1-(1-naphthylmethyl)-piperazine inhibition assay successfully rules out efflux pump overexpression in Acinetobacter baumannii

doi:10.21203/rs.3.rs-4504282/v1

Background. Antimicrobial resistance (AMR) in ESKAPE pathogens, notably in carbapenem-resistant Acinetobacter baumannii, is a pressing global health concern, contributing to significant AMR-associated mortality. Efflux pump overexpression plays a crucial role in the multidrug resistance (MDR) of A. baumannii, but the identification of efflux-overexpressing strains remains challenging.

Methods. We evaluated the performance of an efflux pump inhibition assay in comparison with RT-qPCR, to assess efflux pump overexpression in a collection of clinical A. baumannii strains. Sixty MDR strains and a wild one were analyzed.

Results. The inhibition assay was positive for 34 and negative for 27 strains, respectively. Results were in agreement with RT-qPCR in 67.2% of the tested strains (39/58). Cohen's kappa showed a fair agreement between inhibition assay and RT-qPCR (Cohen’s kappa = 0.37). Inhibition by NMP, but not PAβN, was in moderate agreement with RT-qPCR (Cohen’s kappa = 0.41).Furthermore, gpi alleles were associated with efflux pump overexpression (p = 0.03), suggesting potential links between genetic diversity and efflux pump overexpression. RT-qPCR showed a significant efflux pump overexpression for 4 (16.7%) out of 24 inhibition assay negative strains.

Conclusions. Our findings support the ability to reliably rule out efflux pump overexpression in A. baumannii strains displaying a negative result with an inhibition test relying on NMP. However, confirmatory analyses are necessary for strains that test positive.

Acinetobacter baumannii

antibiotic resistance

efflux pump

efflux pump inhibitors

Antimicrobial resistance (AMR) was responsible for an estimated 4.95 million annual deaths around the world in 2019 [1]. The ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp.) are believed to cause the bulk of AMR-related healthcare infections, and have become top priority targets for the development of new antibiotics [2]. Among them, carbapenem-resistant A. baumannii is a significant concern, designated as a “critical priority” by the World Health Organization [3], and an urgent threat by the Centers for Disease Control and Prevention (CDC) [4].

All major mechanisms of drug resistance have been described in A. baumannii, and include limited drug uptake (e.g. CarO disruption), target modification (e.g. GyrA, GyrB and ParC mutations), drug inactivation (e.g. 16S RNA methyltransferase and/or carbapenemase production), and the overexpression of efflux pumps (EP) (e.g. AdeABC overexpression) [5, 6]. Carbapenemase production is of the greatest concern, but efflux pump overexpression is strongly associated with multi-drug resistance (MDR) phenotypes [5, 7]. Efflux pumps are a large group of structurally and genetically diverse membrane active transporters, most of which have an early evolutionary origin as evidenced by the ubiquitous nature of several families that span all domains of life [8]. To date, six families of efflux pumps have been described in bacteria and were all identified in A. baumannii : resistance-nodulation-cell division (RND), major facilitator superfamily (MFS), multidrug and toxin extrusion (MATE), small multidrug resistance (SMR), proteobacterial antimicrobial compound efflux (PACE), and ATP-binding cassette (ABC) [7, 8].

RND pumps have a unique tripartite structure, and use proton motor force to extrude a large number of drugs such as beta-lactams, macrolides, aminoglycosides, and fluoroquinolones to name a few [7]. AdeABC, AdeFGH, and AdeIJK are the most studied RND efflux pumps, and are believed to be the most clinically relevant in AMR [5, 7]. AbeM, a member of the MATE family, as well as AbaQ from the MFS family, have been shown to extrude fluoroquinolones among other drugs [7]. It has also been suggested that fluoroquinolones are substrates of AmvA, another member of the MFS family [9]. ABC and SMR transporters are believed to play only a minor role in AMR in this species [7]. AceI, the only PACE efflux pump described in this species, is known to only extrude chlorhexidine, an antiseptic [7].

When overexpressed, efflux pumps can lead to resistant phenotypes in A. baumannii, as is the case in a number of other bacterial species [10]. A common strategy for the identification of efflux pump overexpressing strains is the phenotypic inhibition assay (IA). It consists in a comparison of minimal inhibitory concentrations (MICs) of a drug obtained in the absence and the presence of an efflux pump inhibitor (EPI) [10]. A fold change in MICs of 4 or greater after addition of the EPI is considered a marker of efflux pump overexpression [11]. Two EPIs, namely phenylalanine-arginine beta-naphthylamide (PAβN) and 1-(1-naphthylmethyl)-piperazine (NMP), are arguably the most well characterized, and were shown to be active in A. baumannii [11].

The aim of this study was to expand on our previous report comparing the performance of a phenotypic IA to the relative expression levels of six efflux pump encoding genes (adeB, adeG, adeJ, amvA, abaQ, abeM) obtained by RT-qPCR on a subset of A. baumannii ciprofloxacin resistant strains [12]. We focused on strains displaying a fold change lower than the threshold value of 4 stated above, and investigated if this result could be used to rule out EP overexpression as measured by RT-qPCR. In addition, we used bla_oxa51 typing to obtain data on the population structure of studied strains, and investigated the relationship between efflux-pump overexpression and gpi single-locus sequence typing.

Bacterial strains and ciprofloxacin susceptibility testing. Data from sixty A. baumannii strains, isolated from clinical or screening samples in Amiens University Hospital (Amiens, France) from 1995 to 2018 were included in this study. Ciprofloxacin MICs alone and in the presence of NMP or PAβN were obtained from our previous report [12]. Three separate definitions for a positive IA were set, relative to a decrease of at least 4-fold in ciprofloxacin MIC in the presence of: (i) NMP or PAβN (IA_NMP/PAβN), (ii) NMP (IA_NMP), and finally (iii) PAβN (IA_PAβN).

RT-qPCR assay. RT-qPCR was performed as previously described [12]. Briefly, IA_NMP/PAβNnegative strains were cultured overnight in cation-adjusted Mueller-Hinton Broth (VWR International, USA) at 35°C under aerobic conditions. RNA extraction was performed with the QiagenRneasy^® minikit with the addition of RNAprotect bacterial agent (Qiagen, France). The RNA concentration was measured by a spectrophotometer (Nanodrop, ThermoFisher Scientific, France) and samples were stored at -20°C until further use. Genomic DNA digestion, prior to reverse transcription, was performed by gDNA Wipeout kit (Qiagen) according to manufacturer’s instructions. One microgram of total RNA was retro-transcribed using a Transcriptor High Fidelity cDNA Synthesis kit (Roche Diagnostics, Switzerland) in a Veriti PCR thermal cycler (Applied Biosystems, France) with the following cycle settings: 10 min at 65°C, 30 min at 42°C, and 5 min at 85°C. qPCR was performed on a LightCycler 480 (Roche Diagnostics) using PowerUp SYBR Green (Applied Biosystems) according to manufacturer’s instructions. The cycling program was set as (i) activation (15 min at 95°C), (ii) ampliﬁcation of 45 cycles (15 s at 95°C, 25 s at 60°C, 15 s at 72°C) followed by (iii) melting curve analysis (5s at 95°C, 1 min at 65°C, 5 s at 95°C, 1 min at 65°C, and a ﬁnal increase at 97°C, with a transition rate of 0.11°C/s). Each reaction was carried out in technical and biological duplicates. A total of 6 genes of interest (adeB, adeG, adeJ, abeM, abaQ, and amvA) were assessed and rpoB was used as a reference gene. Fold changes in expression levels were calculated using the Pfaffl method, which takes into consideration the observed PCR efficiencies of individual genes and were log2-transformed prior to statistical analysis [13]. RT-qPCR data for IA_NMP/PAβNpositive strains were retrieved from our previous study [12].

bla_oxa-51 and gpi sequencing. Typing of the bla_oxa-51and gpi alleles was performed using primers shown in Table 1on the sixty strains included in this study. DNA extraction was performed by heat shock. A 1 µL loop of overnight bacterial culture was suspended in 1 mL of saline and incubated at 95°C for 15 minutes, then at -80°C for 10 min and finally centrifuged at 10,000 g for 5 min. DNA concentrations in supernatants were determined by NanoDrop (ThermoFisher Scientific). Then, samples were diluted to a final concentration of 20 ng/µL and served as PCR templates. End-point PCR was performed using Taq’Ozyme HS Mix (Ozyme, France) in a 25 µL reaction volume, under the following conditions: hot-start 95°C for 1 min, 35 cycles (denaturation at 95°C for 15 s, annealing at 58°C for 30 s, extension at 72°C for 1 min 30 s), final extension at 72°C for 5 min. PCR products were purified by ExoSAP-IT^TM (ThermoFisher Scientific) following the manufacturer’s instructions. Sequencing was performed using BigDye^TM Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific) according to manufacturer’s instructions for diluted reactions in a volume of 10 µL including 2 µL of BigDye^TM Terminator 3.1 Ready Reaction Mix, 2 µL of BigDye^TM Terminator Sequencing Buffer and 3.2 pmol of forward or reverse primer (Table 1). Sequences were purified using the BigDyeXterminator^TM Purification Kit (ThermoFisher Scientific) following the manufacturer’s instructions in a reaction volume containing 10 µL of the sequenced amplicon, 45 µL of SAM^TM solution and 5 µL of BigDyeXterminator^TM solution. Capillary electrophoresis was performed on purified sequences on a 3500 Dx Analyzer (Applied Biosystems). Sequences were aligned and manually corrected on UniproUgene v.33 (Unipro LLC, Russia). Alleles were assigned for each gene using PubMLST online tool (https://pubmlst.org/organisms/acinetobacter-baumannii).

Statistical analysis. Analysis was performed on RStudio 2023.12.1+402 (Posit Software, USA). Mean log2-transformed fold changes of individual efflux genes in each strain were compared to a threshold of 1 using one-tailed Student’s t-test. Median log2-transformed fold changes were compared using Wilcoxon signed-rank test. The association between gpi allele and efflux pump overexpression was tested using Fisher's exact test. Post-hoc pairwise analysis was performed using Fisher’s exact test with Bonferroni correction. All tests were performed with an α = 5% and statistical significance was inferred for P values below 0.05.

Agreement between IA and RT-qPCR. Based on the first definition, 34 strains out of 60 were IA_NMP/PAβN positive and 26, as well as a wild type (WT) strain (ABAM 113), were IA_NMP/PAβN negative. Out of the twenty-six negative IA_NMP/PAβN negative strains, two (ABAM 40 and ABAM 60) did not yield sufficient amounts of RNA upon extraction on four attempts and were excluded from further analysis, as well as from bla_oxa-51and gpi sequencing. Among the twenty-four remaining IA_NMP/PAβN negative strains, 4/24 (16.7%) showed a statistically significant increase in expression level for at least one efflux pump encoding gene (Tables 2, 3 and Table S1). IA_NMP/PAβN was concordant with RT-qPCR in 67.2% of the tested strains (39/58), which included 20 IA_NMP/PAβN negative/RT-qPCR negativeand 19 IA_NMP/PAβN positive/RT-qPCR positive strains. Discrepant results were obtained for 32.7% of the tested strains (19/58), including 15 IA_NMP/PAβN positive/RT-qPCR negativeand 4 IA_NMP/PAβN negative/RT-qPCR positive strains (Table 2). Moreover, Cohen’s kappa showed a fair agreement (0.37, CI_95% [0.15; 0.59]) between the 2 tests. However inhibition assay results obtained by NMP and PAβN did not agree (Cohen’s kappa = 0.076 CI_95%[-0.18, 0.34]).

When considering NMP and PAβN separately for the interpretation of the IA, IA_NMP showed a moderate agreement with RT-qPCR (Cohen’s kappa = 0.41 CI_95% [0.17, 0.65]) (Table 2). In contrast, IA_PAβN test results showed a poor agreement (Cohen’s kappa = 0.17, CI_95% [-0.092, 0.42]) with RT-qPCR (Table 2). Moreover, IA_PAβN positive strains did not show any significant increase in the fold change expression for any of the tested genes relative to IA_PAβNnegative (data not shown).

IA_NMP positive strains showed a statistically significant increase in the median log2-transformed fold changes for three efflux pump genes : adeG (-1.2 vs -0.01 ; p<0.01), abeM (-1.8 vs 0.01 ; p<0.01) and abaQ (-1.3 vs 0.6, p<0.05) (Figure 1). Median log2-transformed fold changes were higher, but not statistically significantly, for adeJ (0.6 vs 2.0) and amvA (-2.3 vs -1.5) genes, but not for adeB (0.7 vs 0.6).

bla_oxa-51 and gpi sequencing. Sequences for bla_oxa-51were obtained for fifty-two out of the fifty-eight strains. bla_oxa-51allele 1 was widely represented, with forty-two strains (81%) carrying it. Other alleles were rare. Alleles 2 and 77 were observed in two strains each (ABAM 48 and ABAM 52, ABAM 67 and ABAM 133, respectively). Alleles 8, 28, 46 and 66 were present in one strain each (ABAM 3, ABAM 53, ABAM 45 and ABAM 39, respectively) (Table S2). In addition, two strains (ABAM 62 and ABAM 63) had a previously unreported bla_oxa-51allele (GenBank accession no. under processing) with its closest match being allele 66, containing a single T433C (S175P) missense mutation. Sequences for gpi were obtained for fifty-seven out of fifty-eight strains. One strain, ABAM 67, failed to amplify in three independent experiments. Alleles 96, 97 and 102 were the most frequent ones with 43.8% (25/57), 29.8% (17/57) and 14% (8/57) of the strains, respectively. Allele 98 was found in 4 strains (ABAM 3, ABAM 39, ABAM 62 and ABAM 63) while alleles 107, 142, and 172 were carried by one strain each (ABAM 133, ABAM 45 and ABAM 59, respectively) (Table S2). Fisher exact test showed a statistically significant association between gpi allele and efflux pump overexpression assessed by RT-qPCR (p = 0.03) as shown in Figure 2. Post-hoc analysis for pair-wise comparison using Bonferroni p-value adjustment method did not reach significance for any of the tested pairs.

The adjunction of an EPI, such as PAβN or NMP, to an antibiotic affected by efflux pump extrusion, could potentially restore its activity and offer a therapeutic alternative for patients infected with MDR A. baumannii strains. Additionally, their use has been described for in vitro screening of antibiotic resistance by efflux pump overexpression [11, 14–17].

Ciprofloxacin, a fluoroquinolone, is a substrate for various efflux pumps in A. baumannii, which makes it an attractive candidate as a marker of efflux pump activity [12]. Although resistance to ciprofloxacin in this species is primarily driven by mutations in gyrA and parC genes, efflux pump activity has been recognized as a major contributor to resistance [5].

Despite being widely reported in the literature, little is known about the performance of these phenotypic IAs and whether the results obtained correlate with an actual overexpression of efflux pump genes. Thus, the first aim of this study was to compare the results of a previously described IA with a RT-qPCR assay [11]. We found that the overall agreement between IA_NMP/PAβN and RT-qPCR was fair (Cohen’s Kappa = 0.37). However, the largest number of discordant results came from IA_NMP/PAβN positive strains which did not show an increased expression level for several major efflux pumps on RT-qPCR testing (15/58). This observation could be attributed to the contribution of other efflux pump genes unaccounted for in this study which may be involved in phenotypic resistance. However, resistant phenotypes can also arise from expression-independent mechanisms as seen in several amino acid substitutions in the AcrB efflux pump in Escherichia coli [18]. Moreover, substitutions AdeB efflux pump in A. baumannii can lead to resistant phenotypes, and perhaps most surprisingly, the overexpression of certain variants of AdeB leads to hypersusceptible phenotypes [19]. Although mRNA levels are generally correlated to protein levels, other mechanisms regulate the expression of efflux pump genes, such as cis-encoded RNA elements or trans-acting small regulatory RNAs. The latter are known to act as either translation repressors or promoters as observed in E. coli and N. gonorrhoeae [8]. Finally, small proteins, such as AcrZ which interacts with AcrB in E. coli and plays a role in efflux pump substrate recognition, could also be relevant in A. baumannii [8].

Additionally, we found that 4 out of the 24 IA_NMP/PAβN negative strains included in this study overexpressed one efflux pump gene (adeG for ABAM 39, adeJ for ABAM 66 and ABAM 83 and adeB for ABAM 87). However, their relative expression levels were lower than those previously reported, which showed increases up to 50-fold for adeB and 200 to 300-fold for adeG in resistant A. baumannii strains [20, 21]. This raises the question of the significance of low-level overexpression on phenotypic resistance in such strains. However, the correlation between expression levels and resistant phenotype is not straightforward, and may be dependent on the cooperation of different mechanisms of resistance [22, 23]. Nonetheless, adeJ expression levels observed in this study are consistent with published data, showing a five-fold increase in expression levels upon deletion of its negative regulator adeN [24].

In our study, NMP and PAβN did not equally inhibit the tested strains as shown by the lack of agreement between IA_NMP and IA_PAβN (Cohen’s Kappa = 0.076). Indeed, IA_NMP showed a moderate agreement with RT-qPCR (Cohen’s Kappa = 0.41), whereas IA_PAβN did not (Cohen’s Kappa = 0.17). This is in line with published data, showing that NMP is a more potent EPI than PAβN in A. baumannii [11]. Additionally, when taking into account only data obtained from IA_NMP, there was a significant increase of the expression levels of abaQ (p < 0.05), adeG and abeM (p < 0.01) in IA_NMP positive strains. Further studies are needed to explore whether those differences in expression levels are related to the mechanism of action of NMP.

The majority of the strains included in this study harbored bla_oxa51 allele 1, encoding the intrinsic oxacillinase OXA-66, which is strongly associated with the international clone (IC) 2, the predominant lineage in Europe [5, 25]. Molecular determinants of resistance are strongly correlated with international clones (IC) of A. baumannii. For example, AbaR-type resistance island is associated with, but not exclusive to IC1, while IC2 typically harbors resistance genes on a Tn6022-Tn6172 structure [5].Therefore, the second aim of this work as to investigate the link between genetic diversity and efflux pump overexpression assessed by RT-qPCR using gpi sequencing as a proxy for clonal diversity of A. baumannii. The choice of gpi sequencing is justified by its high discriminatory power in the Bartual multi-locus sequence typing scheme [26–28]. We observed a significant correlation between gpi alleles and the efflux pump overexpression determined by RT-qPCR (p = 0.03). These results suggest that efflux pump overexpression profiles may be linked to certain lineages of A. baumannii. However, upon post-hoc analysis with Bonferroni correction for alpha inflation, no specific gpi allele was significantly associated with efflux pump overexpression. Whole genome sequencing data from A. baumannii strains included in this study would be useful to confirm or refute our findings.

However, our study has several limitations. Strains used in this study were isolated from a single hospital in France and results may not be representative of the whole strain distribution of A. baumannii in other parts of the world. In addition, RT-qPCR analysis is dependent on various experimental conditions which make comparison between different approaches challenging. Furthermore, we included a limited number of efflux pump genes which does not account for the much larger diversity of efflux pump genes that have been identified in A. baumannii and which could be significant determinants of resistance [7]. However, we included efflux pumps genes for which sufficient published data is available pertaining to their role in ciprofloxacin resistance.

In summary, our results highlight that the inhibition assay using NMP alone can be reasonably employed as a screening test to rule out efflux pump overexpression in A. baumannii. However, it is not sufficient to confidently identify efflux-mediated resistance to ciprofloxacin in A. baumannii strains, and confirmatory testing is recommended in inhibition assay positive strains. Therefore, an integrative approach using multiple techniques (like RT-qPCR) appears essential in order to comprehensively assess the role of efflux pumps in phenotypic antibiotic resistance.

FUNDING

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

COMPETING INTERESTS

The authors have no relevant financial or non-financial interests to disclose.

AUTHOR CONTRIBUTION

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Victor Zosim and Morgane Choquet. The first draft of the manuscript was written by Victor Zosim and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

DATA AVAILABILITY

All the data produced for this manuscript will be available upon request to the corresponding author.

Murray CJL, Ikuta KS, Sharara F, Swetschinski L, Aguilar GR, Gray A et al Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet 2022 12;399:629–655. 10.1016/S0140-6736(21)02724-0
Rice LB Federal Funding for the Study of Antimicrobial Resistance in Nosocomial Pathogens: No ESKAPE. J INFECT DIS 2008 15;197:1079–1081. 10.1086/533452
WHO TEAM, Antimicrobial Resistance Division, Global Coordination and Partnership, Selection M, IP and, Affordability (2017) Prioritization of pathogens to guide discovery, research and development of new antibiotics for drug-resistant bacterial infections, including tuberculosis [Internet]. World Health Organization (WHO); doi: https://www.who.int/publications/i/item/WHO-EMP-IAU-2017.12
Centers for Disease Control and Prevention (U.S.) Antibiotic resistance threats in the United States, 2019 [Internet]. Centers for Disease Control and Prevention (U.S.); 2019 [cited 2023 1]. doi: https://stacks.cdc.gov/view/cdc/82532doi: 10.15620/cdc:82532
Castanheira M, Mendes RE, Gales AC (2023) Global Epidemiology and Mechanisms of Resistance of Acinetobacter baumannii-calcoaceticus Complex. Clin Infect Dis 1:76:S166–S178. 10.1093/cid/ciad109
Poirel L, Bonnin RA, Nordmann P (2011) Genetic basis of antibiotic resistance in pathogenic Acinetobacter species. IUBMB Life 63:1061–1067. 10.1002/iub.532
Kornelsen V, Kumar A Update on Multidrug Resistance Efflux Pumps in Acinetobacter spp. Antimicrob Agents Chemother 2021 17;65:e00514–e00521. 10.1128/AAC.00514-21
Du D, Wang-Kan X, Neuberger A, van Veen HW, Pos KM, Piddock LJV et al (2018) Multidrug efflux pumps: structure, function and regulation. Nat Rev Microbiol 16:523–539. 10.1038/s41579-018-0048-6
Rajamohan G, Srinivasan VB, Gebreyes WA (2010) Molecular and functional characterization of a novel efflux pump, AmvA, mediating antimicrobial and disinfectant resistance in Acinetobacter baumannii. J Antimicrob Chemother 65:1919–1925. 10.1093/jac/dkq195
Xz L P P, H N. The challenge of efflux-mediated antibiotic resistance in Gram-negative bacteria. Clinical microbiology reviews [Internet] 2015 [cited 2023 27];28. doi: https://pubmed.ncbi.nlm.nih.gov/25788514/doi: 10.1128/CMR.00117 – 14
Pannek S, Higgins PG, Steinke P, Jonas D, Akova M, Bohnert JA et al Multidrug efflux inhibition in Acinetobacter baumannii: comparison between 1-(1-naphthylmethyl)-piperazine and phenyl-arginine-β-naphthylamide. J Antimicrob Chemother 2006 1;57:970–974. 10.1093/jac/dkl081
Choquet M, Lohou E, Pair E, Sonnet P, Mullié C Efflux Pump Overexpression Profiling in Acinetobacter baumannii and Study of New 1-(1-Naphthylmethyl)-Piperazine Analogs as Potential Efflux Inhibitors. Antimicrob Agents Chemother 2021 17;65:e00710–e00721. 10.1128/AAC.00710-21
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res 129:e45
Lomovskaya O, Warren MS, Lee A, Galazzo J, Fronko R, Lee M et al (2001) Identification and Characterization of Inhibitors of Multidrug Resistance Efflux Pumps in Pseudomonas aeruginosa: Novel Agents for Combination Therapy. Antimicrob Agents Chemother 45:105–116. 10.1128/AAC.45.1.105-116.2001
Bina XR, Philippart JA, Bina JE Effect of the efflux inhibitors 1-(1-naphthylmethyl)-piperazine and phenyl-arginine-β-naphthylamide on antimicrobial susceptibility and virulence factor production in Vibrio cholerae. J Antimicrob Chemother 2009 1;63:103–108. 10.1093/jac/dkn466
Ribera A, Ruiz J, Jiminez de Anta MT, Vila J Effect of an efflux pump inhibitor on the MIC of nalidixic acid for Acinetobacter baumannii and Stenotrophomonas maltophilia clinical isolates. J Antimicrob Chemother 2002 1;49:697–698. 10.1093/jac/49.4.697
Chevalier J, Bredin J, Mahamoud A, Malléa M, Barbe J, Pagès J-M (2004) Inhibitors of Antibiotic Efflux in Resistant Enterobacter aerogenes and Klebsiella pneumoniae Strains. Antimicrob Agents Chemother 48:1043–1046. 10.1128/aac.48.3.1043-1046.2004
Blair JMA, Bavro VN, Ricci V, Modi N, Cacciotto P, Kleinekathӧfer U et al (2015) AcrB drug-binding pocket substitution confers clinically relevant resistance and altered substrate specificity. Proc Natl Acad Sci U S A 17:112:3511–3516. 10.1073/pnas.1419939112
Leus IV, Roberts SR, Trinh A, Yu W, Zgurskaya E HI. Nonadditive functional interactions between ligand-binding sites of the multidrug efflux pump AdeB from Acinetobacter baumannii. J Bacteriol 2023 18;206:e00217–e00223. 10.1128/jb.00217-23
Yoon E-J, Courvalin P, Grillot-Courvalin C (2013) RND-Type Efflux Pumps in Multidrug-Resistant Clinical Isolates of Acinetobacter baumannii: Major Role for AdeABC Overexpression and AdeRS Mutations. Antimicrob Agents Chemother 1157:2989–2995. 10.1128/aac.02556-12
Coyne S, Rosenfeld N, Lambert T, Courvalin P, Périchon B (2010) Overexpression of Resistance-Nodulation-Cell Division Pump AdeFGH Confers Multidrug Resistance in Acinetobacter baumannii. Antimicrob Agents Chemother 54:4389–4393. 10.1128/aac.00155-10
Llanes C, Hocquet D, Vogne C, Benali-Baitich D, Neuwirth C, Plésiat P (2004) Clinical Strains of Pseudomonas aeruginosa Overproducing MexAB-OprM and MexXY Efflux Pumps Simultaneously. Antimicrob Agents Chemother 48:1797–1802. 10.1128/aac.48.5.1797-1802.2004
Seupt A, Schniederjans M, Tomasch J, Häussler S Expression of the MexXY Aminoglycoside Efflux Pump and Presence of an Aminoglycoside-Modifying Enzyme in Clinical Pseudomonas aeruginosa Isolates Are Highly Correlated. Antimicrob Agents Chemother 2020 16;65:e01166–e01120. 10.1128/AAC.01166-20
Rosenfeld N, Bouchier C, Courvalin P, Périchon B (2012) Expression of the Resistance-Nodulation-Cell Division Pump AdeIJK in Acinetobacter baumannii Is Regulated by AdeN, a TetR-Type Regulator. Antimicrob Agents Chemother 1256:2504–2510. 10.1128/aac.06422-11
Pournaras S, Gogou V, Giannouli M, Dimitroulia E, Dafopoulou K, Tsakris A et al Single-Locus-Sequence-Based Typing of bla OXA-51-like Genes for Rapid Assignment of Acinetobacter baumannii Clinical Isolates to International Clonal Lineages. J Clin Microbiol 2020 21;52:1653–1657. 10.1128/jcm.03565-13
Bartual SG, Seifert H, Hippler C, Luzon MAD, Wisplinghoff H, Rodríguez-Valera F (2005) Development of a Multilocus Sequence Typing Scheme for Characterization of Clinical Isolates of Acinetobacter baumannii. J Clin Microbiol 43:4382–4390. 10.1128/JCM.43.9.4382-4390.2005
Gaiarsa S, Batisti Biffignandi G, Esposito EP, Castelli M, Jolley KA, Brisse S et al Comparative Analysis of the Two Acinetobacter baumannii Multilocus Sequence Typing (MLST) Schemes. Front. Microbiol. [Internet] 2019 3 [cited 2024 3];10. doi: https://www.frontiersin.org/journals/microbiology/articles/10.3389/fmicb.2019.00930/fulldoi: 10.3389/fmicb.2019.00930
Tomaschek F, Higgins PG, Stefanik D, Wisplinghoff H, Seifert H Head-to-Head Comparison of Two Multi-Locus Sequence Typing (MLST) Schemes for Characterization of Acinetobacter baumannii Outbreak and Sporadic Isolates. PLoS ONE 2016 12;11:e0153014. 10.1371/journal.pone.0153014
Héritier C, Poirel L, Fournier P-E, Claverie J-M, Raoult D, Nordmann P (2005) Characterization of the Naturally Occurring Oxacillinase of Acinetobacter baumannii. Antimicrob Agents Chemother 49:4174–4179. 10.1128/AAC.49.10.4174-4179.2005

Table 1.bla_OXA-51and gpi primers used in this study [25,28].

Target gene	Sequence (5’-3’)
bla_oxa-51	FWD, CTAATAATTGATCTACTCAAG
bla_oxa-51	REV, CCAGTGGATGGATAGATTATC
gpi	FWD, GAAATTTCCGGAGCTCACAA
gpi	REV, TCAGGAGCAATACCCCACTC

Table 2. Agreement between the inhibition assay (IA) and the RT-qPCR results (n = 58 strains).

		IA_NMP/PAβN^a		IA_NMP^a		IA_PAβN^a
		Negative	Positive	Negative	Positive	Negative	Positive
RT-qPCR	Negative	20	15	28	7	24	11
	Positive	4	19	9	14	12	11
	Total	24	34	37	21	36	22
Cohen’s kappa [CI_95%]		0.37 [0.15, 0.59]		0.41 [0.17, 0.65]		0.17 [-0.09, 0.42]

a) MICs for ciprofloxacin ± NMP/PAβN were obtained from Choquet et al. [11]

Table 3. Inhibition assay (IA) negative strains overexpressing efflux pumps.

Strain	Gene	Log2 Fold change mean	Lowerbound CI_95%	p
ABAM 39	adeG	2.90	1.28	0.04
ABAM 66	adeJ	1.82	1.41	0.03
ABAM 83	adeJ	1.80	1.48	0.02
ABAM 87	adeB	1.54	1.51	<0.01

No competing interests reported.

TableS1ands2.docx

1-(1-naphthylmethyl)-piperazine inhibition assay successfully rules out efflux pump overexpression in Acinetobacter baumannii

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

RESULTS

DISCUSSION

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1