General Worm Maintenance
All strains were cultured using standard methods66. For all experiments, worms were maintained at 20°C on plates made from nematode growth medium (NGM: 3 g/L NaCl, 2.5 g/L Bacto-peptone, 17 g/L Bacto-agar in distilled water, with 1 mL/L cholesterol (5 mg/mL in ethanol), 1 mL/L 1M CaCl2, 1 mL/L 1M MgSO4, and 25 mL/L 1M potassium phosphate buffer (pH 6.0) added to molten agar after autoclaving) or high growth medium (HGM: NGM recipe modified as follows: 20 g/L Bacto-peptone, 30 g/L Bacto-agar, and 4 mL/L cholesterol (5 mg/mL in ethanol); all other components same as NGM), with OP50 E. coli for ad libitum feeding. To synchronize experimental animals, eggs were collected from gravid hermaphrodites by exposing the animals to an alkaline-bleach solution (e.g., 1.5 ml sodium hypochlorite, 0.5 mL 5 N KOH, 8.0 mL water), followed by repeated washing of collected eggs in M9 buffer ((6 g/L Na2HPO4, 3 g/L KH2PO4, 5 g/L NaCl and 1 mL/L 1M MgSO4 in distilled water).
C. elegans Strains
Wild-type: (N2 Bristol); The AID strains: MQD2356 (unc-119(ed3); hqKi373 [Prgef-1::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III), MQD2474(unc-119(ed3); ieSi61 [Pges-1::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2 (hqKi363[daf-2::degron::mNeonGreen]) III), MQD2383 (unc-119(ed3); hqKi378 [Plim-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III), MQD2375 (unc-119(ed3); daf-2(hqKi363[daf-2::degron::mNeonGreen]) III;ieSi38 [Psun-1::TIR1::mRuby::sun-1 3’UTR, cb-unc-119(+)] IV), MQD2378 (unc-119(ed3); hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III), and MQD2379 (unc-119(ed3); hqKi375 [Pmyo-3::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III) were described previously. Strain: IG1846 (frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV) was obtained from the Caenorhabditis Genetics Center (University of Minnesota, Minneapolis, MN). Mutant: CB1370 (daf-2(e1370) III), Strains:, HA2160 (rtEx721[flp-18p::lin-12(RNAi) myo-2p::gfp]; glp-1(bn18)III), and HA1931 (rtEx635[che-2p::glp-1(RNAi), myo-2p::gfp pha-1(+)]; pha(e2123)III) were kind gifts from A. Hart (Brown University, Providence, RI, USA). Stains: CQ721 (hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II; wqEx76 [Ptwk-3::sense:lin-12, Ptwk-3::antisense:lin-12 + Pmyo-2::GFP]), CQ723 (hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II; wqEx77 [Pttx-3::sense:lin-12, Pttx-3::antisense:lin-12 + Pmyo-2::GFP]) and CQ801 (osm-11p::GFP;osm-11p::osm-11::unc54 3’UTR) were made in this study.
The following strains were generated by crosses: CQ761 (hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3'UTR + Cb-unc-119(+)] II; crh-1(n3315); daf-2(hqKi363[daf-2::degron::mNeonGreen]) III) was generated by crossing MQD2378 (unc-119(ed3); hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;
daf-2(hqKi363[daf-2::degron::mNeonGreen]) III) with MT9973 (crh-1(n3315)), CQ796 (hqKi373 [Prgef-1::TIR1::mRuby::unc-54 3' UTR + Cb-unc-119(+)] II; crh-1(n3315); daf-2(hqKi363[daf-2::degron::mNeonGreen]) III) was generated by crossing MQD2356 (unc-119(ed3); hqKi373 [Prgef-1::TIR1::mRuby::unc-54 3' UTR + Cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III) with MT9973 (crh-1(n3315)), CQ683 (hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III; rtEx721[flp-18p::lin-12(RNAi) myo-2p::gfp]) was generated by crossing MQD2378 (unc-119(ed3); hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III) with HA2160 (rtEx721[flp-18p::lin-12(RNAi) myo-2p::gfp]; glp-1(bn18)III), CQ685 (hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III; rtEx635[che-2p::glp-1(RNAi), myo-2p::gfp pha-1(+)]) was generated by crossing MQD2378 (unc-119(ed3); hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III) with HA1931 (rtEx635[che-2p::glp-1(RNAi), myo-2p::gfp pha-1(+)]; pha(e2123)III). CQ756 (wqIs6 [Prgef-1::GFP-his-58] hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3'UTR + Cb-unc-119(+)] II; daf-2(hqKi363[daf-2::degron::mNeonGreen]) III) was generated by crossing MQD2378 (unc-119(ed3); hqKi374 [Pdpy-7::TIR1::mRuby::unc-54 3’UTR, cb-unc-119(+)] II;daf-2(hqKi363[daf-2::degron::mNeonGreen]) III) with CQ713 (wqIs6 [Prgef-1::GFP-his-58]). CQ800 (daf-2(e1370);crh-1(n3315)) were generated by crossing CQ695 (daf-2(e1370)) with MT9973 (crh-1(n3315).
Sequences of the primers used for constructing transgenes that knockdown lin-12 in AIY, RIG, or RIM and AVA interneurons.
Three promoters were used to drive the sense and antisense expression of lin-12 RNA: pttx-3 (AIY interneurons), ptwk-3 (RIG interneurons), and pnmr-1 (RIM and AVA interneurons).
For the ttx-3 promoter, a 3.1 kb fragment upstream of the ATG and the first two exons and introns were amplified using the following primers:
ttx-3 Pf = tcatgcatattcgattttttcagtaaacg ttx-3 Pr = tttgacaccgaagacaattattatg
For the twk-3 promoter, a 149 bp fragment upstream of the ATG was amplified using the following primers:
twk-3 Pf = tacgccatccaattagtattttatgtctg twk-3 Pr = ttttaagaagaacaaggaaaaagttgaag
For the nmr-1 promoter, a 5 kb fragment upstream of the ATG was amplified using the following primers:
nmr-1 Pf = gatgattatggaaccaaactcagaatttaatg nmr-1 Pr= atctgtaacaaaactaaagtttgtcgtg
Because these promoters were used to drive transcription of lin-12 gene, all three Pr of primers had 25 additional nucleotides complementary to either the sensed strand or the antisense strand of lin-12 gene.
3.8 kb of the target gene lin-12 was amplified from the strain HA2160 using the following primers:
Pf = atgcggatccctacgatttg Pr = acactagccccttgctgaatc
The fragments for twk-3p- or ttx-3p-driven the sense and antisense expression of lin-12 RNA were injected at 100 ng/ul each with 2 ng/ul myo-2p::GFP marker at a total volume of 20 ul. The fragments for nmr-1p-driven the sense and antisense expression of lin-12 RNA were injected at 75 ng/ul each with 2 ng/ul myo-2p::GFP marker and 1 kb DNA ladder to bring up to 100 ng/ul at a total volume of 20 ul.
CQ801 was generated by co-injection at 10ng/ul of the plasmid containing genomic of the osm-11 gene with unc-54 3’UTR expressed under the control of 2.5 kb of upstream genomic DNA sequences and the plasmid containing GFP with unc-54 3’UTR expressed under the control of 2.5 kb of upstream genomic DNA sequences.
Auxin treatment
For auxin experiments, the standard HGM molten agar was supplemented with 2.5 mL 400 mM indole-3-acetic acid (IAA): Alfa Aesar (#A10556) freshly prepared in ethanol and plates were seeded with E. coli for ad libitum feeding. Synchronized AID worms were transferred to HGM with auxin plates for 16-20 hours before behavior assay. For mid-life experiments, worms were transferred at the L4 larval stage onto HGM plates supplemented with 500 ml/L 0.1 M FUDR (5-Fluoro2’-deoxyuridine) for a final concentration of 0.05M FUDR and were transferred back to standard HGM with or without auxin 20 hours before memory assay.
RNAi treatment
For RNAi experiments, the standard HGM molten agar was supplemented with 1 mL/L 1 M IPTG (isopropyl b-d-1-thiogalactopyranoside) and 1 mL/L 100 mg/mL carbenicillin, and plates were seeded with HT115 E. coli for ad libitum feeding. All RNAi treatment starts from L4 larval stage and lasts for 3 days. RNAi experiments were performed using the standard feeding RNAi method. Bacterial clones expressing the control construct (empty vector, pL4440). All RNAi clones were sequenced prior to use.
Pavlovian Appetitive Associative Assay
Animals were trained and tested for short-term memory as previously described4. Briefly, synchronized young or aged adult hermaphrodites were washed from HGM, RNAi or HGM supplemented with auxin plates with M9 buffer, allowed to settle by gravity, and repeatedly washed three more times with M9 buffer. Then animals were starved for 1 hr in M9 buffer. For conditioning (food and 10% 2-butanone pairing), worms were then transferred to 10 cm NGM conditioning plates (seeded with OP50 E. coli bacteria and with 18 mL 10% 2-butanone (Acros Organics) dissolved in ethanol on the lid) for 1 hr at 20°C. After conditioning, the trained worms were tested for chemotaxis towards 10% butanone vs. an ethanol control either immediately (0 hr) or after being transferred to 10 cm NGM holding plates with fresh OP50 E. coli bacteria for specified time intervals (30 min-2 hr).
Chemotaxis indices were calculated as follows:
The calculation for the learning Index is:
Learning indices for extrachromosomal transgenic strains were analyzed by hand counting GFP positive and negative worms at different locations at individual timepoint on the chemotaxis plates. Control animals for these experiments were the transgenic worms’ GFP-negative siblings.
Chemotaxis Assay
Synchronized adult worms were tested for chemotaxis to 1% benzaldehyde in ethanol or 10% pyrazine in ethanol, using standard, previously described chemotaxis assay conditions 67.
DiI staining
Worms were grown on regular seeded HGMs until Day 2 adults (for young worms DiI staining), or until L4 and transferred to HGMs supplemented with FUDR to Day 4 and then transferred to regular HGMs until Day 5 (for older worms DiI staining). On the day for imaging, well-fed worms were washed 3 times by M9, and then resuspended in 1ml M9 with 5 ul DiI stock solution (2mg/ml DiI (Molecular Probes, catalog # D-282) in dimethyl formamide) for 3 hours on a slow shaker at room temperature. Then the worms were washed with M9 twice before transferring them onto agar pads with sodium azide to visualize by Nikon Eclipse Ti microscope. Z-stack multi-channel (DIC, mCherry/RFP and GFP) images of Day 2 or 5 adult worms were acquired at 60X magnification.
Imaging
Worms were treated with 1 mM auxin for 24 hours starting from late L4 stage at 20 °C. Confocal images were captured by the spinning-disk microscope (UltraVIEW VOX; PerkinElmer) equipped with a 60×, 1.4 numerical aperture oil-immersion objective. Images were viewed and processed using Volocity software (PerkinElmer).
RNA isolation
Synchronized Day 2 adult worms were collected in M9 and washed repeatedly 3 times to remove excess bacteria. Worm pellets were crushed in liquid nitrogen and transferred to 850 uL Trizol LS. Total RNA was extracted using the standard Trizol/chloroform/isopropanol method followed by DNase digestion and Qiagen RNeasy Mini kit. Agilent Bioanalyzer RNA Pico chips were used to assess the quality and quantity of isolated RNA. mRNA libraries were prepared using the RNA-Seq directional library prep on Apollo 324 robot and were sequenced (65-nt paired-end) on the Illumina Novaseq S1 100nt flowcell v1.5 platform (yields ~1.3-1.6 B reads).
RNA-seq data analysis
RNA sequencing analysis was performed as previously described. FASTQC was used to assess read quality scores. The universal Illumina adaptor sequences were trimmed using Cutadapt v1.6 (Martin, 2011). The trimmed reads were mapped to the C. elegans genome (UCSC Feb 2013, ce11/ws245) using STAR (Dobin et al., 2013). The reads aligning to individual genes were counted using htseq-counts (mode: union), and DESeq2 was used for differential expression analysis. Genes with an adjusted p-value 0.05 were considered significantly differentially expressed.
Tissue Query
worm.princeton.edu was used for tissue query from upregulated or downregulated gene lists (DESeq2 genes FDR < 1%).
Secreted Protein Prediction
SignalP-5.0 (DTU Health Tech) was used for secreted protein prediction from 75 genes exclusively expressed in the hypodermis.
Neuronal nuclei isolation
C. elegans neuronal nuclei were isolated using the following methods, modified from the mammalian single nucleus RNA-seq protocol from 10X Genomics. Worms (CQ756) grew on regular HG until Day 1 and were trasnfered to HG or HG + auxin plates on Day 1. Then, ~400 μL of Day 2 worms CQ756 were washed from HG or HG + auxin plates. Samples were washed 3x in M9 buffer and worm pellets were kept on ice until douncing. The 400 μL worm pellet was transferred to a 1 mL dounce homogenizer (Kimble Glass Tissue Homogenizer, 88 mm overall length, Dounce 1 mL working capacity; Cat # 885300-0001) filled with 300 μL of NP40 lysis buffer (10 mM Tris-HCl (Sigma-Aldrich, Cat. # T2194; pH 7.4), 10 mM NaCl (Sigma-Aldrich, Cat. # 59222C; 5M), 3 mM MgCl2 (Sigma-Aldrich, Cat. # M1028; 1M), 0.05% Nonidet P40 Substitute (Sigma-Aldrich, Cat. # 74385), 1 mM DTT (Sigma-Aldrich, Cat. # 646563), 1 U/μL RNase inhibitor (Sigma Protector RNase inhibitor; Sigma-Aldrich, Cat. # 3335402001), Nuclease-free water). Each sample was dounce homogenized 25-35x, using only the tight pestle. After 15 strokes, the degree of lysis was examined every five strokes, until appropriate lysis was achieved (no intact worms, with small worm fragments and pieces of empty cuticle present). Samples were moved to 2 mL low bind microcentrifuge tubes and dounce homogenizers were rinsed with 1 mL of NP40 lysis buffer; this rinse was added to the tubes. Samples were then incubated for 5 min on ice and pipetted twice after 2 min and 4 min, 10x each, with a P200 pipette. Suspensions were passed through a 40 μm filter into a 15 mL conical tube (each filter was rinsed with an additional 250 μL of lysis buffer), and then transferred to a 2 mL low bind microcentrifuge tube. Samples were centrifuged at 1000g for 5 min at 4°C. The supernatant was removed, leaving ~100 μL behind, and 1 mL of wash buffer (PBS + 0.5% BSA (Miltenyi Biotec, Cat. # 130-091-376) + 1 U/uL of RNAase inhibitor) was added with no mixing for 5 min on ice. After 5 min, the pellet was resuspended by mixing 3x with a P1000. Samples were centrifuged again at 1000g for 5 min at 4°C. The supernatant was removed, leaving ~100 μL behind, and the pellet was then resuspended in 500 μL of wash buffer. Hoechst stain (1:10,000 dilution; Molecular Probes Hoechst 33342, Thermo Fisher, Cat. # H3570) was added to each sample, and samples were then passed through 5 μm syringe filters (pre-wetted with 500 μL of wash buffer) using a 1 mL syringe, directly into FACS tubes. Samples were incubated for at least 5 min on ice prior to FACS.
FACS
Hoechst and GFP+ nuclei were sorted using a 70 μm nozzle and a flow rate of 3 on a BD Biosciences FACSAria Fusion sorter into a 1.5 mL low bind microcentrifuge tube containing collection buffer (500 μL of 0.5% BSA + 1U/μL RNase Inhibitor). The instrument was washed with bleach between samples. 150,000- 200,000 nuclei per sample were sorted for further analysis.
snRNA-seq library preparation and sequencing
After FACS, samples were centrifuged at 1000g for 5 min at 4°C. The supernatant was removed and nuclei were resuspended in 20 μL of collection buffer. The total number of nuclei for each sample was estimated (~3/4 loss) and single nuclei suspension samples were loaded to the 10X Genomics Chromium X system using the Single Cell 3’ v3.1 Reagent Kits (10X Genomics Inc., CA) to generate and amplify cDNA. The amplified cDNA samples were purified with Ampure XP magnetic beads (Beckman Coulter, CA), quantified by Qubit fluorometer (Invitrogen, CA), and examined on Bioanalyzer with High Sensitivity DNA chips (Agilent, CA) for size distribution. Illumina sequencing libraries were generated from the amplified cDNA samples using the Illumina Tagment DNA Enzyme and Buffer kit (Illumina, CA). These libraries were examined by Qubit and Bioanalyzer, then pooled at equal molar amount and sequenced on Illumina NovaSeq 6000 S Prime flowcells as 28+94 nt pair-end reads following the standard protocol. Raw sequencing reads were filtered by Illumina NovaSeq Control Software and only the Pass-Filter (PF) reads were used for further analysis.
Alignment and Quality control of data
Alignment of reads was performed using CellRanger version 7.1.0. SoupX was used to remove ambient RNA contamination on the Cell Ranger output files. To subset the data that represent broken or damaged nuclei, doublets, or empty droplets, we set cutoffs by checking Violin Plots of genes per cell: the lower bound was 150-210 features/cell for each sample and the higher bound was between 750 and 1000 features/cell depending on the sample.
Normalization, Integration, and Clustering
In Seurat, we used the single cell pipeline, where single cell transform (SCT) was used for normalization. Different numbers of PCs: 80, 90, 100, 110, 120, 125, 130, 150, 200, and different resolutions: 0.8, 0.9, 1.0, and 1.2. 125 PCs at a clustering resolution of 1 was used, which resulted in 106 clusters in our dataset.
Cluster Labeling/ Cell Type Analysis
We performed cluster annotation using a combination of a hypergeometric test and AUCell algorithm as described previously68.
Differentially-expressed gene identification
FindMarkers function was used in the Seurat package for differential expression identification. Wilcoxon Rank Sum Test method was performed on each subsetted cluster, comparing auxin (-) cells and auxin (+) cells within the same cluster. Genes with a minimum percentage of expression in 25% of the cells were analyzed, and the significantly differentially expressed genes were identified if their log2(fold-change) > 0.1 or < -0.1, and adjusted p-value < 0.05. The genes significantly differentially expressed in at least one cluster are considered differentially expressed.
GSEA
For calculating GSEA for KEGG pathways, we downloaded the KEGG pathways from Worm Enrichr69. We generated a ranked list of the differentially expressed genes in each cluster according to their log2(fold-change) and applied GSEA on the ranked lists using the fgsea package in R70. The minimum size of the gene set to test is 2 and the maximum size is 500. Then, we plotted the normalized enrichment score for each pathway in the heatmap.
For calculating GSEA for CREB-LTAM or GNAQ induced genes, we downloaded the CREB-LTAM or GNAQ induced genes12,16. We generated a ranked list of the differentially expressed genes in each neuron according to their log2(fold-change) and applied GSEA on the ranked lists using the fgsea package in R70. The minimum size of the gene set to test is 2 and the maximum size is 500. Then, we plotted the normalized enrichment score for each pathway in the heatmap.
QUANTIFICATION AND STATISTICAL ANALYSIS
Two-way ANOVA with Tukey post hoc tests was used to compare learning indices among multiple groups. one-way ANOVA analysis of variances followed by Bonferroni post hoc tests for multiple comparisons was performed. Two-way ANOVAs were used between genotype (daf-2(e1370) and wild-type, control RNAi and daf-2 RNAi, control and osm-11 overexpression, hypodermal DAF-2 AID and hypodermal DAF-2 AID;crh-1(3315)) and different timepoint (0 hr, 0.5 hr, 1 hr, 2 hr, 3 hr, 4 hr, 5 hr, and 6 hr) on learning indices with a significant interaction between factors leading to the performance of Bonferroni post hoc comparisons to determine differences between individual groups. Experiments were repeated on separate days, using separate independent populations, to confirm that results were reproducible. Prism 9 software was used for all statistical analyses. Software and statistical details used for RNA sequencing analyses are described in the method details section of the STAR Methods. Additional statistical details of experiments, including sample size (with n representing the number of chemotaxis assays performed for behavior, RNA collections for RNA-seq, and the number of worms for microscopy), can be found in the figure legends.