This study evaluated the potential accumulation of lipid of isolated Yeast from soil sample by using Synthetic dairy wastewater as a renewable feedstock for biodiesel production. on the basis of their lipid accumulation five oleaginous Yeast (i.e.Y1, Y2, Y5, Y6, Y7) were screened (lipid content >20%) and the productivity on a Yeast Peptone medium. The effect on capacity of lipid accumulation by different carbon sources (i.e. Galactose, Glucose, Starch, Sucrose and Cellulose) of the Yeast isolates was evaluated. The Y1 oleaginous yeast which shows closet relation to Pseudozyma genus could accumulate (54%) lipid, biomass production (2.47g/l) using Glucose and galactose as a source of carbon. Furthermore, the Y1 yeast strains demonstrated effective utilization of dairy wastewater, resulting in a substantial reduction (~50%) in Chemical Oxygen Demand (COD), along with notable lipid accumulation (49.8%) and biomass production (1.5 g/l). The lipids produced by Yeast Y1 had the presence of various fatty acid i.e. oleic acid, alpha linolenic acid etc., and presence of high percent of saturated fatty acid over total fatty acid as visually confirmed by Nile red staining and chemical characterized by nuclear magnetic resonance (NMR) spectroscopy. NMR analysis indicated that the lipids extracted from Yeast Y1 were suitable for biodiesel applications. Overall, the findings of this study underscore the potential of leveraging dairy wastewater as a cost-effective and efficient resource for biodiesel production using oleaginous yeast. This approach not only addresses contemporary concerns regarding fuel shortages, food security and climate change but also contributes to the sustainable management of wastewater resources.
Research Article
Valorization of Dairy Wastewater into microbial lipid by an oleaginous yeast Pseudozymasp. for Sustainable Biodiesel Production
https://doi.org/10.21203/rs.3.rs-4501191/v1
This work is licensed under a CC BY 4.0 License
You are reading this latest preprint version
Oleaginous Yeast
Lipid
Dairy wastewater
COD
The rapid growth of population all over the world increases environmental concern over fossil fuels. The rapid depletion of non-renewable fuel reserves their rising cost and the detrimental effect on the environment and climatic change have strongly prompted the researchers to find suitable renewable fuel sources [2]. India is well known for its extensive agricultural activities, with a significant portion of its population relying on agriculture as a primary source of income, making a crucial contribution to the country's economy. The increasing population has led to higher demand for both food and fuel, resulting in intensified agricultural practices. Consequently, this has resulted to a significant increase in waste generation and the depletion of natural resources. This waste includes agricultural residue, forest residue, farm animal manure, fruit and vegetable residue, Dairy waste, organic industrial waste, and various crops [57].
Biodiesel is produced by a process called transesterification. It involves using different vegetable oils or fats along with specific reaction catalysts and short-chain alcohols [5, 6]. The current materials used for making biodiesel, mainly derived from plants like soybean and vegetable oil, make up over 75% of the total cost [7]. This makes biodiesel more expensive compared to regular fuels [7]. Moreover, the biodiesel industry competes heavily with the food industry for oil crops and land suitable for farming [8]. To tackle these challenges, there's a potential solution using microbial lipids, known as single cell oils (SCO), obtained from cultivating microalgae [9], oleaginous yeast, and fungi [10, 11]. These can substitute vegetable oils in biodiesel production. Biomass based lipids obtained from oleaginous microorganism could be potentially an alternative and attractive source for biodiesel production [1] due to several benefits like being less toxic, working well with current diesel and producing fewer emission, it’s seen as a great option [2, 3]. Additionally, its impressive lubricating properties and the ability to match the energy levels of regular fuels make it remarkable [4]. In addition to its advantages, biodiesel also has limitations such as poor performance at low temperatures, high density, high viscosity and low volatility. Biodiesel is primarily composed of fatty acids [37, 38, 39, 40], which can be classified based on their chemical bonds as either unsaturated or saturated. The specific composition of these fatty acids varies depending on the source material, such as coconut oil or Pongamia oil, leading to differences in the properties of the resulting biodiesel [41, 42, 43]. The structure of these fatty compounds affects important biodiesel properties such as density, calorific value, cetane number and performance at low temperatures. Consequently, there is a need for standardization of the chemical and physical properties of biodiesel before it can be widely used commercially. Unsaturated fatty acids, while beneficial in some aspects, tend to have poor oxidative stability and produce more nitrogen oxide emissions compared to saturated fatty acids [44, 45, 46]. On the other hand, saturated fatty acids may exhibit poorer performance at low temperatures but have lower nitrogen oxide emissions and better oxidative stability. Due to increasingly stringent emission regulations, there is growing interest in biodiesel derived from saturated fatty acids [47, 48, 49, 50]. Some scientific studies suggest that increasing the saturation of fatty acids in biodiesel can lead to reduced greenhouse gas emissions, higher cetane numbers, improved combustion properties, and greater fuel efficiency. Recent research also indicates that higher levels of saturated fatty acids can improve biodiesel properties by reducing density and viscosity. Accurate measurement of density and viscosity is crucial for ensuring the quality of biodiesel [51, 52].
Single cell oil (SCO) is typically obtained from lipid producing microorganisms such as molds, bacteria, microalgae and yeast [12]. Among these, yeasts have attracted significant attention due to their high cell density, rapid growth, and store up to 70% of lipids [13, 16] devoid of endotoxins [32], and suitability for large-scale fermentation [31]. Oleaginous yeast cells accumulate lipids, primarily triacylglycerols (TAGs), in response to environmental stresses like nitrogen limitation, high carbon availability, or osmotic stress. They can utilize diverse carbon sources such as glucose, xylose, glycerol, and lignocellulosic hydrolysates, making them attractive for biodiesel production using low-cost renewable feedstocks. Cultivation methods include batch, fed-batch, and continuous cultures, with optimization of fermentation conditions like pH, temperature, aeration, and nutrient supplementation being crucial for maximizing lipid production. Notably, the lipids found within these yeasts consist predominantly of long-chain fatty acids (C16-C18), making them highly attractive for biodiesel production [32]. In this study, we present findings on a lipid-rich yeast strain, Y1, belonging to the Pseudozyma genus. This strain demonstrates notable proficiency in utilizing dairy wastewater, converting it into microbial lipid. It falls under the category of an anamorphic basidiomycetous yeast within the Ustilagomycetes class, which also encompasses Ustilago maydis the smut fungus [77]. Currently, the Pseudozyma genus comprises 15 recognized species, including P. shanxiensis P. antarctica, P. aphids, P. fusiformata, P. tsukubaensis, P. graminicola, P. jejuensis, P. hubeiensis, P. thailandica, P. parantarctica, Pseudozyma abaconensis, P. prolifica, P. pruni, P. rugulosa and P. flocculosa [78, 80]. However, this number continues to grow [78, 79, 84]. The taxonomy of the genus Pseudozyma is complex, as its species are distributed among various teleomorphic genera within the Ustilaginales order. These species occupy different clades, including those defined as Sporisorium, Ustilago–Sporisorium and Ustilago sensu lato clades by previous researchers [81, 82]. Research findings indicate that Pseudozyma parantarctica strain CHC28 demonstrates notable potential as an oleaginous yeast strain for the production of microbial oil. This strain exhibits a commendable ability to generate intracellular oil at a high rate. Moreover, the fatty composition of the crude oil produced by this yeast closely resembles that of conventional oils utilized in biodiesel manufacturing [85]. The lipids produced by Pseudozyma strains exhibit a fatty acid composition similar to that of vegetable oils, rendering them suitable for biodiesel production [84]. Beyond fuel production they hold significant potential for biosurfactant production., yeast-derived SCO finds use in making various products like detergents, soaps, paints, lubricants and additives in the food and cosmetic industries. There's also potential for it to serve as an edible oil source [14]. Moreover, these yeasts can produce substantial amounts of carbohydrates, proteins and other nutrients, enhancing their industrial significance [15]. However, the challenge lies in the cost and availability of nutrients for sustaining continuous yeast cultivation, posing a barrier to widespread commercial use. In addition, certain species possess the capability to produce and retain significant quantities of proteins, carbohydrates, and various nutrients, thereby enhancing their value for industrial purposes. However, the challenge of commercializing and implementing large-scale applications has historically revolved around the cost and availability of substrates rich in essential nutrients required for continuous yeast cultivation [73].
In recent times, the proliferation of wastewater treatment plants has been notable due to factors such as industrial expansion and urban growth [74]. The dairy industry produces a lot of wastewaters known as dairy wastewater (DW) due to various processes like pasteurization, homogenization, and dairy product manufacturing, as well as cleaning operations. This wastewater contains a high amount of organic matter and nutrients such as lactose, protein, oil, sugars, and salts from milk. DW typically has high levels of biochemical oxygen demand (BOD) from 45 to 49,000 mg/L of range and chemical oxygen demand (COD) from 2500 to 20,210 mg/L of range. It also contains nutrients that can lead to eutrophication. Discharging untreated DW into water bodies has serious environmental consequences, including contamination of aquatic ecosystems and potential harm to human health [34]. It represents a cost-effective and environmentally sustainable raw material for large-scale biodiesel production, following appropriate pre-treatment procedures [75]. Certain species of oleaginous yeast demonstrate the capacity to effectively utilize such resources by producing the necessary hydrolytic enzymes [76].
Integrating valorization and biorefinery processes into bioremediation presents a multifaceted solution to environmental pollution while advancing the principles of a circular economy [65]. By leveraging biological agents to remediate contaminants and extracting value from biomass, this approach not only cleans up polluted sites but also generates valuable products, reducing waste and promoting resource efficiency exemplifies the concept of "waste to wealth" by transforming contaminated biomass into valuable products such as biofuels, biochemicals, or materials [58]. This infusion of value not only makes these formerly discarded materials economically viable but also opens up new revenue streams and economic opportunities. Moreover, by adhering to circular economy principles, this integrated approach ensures that resources are utilized efficiently and sustainably, reducing reliance on raw material extraction and minimizing waste disposal. Consequently, environmental benefits such as pollution reduction, energy conservation, and greenhouse gas emission mitigation are realized. Through the synergistic integration of bioremediation, valorization, and biorefinery technologies, economic viability, environmental sustainability, and technological innovation are all achieved. This holistic approach holds immense promise for addressing environmental challenges while fostering a more sustainable and circular future [66].
In this study, yeast with high lipid accumulation capacity were isolated and screened from oil contaminated soil sample. The characterization of oleaginous yeast was performed using molecular techniques. The production of lipid was studied by valorization of dairy wastewater as a feedstock using screened oleaginous yeast. The optimization of different operating parameters influencing the lipid production by oleaginous yeast like effect of carbon source, effect of the duration of incubation on lipid production, COD reduction and sugar utilization. The produced lipids were characterized as alternative low-cost substrate of biodiesel for their potential application. According to the performed literature review (using Scopus till 2024), this is the first report on the isolation of oleaginous Yeast closely related to Pseudozyma thailandica CBS 10006 (accession number: NG 063041) and Pseudozyma pruni CBS 10937 (accession number: NG 063040) from oil contaminated soil sample and to study its growth and lipid production for biodiesel synthesis by utilizing dairy wastewater.
2.1. Isolation and screening
2.1.1. Isolation of lipid producing yeast strain
To isolate lipid-producing yeast, we collected soil samples from an area near the petrol pump close to NIT Warangal, Hanamkonda, Telangana, India, which were then stored at 4°C. The isolation process involved serial dilution of the soil sample until a 10− 9dilution was achieved. Subsequently, spread plates were prepared using YPD agar medium. From these plates, we selected five different colonies (Y1, Y2, Y5, Y6, Y7) based on their distinct yeast morphology. These selected colonies were streaked onto separate agar plates of YPD and incubated at 29°C for 72 hours to obtain pure cultures. The pure colonies obtained were preserved in glycerol stock at -20°C for future use. All the isolated yeast strains were then evaluated for their capacity to produce lipids by incubating them at 29°C for 48 hours in YPD broth medium. Following the stationary phase, each isolate's culture was assessed for both cell biomass and lipid content, utilizing the method outlined by Yanh et al. [1]. The yeast strain demonstrating the highest lipid accumulation was chosen for further investigation.
2.1.2. Screening of yeast for lipid production
In this experiment, 100 milliliters of each medium were placed in a 250-milliliter Erlenmeyer flask and sterilized at 121°C by autoclaving for 15 minutes with 15 psi pressure. Subsequently, 5% (v/v) of a seed culture was added to each flask, and they were then placed in an orbital shaker incubator set at 27 ± 2°C with a pH maintained at 6.5 ± 0.2. The flasks were continuously stirred at a speed of 190 revolutions per minute (rpm) for 48 hours until the stationary phase was reached. At intervals of every 12 hours, 1 milliliter of culture was extracted from each flask to determine the specific growth rate by measuring the optical density (OD) at 595 nanometers using a spectrophotometer. These measured values were plotted against their respective time points to assess the growth kinetics. The specific growth rate (µ), as described by [17], was calculated using the formula:
µ = ln (ODt2 - ODt1 / t2 - t1)
Where ODt1 and ODt2 represent the optical densities at the initial (t1) and final (t2) points of the exponential growth phase, respectively.2.1.1.
2.1.2.1. Nile red staining
Lipid accumulations in the isolated oleaginous yeast were visually confirmed by fluorescent microscopy using 96 well plate Nile red staining [18, 20]. Firstly, a Nile red working solution was prepared by diluting a 2 mg/mL stock solution, which was stored at 4°C in the dark (Nile red sensitivity to light) using acetone. The desired amount of yeast cell culture was harvested at the desired growth phase by centrifugation for 2 minutes at 2000 revolutions per minute (rpm). The resulting pellet was washed in 1× phosphate-buffered saline (PBS) solution that had been autoclaved, before resuspending the cells in a total volume of at least 1 milliliter of 1× PBS solution, aiming for an optical density (OD) at 595 nm ~ 1.0. Next, the microplate reader settings were adjusted to use an excitation wavelength of 485 nanometers and an emission wavelength of 535 nanometers, with the top 50% mirror. Using a black, clear-bottomed 96-well plate, 25 microliters of freshly prepared dimethyl sulfoxide (DMSO): PBS solution (in a 1:1 volume ratio) were added to each well required for the assay. Additionally, 250 microliters of sterile 1× PBS were poured into at least 6 wells of row A to account for background fluorescence. Subsequently, 250 microliters of each yeast sample were carefully transferred into the corresponding wells of the 96-well plate, ensuring thorough mixing of the samples as yeast cells tend to settle. Finally, using a single pipette tip, 25 microliters of a freshly prepared stock solution of Nile red (at a concentration of 60 micrograms per milliliter) were added to each well, resulting in a final concentration of 5 micrograms per milliliter of Nile red per well. Immediately after adding the Nile red dye, the plate was read for the necessary number of cycles as per the experimental requirements.
2.2. Identification and phylogenetic analysis of yeast strain
To identify the chosen yeast strain, we extracted genomic DNA using the HiPurA Fungal DNA purification spin column kit from HiMedia, India. We then amplified the partial 18S rRNA gene sequence via PCR, employing universal primers NS1 (5’ GTAGTCATATGCTTGTCTC 3’) and NS4(5’CTTCCGTCAATTCCTTTAAG3’) [67]. The PCR reaction mixture, comprising EmeraldAmp GT PCR Master Mix (Takara Bio USA), DNA template, primers, and water, was cycled using an Applied Biosystems Veriti Thermal Cycler. Taxonomic classification and phylogenetic tree construction were conducted using MEGA 6.0 software [69]. Sequencing data were analyzed using the Basic Local Alignment Search Tool (BLAST) against the NCBI database to find the most closely related culture sequence [68].
2.3. Analytical methods
2.3.1. Harvesting lipids and assessing their yield over biomass
The cultures were harvested through centrifugation at a speed of 10,000 rpm for a duration of 20 minutes. Subsequently, the resulting pellet was subjected to oven drying at 60°C overnight, followed by weighing to determine the dry biomass for subsequent lipid analysis. For lipid extraction, the modified approach used by Kumar and Banerjee [21, 33] was employed. The lipids from the crushed, dried biomass were extracted using a modified Bligh and Dyer extraction method. This method involved utilizing chloroform and methanol in a 2:1 ratio as solvents, with the addition of glass beads weighing half the biomass for cell wall disruption. After centrifugation at 10,000 rpm for 15 minutes, the supernatant, containing the lipid soluble in the polar solvent, was collected. The solvent was then allowed to evaporate into a pre-weighed tube (W1). This extraction process was carried out in duplicates. Following this, the vial containing the total extracted lipids underwent evaporation at 60°C and was subsequently weighed (W2).
The lipid amount was determined based on the difference between W1 and W2, and the lipid content (%) was calculated using the formula:
Lipid content (%) = (W2 - W1) / sample weight (g) * 100
Furthermore, the lipid yield (%) was calculated as [26, 1]:
Lipid yield (%) = (lipid obtained (g) / Biomass weight (g)) * 100
2.3.2. Analyzing the chemical properties of the generated lipids
The lipids extracted from Y1 were subjected to identification and characterization using 1H nuclear magnetic resonance spectroscopy (NMR) at the Central Research Instrumentation Facility (CRIF) at NIT Warangal. For NMR analysis, lipid samples weighing 6 milligrams were dissolved in 600 microliters of CDCl3 solvent [30].
2.4. Studied the effect on growth and lipid production of isolated yeast by different carbon source
The activated seed cultures, measuring 2 milliliters each, of the chosen isolates were inoculated into 100 milliliters of production medium, which was a glucose-supplemented YPD medium. These cultures were then subjected to incubation in an orbital shaker at 29°C and 180 revolutions per minute (rpm) for a duration of 72 hours. To assess the impact of various carbon sources on both production of lipid and the growth of the isolated bacteria, glucose was substituted with sucrose, galactose, starch or cellulose, in the YPD medium. Each experiment was conducted in duplicate.
2.5. Synthetic dairy wastewater as medium
2.5.1. Dairy wastewater composition
The composition of the simulated dairy wastewater (SDWW) utilized in this study aligns with previously reported findings by Divya Kuravi and Venkata Mohan in 2022[22]. The components include milk powder at a concentration of 800 milligrams per liter (mg/L), (NH4)2SO4 at 60 mg/L, CaCl2⋅2H2O at 0.37 mg/L, CH3COONa at 200 mg/L, CoCl2 at 0.4 mg/L, CuSO4⋅5H2O at 0.48 mg/L, FeCl3⋅6H2O at 1.45 mg/L, K3PO4 at 150 mg/L, MgSO4⋅7H2O at 5.0 mg/L, MnCl2⋅4H2O at 0.28 mg/L, Na2MoO4⋅2H2O at 1.25 mg/L, and ZnSO4⋅7H2O at 0.45 mg/L. The pH of the medium was controlled within a range of 6.5 ± 2. The initial physio-chemical properties of the synthetic dairy wastewater indicated a chemical oxygen demand (COD) of 5300 mg/L.
2.5.2. Experiments with synthetic dairy wastewater and YPD in different ratio
The experiments involved the utilization of synthetic raw dairy wastewater (SRDWW), synthetic dairy wastewater enriched with 20 grams per liter of glucose (SDWWG), and synthetic dairy wastewater supplemented with YPD at ratios of 1:1, 2:1 and 1:2 (SDWW: YPD). The chosen isolate was cultured in 100 milliliters of the specified synthetic water formulations using 250 milliliter Erlenmeyer flasks. Time-dependent assessments were conducted to track biomass growth, substrate utilization and lipid production profiles.
2.5.3. COD and glucose content
The samples underwent centrifugation at 10,000 revolutions per minute (rpm) for 15 minutes to distinguish supernatant from the biomass. The supernatant was then utilized for chemical oxygen demand (COD) analysis as outlined in the Standard Methods (APHA, 2005) [24] and the estimation of reducing sugars were determined using the GOD POD (Glucose oxidase peroxidase) method [25].
3.1. Isolation and screening
In the initial phase of this study, our focus was on isolating yeast strains capable of accumulating significant lipid content relative to their total biomass. We began by isolating yeast strains from soil samples, utilizing dilutions of up to 10− 9. This method was chosen because previous research has indicated that soil contaminated with oils [27] is a promising source for isolating oleaginous microorganisms. After isolating 5 distinct strains based on their unique morphological characteristics, we prepared pure cultures of each strain for further screening. Batch cultures were then set up for all 5 strains (designated as Y-1 to Y-5), and the lipid content of each strain's dry biomass was extracted and compared. The results in Fig. 1 revealed that lipid content, measured at the stationary phase of cultivation under consistent experimental conditions, was found to be 53.2% for Y-1, 23% for Y-2, 33.4% for YS-5, 32% for Y-6, and 21.6% for YS-7. This variability underscores the significant differences in lipid accumulation both between species and within distinct strains of the same species. Therefore, rigorous screening and characterization are essential to ensure that the oleaginous yeast selected is suitable for producing lipids suitable for biodiesel production. According to established literature, microorganisms with lipid content exceeding 20% of their dry weight are classified as oleaginous [31]. Consequently, three out of the five isolates in our study met this criterion, with strain Y1 exhibiting the highest lipid production at 53.2%. This strain as shows in Fig. 2, with a cell biomass of 2.479 ± 0.14 g/L and a lipid concentration of 1.318 ± 0.12 g/L, was selected for further investigation. Nile Red staining revealed that the intracellular lipid particles is present in the yeast cells, confirming the significant production of microbial oil by the Y1 yeast strain as shown in Fig. 3.
3.2. Identification and phylogenetic analysis of yeast strain.
PCR amplification of fungal specific 18S gene (1000 bp) was carried out by using primersNS1 (5’ GTAGTCATATGCTTGTCTC 3’) and NS4 (5’ CTTCCGTCAATTCCTTTAAG3’) [68] (White et al., 1990). After conducting PCR, we visualized the resulting products by staining them with Gel Red Nucleic Acid Gel Stain and running them on a 1% agarose gel in TBE buffer. We then observed the bands under a UV transilluminator as shows in Fig. 4(a). By comparing the size of the DNA fragment of the Y1 strain with a 100 bp DNA ladder, we determined that it was approximately 1000 base pairs long as shows in Fig. 4(b). To identify the strain, we performed a nucleotide BLAST search using the NCBI database, aiming for at least 99% identity. The evolutionary relationship was inferred using the Neighbor-Joining method [70], with the optimal tree displaying a sum of branch length of 0.21950635. Bootstrap testing with 1000 replicates indicated the percentage of times associated taxa clustered together [71]. The tree was drawn to scale, with branch lengths representing evolutionary distances computed using the Kimura 2-parameter method [72]. The analysis of 12 nucleotide sequences, ensuring that any positions with gaps or missing data were excluded from the analysis. In the final dataset, there were a total of 969 positions. These evolutionary analyses were performed using MEGA6 software. [69]. In the constructed phylogenetic tree as shows in Fig. 4(c), our isolated yeast strain Y1 showed a 99.80% similarity to two strains: Pseudozyma thailandica CBS 10006 (accession number: NG 063041) and Pseudozyma pruni CBS 10937 (accession number: NG 063040). Consequently, we submitted the obtained sequence to GenBank, where it was assigned the accession number PP594208. Light pink colonies were obtained after the yeast strain YI was grown on YPD plates for 3 days, indicating that the yeast strain YI synthesizes a great deal of pink pigment.
3.3. Analysis of lipid using 1H NMR spectroscopy.
Gas chromatography (GC) is a standard technique for analyzing fatty acids [53]. It enables the comprehensive identification of all fatty acids present in the oil under examination, typically by converting them into methyl esters. However, spectroscopic methods can also be employed for fatty acid analysis. Among these, the 1H NMR method is frequently chosen as an alternative to GC due to its rapid analysis time, minimal solvent usage, and lack of requirement for specialized sample preparation.
The earliest documentation of 1H NMR spectra for fatty compounds dates back to 1959 [54]. Since then, this analytical method has undergone significant advancement. Over the past two decades, numerous publications have emerged utilizing the 1H NMR technique. [29] displays an example spectrum of a vegetable oil, specifically hemp-seed oil and notable signals identified in the 1H NMR spectrum of edible oils.
The supplementary file includes Fig. 5, which presents the 1H NMR spectra of lipids extracted from Y1. Changes in proton signals within the range of 0.85 to 2.35 ppm in the 1H NMR spectrum indicate the presence of saturated fatty acids. Moreover, shifts observed from 5.2 to 5.7 ppm and 2.5 to 3.1 ppm suggest the existence of unsaturated fatty acids containing -CH = CH- groups in the accumulated lipids [28, 29, 30]. The proton nuclear magnetic resonance (1H NMR) spectrum of fatty acid methyl esters (FAME) exhibited a singlet peak at 3.67 ppm, indicating the presence of methoxy protons, and a triplet peak at 2.37 ppm, representing the alpha-methylene protons. These peaks serve as confirmation of the methyl esters present in biodiesel. Additionally, other observed peaks included those at 5.34 ppm, corresponding to olefinic hydrogen, 1.60 ppm from beta-carbonyl methylene protons, 1.27 ppm related to methylene protons of the carbon chain, and 0.9 ppm from terminal methyl protons as presented in Table 1 (see supplementary data Fig. 5b) [19]. Researchers described a method enabling accurate measurement of specific fatty acid concentrations in the analyzed oil sample [56]. The area under the peak and length of the peak is more in the saturated region than the unsaturated region presented high quantity of saturation and can also find by the integration value of the peak. Certain scientific investigations propose that augmenting the saturation of fatty acids in biodiesel could potentially result in decreased greenhouse gas emissions, elevated cetane numbers, enhanced combustion characteristics, and improved fuel efficiency. Recent studies further suggest that heigh levels of saturated fatty acids may enhance biodiesel attributes by lowering density and viscosity. Precise assessment of viscosity and density holds significant importance in guaranteeing the quality of biodiesel [51, 52]. Researchers conducted measurements using two different chromatographs and noted that the consistency of results between the two instruments occasionally differed almost as much as when comparing GC analysis with the 1H NMR method. However, they found that potential errors in methodology mainly revolved around the accuracy of signal integration in the 1H NMR spectrum.
3.4. Effect of different carbon sources on growth of yeast and lipid production
The impact of five different carbon sources - galactose, cellulose, sucrose, glucose and starch - on both lipid and biomass production, as shows in Fig. 6, was investigated using the Y1 oleaginous yeast strain. The findings revealed that, except for cellulose and starch, all other carbon sources (such as glucose, galactose, and sucrose) promoted lipid production more than biomass production. Specifically, when glucose and galactose were present in the medium, Y1 exhibited the highest lipid content (> 50%), whereas sucrose yielded a lipid content of 43%, and starch or cellulose resulted in much lower lipid contents of only 22% and 23% respectively. It's known that oleaginous microorganisms tend to utilize their stored lipids as a carbon source when grown under substrates that are less preferred or not easily metabolizable, leading to lower uptake rates [23]. This phenomenon likely explains the variation in lipid accumulation observed with different carbon sources. Several studies have explored the carbon source as sucrose for producing microbial oil. Among the investigated species, Rhodotorula glutinis and Candida curvata were studied, but only Curvata candida demonstrated significant lipid accumulation, reaching 34% by weight in batch cultures [61, 62, 63]. Various yeast strains, such as Rhodotula 110, Pichia segobiensis, Trichosporonoides spathulata, and Cryptococcus musci, have been isolated and examined for their ability to produce microbial oil using different carbon sources, including agricultural residues [59, 60, 64]. Encouraging results have been reported, particularly by Enshaeieh et al. [64] and Cheirsilp and Kitcha [59], who investigated Trichosporonoides spathulate and Rhodotula 110, respectively. Rhodotula 110, sourced from soil, and R. paludigena CM33 exhibited the highest lipid content (58.2% and 23.87% by weight) respectively, under optimized conditions with glucose as the carbon source [86]. Additionally, the utilization of lignocellulosic materials, such as corn stalk and wheat straw hydrolysates, showed promising results with lipid accumulation reaching 38.9% and 43.4%, respectively [59, 64]. Furthermore, Trichosporonoides spathulata, an isolated oleaginous yeast, demonstrated lipid production of 42.8% by weight using crude glycerol as the carbon source [59]. Given these results, Y1 was chosen for further investigation into the possibility of utilizing dairy wastewater as a medium for lipid production.
3.5. Utilizing dairy wastewater for biomass and lipid generation.
While much research has focused on extracting oils from microalgae for microbial lipid feedstocks, challenges like slow growth rates and the need for sunlight and large space limit algal growth. As a result, interest has turned to yeast lipids as alternative sources, given their ability to efficiently use low-cost renewable waste materials as carbon sources. Yeast strains capable of lipid storage were isolated from soil samples, with the aim of utilizing dairy wastewater as an economical, renewable resource for lipid production. The yeast strain Y1 was grown in various media compositions, including synthetic dairy wastewater, synthetic dairy wastewater supplemented with glucose, and synthetic dairy wastewater supplemented with YPD (yeast extract, peptone, dextrose), in different ratios (1:1, 2:1 and 1:2). The study investigated Y1's biomass production and lipid accumulation, across these different dairy wastewater-based media. Results showed that the highest lipid content (53.1%) and biomass production (2.36 g/l) were achieved when dairy wastewater was supplemented with YPD in a 1:2 ratio. In contrast, when grown in synthetic raw dairy wastewater without YPD supplementation, lipid content and biomass production were 41.2% and 0.8 g/l, respectively (see Fig. 7). Y1's lipid productivity is comparable to other microorganisms like yeast and fungi when cultivated on renewable substrates. For example, an oleaginous yeast strain, Trichosporon cutanam CTM-30125, exhibited a lipid productivity of only 0.66 g/l⋅d in a batch fermentation using hydrolyzed lignocellulosic biomass as a substrate (Guerfali et al., 2018) [35]. Similarly, the lipid productivity of an oleaginous fungus, Mortierella isabellina NRRL 1757, was recorded as 0.91 g/l⋅d when cultivated on cheese whey [36]. These findings suggest that the Y1 isolate demonstrates a remarkable ability to utilize raw dairy wastewater, yielding superior lipid content and productivity compared to values reported in existing literature.
During the initial 24 hours of fermentation using raw dairy wastewater, there was no observable formation of lipid biomass by the Y1 strain. Instead, cell biomass increased concurrently with the consumption of reducing sugars. Notably, lipid accumulation in strain Y1 commenced after this initial 24-hour period, marked by a significant increase in both lipid content (%) and biomass production (g/l). The highest values for biomass and lipid content, reaching 1.53 g/l and 49.8%, respectively, were achieved after 6 days of cultivation and remained stable until day 7 as shown Fig. 8.
Throughout the fermentation process, the total sugar concentration steadily declined from 0.8 g/l to 0.03 g/l shown in Fig. 9(a). Approximately 50% of the chemical oxygen demand (COD) present in the dairy wastewater was effectively utilized by the yeast during fermentation. As a result, the final COD of the wastewater after 6 days was measured at 1600 mg/l shows in Fig. 9(b). This approach not only demonstrates the efficient utilization of dairy wastewater resources but also addresses contemporary concerns regarding sustainable wastewater management.
The newly isolated oleaginous yeast Y1 which is pink in color shows close resemblance to Pseudozyma genus, when cultivated on various carbon sources like glucose and galactose in Yeast Peptone Dextrose, demonstrates the ability to amass substantial lipid content, up to 53.2%. Particularly noteworthy is its efficiency in utilizing dairy wastewater, yielding lipid accumulation levels of up to 49.8%. This underscores the potential of yeast Y1 in leveraging dairy wastewater as a renewable resource for biodiesel production. Examining the kinetics of lipid accumulation using different models indicates that this process occurs predominantly during the exponential growth phase of the yeast. Analysis of the lipid properties through techniques such as NMR suggests their suitability for biodiesel production.
Acknowledgement
Miss Ritu Kumari and Dr. M. Jerold would Like to thank NIT Warangal for institute funding, Institute’s Central Research Instrumental Facility (CRIF center) access and National Collection of Industrial Microorganism (NCIM) Pune.
Funding
The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.
Compliance with Ethical Standards
Conflict of interest
The authors declare that they have no conflict of interest.
- Yang, Y., Yan, M., & Hu, B. (2014). Endophytic fungal strains of soybean for lipid production. Bioenergy Research, 7, 353-361.
- Selvakumar, P., & Sivashanmugam, P. (2018). Study on lipid accumulation in novel oleaginous yeast Naganishia liquefaciens NITTS2 utilizing pre-digested municipal waste activated sludge: a low-cost feedstock for biodiesel production. Applied biochemistry and biotechnology, 186, 731-749.
- Luque, R., Lovett, J. C., Datta, B., Clancy, J., Campelo, J. M., & Romero, A. A. (2010). Biodiesel as feasible petrol fuel replacement: a multidisciplinary overview. Energy & Environmental Science, 3(11), 1706-1721.
- Zhang, X., Yan, S., Tyagi, R. D., & Surampalli, R. Y. (2013). Energy balance and greenhouse gas emissions of biodiesel production from oil derived from wastewater and wastewater sludge. Renewable Energy, 55, 392-403.
- Venkatesagowda, B., Ponugupaty, E., Barbosa-Dekker, A. M., & Dekker, R. F. (2018). The purification and characterization of lipases from Lasiodiplodia theobromae, and their immobilization and use for biodiesel production from coconut oil. Applied biochemistry and biotechnology, 185, 619-640.
- Poppe, J. K., Matte, C. R., Fernandez-Lafuente, R., Rodrigues, R. C., & Ayub, M. A. Z. (2018). Transesterification of waste frying oil and soybean oil by combi-lipases under ultrasound-assisted reactions. Applied biochemistry and biotechnology, 186, 576-589.
- Durrett, T. P., Benning, C., & Ohlrogge, J. (2008). Plant triacylglycerols as feedstocks for the production of biofuels. The Plant Journal, 54(4), 593-607.
- Vicente, G., Bautista, L. F., Rodríguez, R., Gutiérrez, F. J., Sádaba, I., Ruiz-Vázquez, R. M., ... & Garre, V. (2009). Biodiesel production from biomass of an oleaginous fungus. Biochemical Engineering Journal, 48(1), 22-27.
- Cheng, Y., Lu, Y., Gao, C., & Wu, Q. (2009). Alga-based biodiesel production and optimization using sugar cane as the feedstock. Energy & Fuels, 23(8), 4166-4173.
- Papanikolaou, S., Sarantou, S., Komaitis, M., & Aggelis, G. (2004). Repression of reserve lipid turnover in Cunninghamella echinulata and Mortierella isabellina cultivated in multiple‐limited media. Journal of Applied Microbiology, 97(4), 867-875.
- Ratledge, C., & Hopkins, S. (2006). Lipids from microbial sources.
- Botham, P. A., & Ratledge, C. (1979). A biochemical explanation for lipid accumulation in Candida 107 and other oleaginous micro-organisms. Microbiology, 114(2), 361-375.
- He, M. X., Hu, Q., Gou, X., Liu, X., Li, Q., Pan, K., ... & Wu, J. (2010). Screening of oleaginous yeast with xylose assimilating capacity for lipid and bio-ethanol production. African Journal of Biotechnology, 9(49), 8392-8397.
- Probst, K. V., Schulte, L. R., Durrett, T. P., Rezac, M. E., & Vadlani, P. V. (2016). Oleaginous yeast: a value-added platform for renewable oils. Critical reviews in biotechnology, 36(5), 942-95.
- Mirón, A. S., Garcıa, M. C. C., Gómez, A. C., Camacho, F. G., Grima, E. M., & Chisti, Y. (2003). Shear stress tolerance and biochemical characterization of Phaeodactylum tricornutum in quasi steady-state continuous culture in outdoor photobioreactors. Biochemical Engineering Journal, 16(3), 287-297.
- He MingXiong, H. M., Hu QiChun, H. Q., Gou XinHua, G. X., Liu XinYing, L. X., Li Qing, L. Q., Pan Ke, P. K., ... & Wu Jin, W. J. (2010). Screening of oleaginous yeast with xylose assimilating capacity for lipid and bio-ethanol production.
- Mouget, J. L., Rosa, P., & Tremblin, G. (2004). Acclimation of Haslea ostrearia to light of different spectral qualities–confirmation ofchromatic adaptation'in diatoms. Journal of Photochemistry and Photobiology B: Biology, 75(1-2), 1-11.
- Rostron, K. A., & Lawrence, C. L. (2017). Nile red staining of neutral lipids in yeast. Histochemistry of Single Molecules: Methods and Protocols, 219-229.
- Brar, K. K., Sarma, A. K., Aslam, M., Polikarpov, I., & Chadha, B. S. (2017). Potential of oleaginous yeast Trichosporon sp., for conversion of sugarcane bagasse hydrolysate into biodiesel. Bioresource technology, 242, 161-168.
- Rostron, K. A., & Lawrence, C. L. (2017). Nile red staining of neutral lipids in yeast. Histochemistry of Single Molecules: Methods and Protocols, 219-229.
- Kumar, S. P., & Banerjee, R. (2013). Optimization of lipid enriched biomass production from oleaginous fungus using response surface methodology.
- Kuravi, S. D., & Mohan, S. V. (2022). Mixotrophic cultivation of Monoraphidium sp. In dairy wastewater using Flat-Panel photobioreactor and photosynthetic performance. Bioresource Technology, 348, 126671.
- Dourou, M., Aggeli, D., Papanikolaou, S., & Aggelis, G. (2018). Critical steps in carbon metabolism affecting lipid accumulation and their regulation in oleaginous microorganisms. Applied microbiology and biotechnology, 102, 2509-2523.
- Rice, E. W., Bridgewater, L., & American Public Health Association (Eds.). (2012). Standard methods for the examination of water and wastewater (Vol. 10). Washington, DC: American public health association.
- Werner, W., Rey, H. G., & Wielinger, H. (1970). On the properties of a new chromogen for the determination of glucose in blood according to the GOD/POD-method. Fresenius' Zeitschrift für analytische Chemie, 252, 224-228.
- Zhang, X., Yan, S., Tyagi, R. D., Drogui, P., & Surampalli, R. Y. (2014). Ultrasonication assisted lipid extraction from oleaginous microorganisms. Bioresource technology, 158, 253-261.
- Murugan, T., Saravanan, D., & Balagurunathan, R. (2012). Production and optimization of single cell oil by oleaginous bacteria isolated from oil contaminated environment. International Journal of Current Research and Review, 4, 175-184.
- Goswami, L., Namboodiri, M. T., Kumar, R. V., Pakshirajan, K., & Pugazhenthi, G. (2017). Biodiesel production potential of oleaginous Rhodococcus opacus grown on biomass gasification wastewater. Renewable Energy, 105, 400-406.
- Siudem, P., Zielińska, A., & Paradowska, K. (2022). Application of 1H NMR in the study of fatty acids composition of vegetable oils. Journal of Pharmaceutical and Biomedical Analysis, 212, 114658.
- Behera, A. R., Dutta, K., Verma, P., Daverey, A., & Sahoo, D. K. (2019). High lipid accumulating bacteria isolated from dairy effluent scum grown on dairy wastewater as potential biodiesel feedstock. Journal of environmental management, 252, 109686.
- Ratledge, C., & Wynn, J. P. (2002). The biochemistry and molecular biology of lipid accumulation in oleaginous microorganisms. Advances in applied microbiology, 51, 1-52.
- Li, M., Liu, G. L., Chi, Z., & Chi, Z. M. (2010). Single cell oil production from hydrolysate of cassava starch by marine-derived yeast Rhodotorula mucilaginosa TJY15a. Biomass and bioenergy, 34(1), 101-107.
- Cea, M., Sangaletti-Gerhard, N., Acuña, P., Fuentes, I., Jorquera, M., Godoy, K., ... & Navia, R. (2015). Screening transesterifiable lipid accumulating bacteria from sewage sludge for biodiesel production. Biotechnology reports, 8, 116-123.
- de Mendonca, H. V., Otenio, M. H., Marchao, L., Lomeu, A., de Souza, D. S., & Reis, A. (2022). Biofuel recovery from microalgae biomass grown in dairy wastewater treated with activated sludge: The next step in sustainable production. Science of The Total Environment, 824, 153838.
- Guerfali, M., Ayadi, I., Belhassen, A., Gargouri, A., & Belghith, H. (2018). Single cell oil production by Trichosporon cutaneum and lignocellulosic residues bioconversion for biodiesel synthesis. Process safety and environmental protection, 113, 292-304.
- Carota, E., Crognale, S., D’Annibale, A., & Petruccioli, M. (2018). Bioconversion of agro-industrial waste into microbial oils by filamentous fungi. Process Safety and Environmental Protection, 117, 143-151.
- Hossain, A. K., & Davies, P. A. (2012). Combustion and emission characteristics of a typical biodiesel engine operated on waste cooking oil derived biodiesel (No. 2012-01-1624). SAE Technical Paper.
- Song, J. T., & Zhang, C. H. (2008). An experimental study on the performance and exhaust emissions of a diesel engine fuelled with soybean oil methyl ester. Proceedings of the Institution of Mechanical Engineers, Part D: Journal of Automobile Engineering, 222(12), 2487-2496.
- Prabhahar, M., Kiani, M. K. D., Bhaskar, K., Sendilvelan, S., Prakash, S., & Sassykova, L. R. (2019). Studies on pongamia oil methyl ester fueled direct injection diesel engine to increase efficiency and to reduce harmful emissions. In Advanced Biofuels (pp. 217-245). Woodhead publishing.
- Prakash, S., Prabhahar, M., Sendilvelan, S., Venkatesh, R., Singh, S., & Bhaskar, K. (2019). Experimental studies on the performance and emission characteristics of an automobile engine fueled with fish oil methyl ester to reduce environmental pollution. Energy Procedia, 160, 412-419.
- Sassykova, L. R. E. (2018). Technogenic emissions into the atmosphere: impact on the environment and neutralization by catalytic methods: Monograph. Qazaq University.
- Meinshausen, M., Meinshausen, N., Hare, W., Raper, S. C., Frieler, K., Knutti, R., ... & Allen, M. R. (2009). Greenhouse-gas emission targets for limiting global warming to 2 C. Nature, 458(7242), 1158-1162.
- Tamilselvan, P., Sassykova, L., Prabhahar, M., Bhaskar, K., Kannayiram, G., Subramanian, S., & Prakash, S. (2020). Influence of saturated fatty acid material composition in biodiesel on its performance in internal combustion engines. Materials Today: Proceedings, 33, 1181-1186.
- Bhaskar, K., Sassykova, L. R., & Sendilvelan, S. (2018). Research of the performance and emission characteristics of Jatropha Oil Methyl Esters (JOME) and diesel blends in a partially premixed charge compression ignition engine. International Journal of Biology and Chemistry, 11(2), 99-107.
- Sassykova, L., Sendilvelan, S., Telbayeva, M., Dossumov, K., & Bhaskar, K. (2019). PREPARATION AND TEST OF CATALYSTS DEPOSITED ON METAL BLOCKS USED IN SYNTHESIS OF DIMETHYL AND DIISOPROPYL ETHERS. Journal of Chemical Technology & Metallurgy, 54(3).
- Sezer, I. (2011). Thermodynamic, performance and emission investigation of a diesel engine running on dimethyl ether and diethyl ether. International Journal of Thermal Sciences, 50(8), 1594-1603.
- Abildin, T. S., Kubekova, S. N., Mataeva, Z. T., & Zhakupova, A. A. (2019). LR Sassykova1, S. Sendilvelan2, K. Bhaskar3, AS Zhumakanova4, YA Aubakirov1. OF GEOLOGY AND TECHNICAL SCIENCES, 181.
- Zhong, H., Watanabe, M., Enomoto, H., Jin, F., Kishita, A., Aida, T. M., & Smith Jr, R. L. (2016). Winterization of vegetable oil blends for biodiesel fuels and correlation based on initial saturated fatty acid constituents. Energy & Fuels, 30(6), 4841-4847.
- Golimowski, W., Krzaczek, P., Marcinkowski, D., Gracz, W., & Wałowski, G. (2019). Impact of biogas and waste fats methyl esters on NO, NO2, CO, and PM emission by dual fuel diesel engine. Sustainability, 11(6), 1799.
- Yoshimoto, Y. (2010). Combustion characteristics of a dual fuel diesel engine with natural gas (study with fatty acid methyl esters used as ignition fuels) (No. 2010-32-0050). SAE Technical Paper.
- Barik, D., & Murugan, S. (2016). Effects of diethyl ether (DEE) injection on combustion performance and emission characteristics of Karanja methyl ester (KME)–biogas fueled dual fuel diesel engine. Fuel, 164, 286-296.
- Verma, S., Das, L. M., Kaushik, S. C., & Bhatti, S. S. (2019). The effects of compression ratio and EGR on the performance and emission characteristics of diesel-biogas dual fuel engine. Applied Thermal Engineering, 150, 1090-1103.
- Simopoulos, A. P. (2008). The importance of the omega-6/omega-3 fatty acid ratio in cardiovascular disease and other chronic diseases. Experimental biology and medicine, 233(6), 674-688.
- Hopkins, C. Y., & Bernstein, H. J. (1959). Applications of proton magnetic resonance spectra in fatty acid chemistry. Canadian Journal of Chemistry, 37(4), 775-782.
- Guillén, M. D., & Ruiz, A. (2003). 1H nuclear magnetic resonance as a fast tool for determining the composition of acyl chains in acylglycerol mixtures. European Journal of Lipid Science and Technology, 105(9), 502-507.
- Knothe, G., & Kenar, J. A. (2004). Determination of the fatty acid profile by 1H‐NMR spectroscopy. European Journal of Lipid Science and Technology, 106(2), 88-96.
- Shanthi, M., Banu, J. R., & Sivashanmugam, P. (2018). Effect of surfactant assisted sonic pretreatment on liquefaction of fruits and vegetable residue: Characterization, acidogenesis, biomethane yield and energy ratio. Bioresource technology, 264, 35-41.
- Paliwal, R. (2022). From Waste to Wealth: Stepping Toward Sustainability Through Circular Economy. In Handbook of Solid Waste Management: Sustainability through Circular Economy (pp. 441-463). Singapore: Springer Nature Singapore
- Kitcha, S., & Cheirsilp, B. (2011). Screening of oleaginous yeasts and optimization for lipid production using crude glycerol as a carbon source. Energy Procedia, 9, 274-282.
- Tanimura, A., Takashima, M., Sugita, T., Endoh, R., Kikukawa, M., Yamaguchi, S., ... & Shima, J. (2014). Cryptococcus terricola is a promising oleaginous yeast for biodiesel production from starch through consolidated bioprocessing. Scientific reports, 4(1), 4776.
- Fei, Q., Chang, H. N., Shang, L., Kim, N., & Kang, J. (2011). The effect of volatile fatty acids as a sole carbon source on lipid accumulation by Cryptococcus albidus for biodiesel production. Bioresource technology, 102(3), 2695-2701.
- Evans, C. T., & Ratledge, C. (1983). A comparison of the oleaginous yeast, Candida curvata, grown on different carbon sources in continuous and batch culture. Lipids, 18(9), 623-629.
- Johnson, V. W., Singh, M., Saini, V. S., Adhikari, D. K., Sista, V., & Yadav, N. K. (1995). Utilization of molasses for the production of fat by an oleaginous yeast, Rhodotorula glutinis IIP-30. Journal of industrial microbiology and biotechnology, 14(1), 1-4.
- Enshaeieh, M., Abdoli, A., Nahvi, I., & Madani, M. (2012). Selection and optimization of single cell oil production from Rodotorula 110 using environmental waste as substrate. Journal of cell and molecular research, 4(2), 68-75.
- Kalkanis, K., Alexakis, D. E., Kyriakis, E., Kiskira, K., Lorenzo-Llanes, J., Themelis, N. J., & Psomopoulos, C. S. (2022). Transforming waste to wealth, achieving circular economy. Circular Economy and Sustainability, 2(4), 1541-1559.
- Lacy, P., & Rutqvist, J. (2015). Waste to wealth: The circular economy advantage (Vol. 91). London: Palgrave Macmillan.
- White, T.J., Bruns, T., Lee, S.J.W.T. and Taylor, J., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications, 18(1), pp.315-322.
- Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J., 1990. Basic local alignment search tool. Journal of molecular biology, 215(3), pp.403-410.
- Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution, 30(12), pp.2725-2729.
- Saitou N. and Nei M. (1987). The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4:406-425.
- Felsenstein J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783-791.
- Kimura M. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:111-120.
- Mirón, A. S., Garcıa, M. C. C., Gómez, A. C., Camacho, F. G., Grima, E. M., & Chisti, Y. (2003). Shear stress tolerance and biochemical characterization of Phaeodactylum tricornutum in quasi steady-state continuous culture in outdoor photobioreactors. Biochemical Engineering Journal, 16(3), 287-297.
- Peccia, J., & Westerhoff, P. (2015). We should expect more out of our sewage sludge.
- Selvakumar, P., & Sivashanmugam, P. (2018). Multi-hydrolytic biocatalyst from organic solid waste and its application in municipal waste activated sludge pre-treatment towards energy recovery. Process Safety and Environmental Protection, 117, 1-10.
- Leiva-Candia, D. E., Pinzi, S., Redel-Macías, M. D., Koutinas, A., Webb, C., & Dorado, M. P. (2014). The potential for agro-industrial waste utilization using oleaginous yeast for the production of biodiesel. Fuel, 123, 33-42.
- BOEKHOUT, T. (1995). Pseudozyma Bandoni emend. Boekhout, a genus for yeast-like anamorphs of Ustilaginales. The Journal of General and Applied Microbiology, 41(4), 359-366.
- Wang, Q. M., Jia, J. H., & Bai, F. Y. (2006). Pseudozyma hubeiensis sp. nov. and Pseudozyma shanxiensis sp. nov., novel ustilaginomycetous anamorphic yeast species from plant leaves. International Journal of Systematic and Evolutionary Microbiology, 56(1), 289-293.
- Golubev, W., Sugita, T., & Golubev, N. (2007). An ustilaginomycetous yeast, Pseudozyma graminicola sp. nov., isolated from the leaves of pasture plants. Mycoscience, 48(1), 29-33.
- Seo, H. S., Um, H. J., Min, J., Rhee, S. K., Cho, T. J., Kim, Y. H., & Lee, J. (2007). Pseudozyma jejuensis sp. nov., a novel cutinolytic ustilaginomycetous yeast species that is able to degrade plastic waste. FEMS yeast research, 7(6), 1035-1045.
- Stoll, M., Begerow, D., & Oberwinkler, F. (2005). Molecular phylogeny of Ustilago, Sporisorium, and related taxa based on combined analyses of rDNA sequences. Mycological Research, 109(3), 342-356.
- Boekhout, T., Fonseca, Á., Sampaio, J. P., Bandoni, R. J., Fell, J. W., & Kwon-Chung, K. J. (2011). Discussion of teleomorphic and anamorphic basidiomycetous yeasts. In The yeasts (pp. 1339-1372). Elsevier.
- Chamnanpa, T., Limtong, P., Srisuk, N., & Limtong, S. (2013). Pseudozyma vetiver sp. nov., a novel anamorphic ustilaginomycetous yeast species isolated from the phylloplane in Thailand. Antonie van Leeuwenhoek, 104, 637-644.
- Pongharn, N., Insomphun, C., Hanmoungjai, P., Jinsiriwanit, S., & Chaiyaso, T. Screening of Oleaginous Yeasts with Xylose Assimilating Capacity for Lipids and Sugar Alcohols Co-production.
- Areesirisuk, A., Chiu, C. H., Yen, T. B., Liu, C. H., & Guo, J. H. (2015). A novel oleaginous yeast strain with high lipid productivity and its application to alternative biodiesel production. Applied biochemistry and microbiology, 51, 411-418.
- Gosalawit, C., Imsoonthornruksa, S., Gilroyed, B. H., Mcnea, L., Boontawan, A., & Ketudat-Cairns, M. (2021). The potential of the oleaginous yeast Rhodotorula paludigena CM33 to produce biolipids. Journal of biotechnology, 329, 56-64.
Table.1. Fatty acid composition at different proton signal.
