serological analysis
A one-step lateral flow immunoassay cassette test kit from Zijian Biotechnology, Shenzhen, China was used following manufacturers instruction for detection of Dengue Virus specific IgG and IgM while ReLASV® Pan-Lassa NP IgG ELISA Kit (Human anti-LASV NP Antibody) was used for detection of IgM antibodies against LASV for samples found positive to DENV Ig M.
Entomological Surveillance
Vector Trapping, Identification, Transportation and Processing
Two entomological approaches were employed in the survey: Larval/Pupae survey and use of Biogents Sentinel Trap (BG Trap) for adult mosquito. The sampling of mosquitoes broadly targets Aedes species as studies have implicated its role in the transmission of a variety of viruses9.
Mosquito Identification and Preservation
Adult mosquitoes collected in the field and those reared to adults from immature collections were killed by freezing at -20º C for 20 min. The specimens were morphologically identified to species level using appropriate taxonomic keys, they were sorted out and identified by morphological characteristics with the key aids of Leopoldo M. Rueda9. They were later counted, recorded and introduced into well-labeled Eppendorf tubes containing RNA later(shield) and then stored frozen at -200C.
Data Management and Analysis
Data was analyzed using Epi info Statistical package Version 7.0 and Microsoft Excel. Quantitative data was presented using tables and charts. Correlation analysis was used to test the association between Dengue Fever, Aedes mosquito vector abundance, and environmental factors (temperature, rainfall, and relative humidity).
Ethical Considerations
Ethical approval was obtained from the Institutional Review Board (IRB) of the Nigerian Institute of Medical Research (NIMR) IRB-19-006. Further permission was obtained from the Oyo State Ministry of Health Department of Public Health (SMOH/EPID/016/005) and the various officer-in -charge in the health care facilities before the commencement of the study. Informed consent was obtained from study participants.