Numerous studies have employed the fruit fly Drosophila melanogaster to examine the genetic and non-genetic influences on ageing and senescence. Non-genetic factors that can affect Drosophila lifespan include changes in larval densities (Leips & Mackay, 2000), heat shock, hunger stress, temperature (Vieira et al., 2000), courtship activity, mating frequency (Chapman et al., 1995), gender (Leips & Mackay, 2000; Mackay et al., 2012), and nutrition (Chapman et al., 1995; Chippindale et al., 1993). Ayroles et al. (2009) hypothesize that a large number of genes with minor effects also affect lifespan, although the consequences of these alleles also rely on the genetic history of individuals (Leips & Mackay, 2000). We compared the whole genome sequences of the selected FLJ populations and their ancestral control JB populations to determine if long-term selection for faster development and late reproduction in a stable, stress-free, and pathogen-free environment will cause any changes in the genetic architecture of the immune system of Drosophila. Despite the culture conditions being stable, stress-free, and pathogen-free, we discovered that two immune function genes, Tep3 and NimB5, had evolved genomic changes in the protein coding region, in response to selection for faster development and late reproduction. Tep3 predicted favourable selection because it gained a stop codon in FLJ that had been lost in JB. Comparing JB with sequence of Drosophila melanogaster from database we found loss of stop codon in JB at exactly the same position where FLJ gained it. Further, NimB5 had a splice donor variation, suggesting that this protein may be impaired as a result of selection. When the transcript levels were checked, Tep3 showed a substantial difference in transcript levels, whereas NimB5 did not, with FLJs having a greater amount of Tep3 transcript, verifying the gene's positive selection. Additionally, it was discovered that Tep3 has been shown to interact with important immune modulators such as PPO1, NimC1, imd, and Rel, thus correlating with some of our earlier findings reported in Shrivastava et al. (2022a).
The Drosophila Tep family consists of six genes, Tep1 through Tep6, one of which, Tep5, does not seem to be expressed. Tep6 (also known as macroglobulin-complement related, MCR) is an outlier in this Drosophila family because the serine for cysteine alteration in the motif is thought to render the thioester binding site non-functional (Lagueux et al., 2000). Tep1, 2, 3, and 4 are expressed by epithelia, haemoglobin, fat bodies, and other tissues. Tep expression is induced by a variety of immune stressors in both larvae and adults. Teps regulation appears to be influenced by the Toll, Imd, JAK-STAT, and Mekk1 pathways. According to one study (Dostálová et al., 2017), flies lacking Tep were unable to trigger Drosomycin expression. In our case FLJs had positive selection for Tep3, and we reported higher transcript levels of Drosomycin in FLJs (Shrivastava et al., 2022a), thus corroborating the results of Dostálová et al. (2017).
NimB5 also had high impact variant, this gene has been reported to be produced downstream of metabolic sensors and ecdysone signalling, generated in the fat body in response to nutritional constraint (Ramond et al., 2020). Although the transcript levels were not different between the selected and control populations, it is highly likely to have modified itself through splicing thus might be playing a homeostatic role in response to higher ecdysone titre (Chauhan et al., 2020). Further, the flies nutritional status revealed reduced insulin signalling as reported in Shrivastava & Shakarad, (2023), with reduced insulin signalling coming from upregulation of foxo (Shrivastava et al., 2023). Thus, NimB5 genomic changes might be working as a modulator for the same.
Taken together, Tep3 and NimB5 genomic changes (being reported in this study) and the molecular (Shrivastava et al., 2022a) and hormonal (Chauhan et al., 2020) changes might together be responsible for difference in basal immune state of JBs and FLJs (Shrivastava et al., 2022a), which in turn might be modulating redox homeostasis genes (Shrivastava et al., 2022b). This study along with the earlier study (Shrivastava et al., 2022a) opens new door to study immune system in homeostasis state so as to better understand the autoimmune disorders and thus devise better therapeutics.
Table 1
Rp49 Forward | CCGCTTCAAGGGACAGTATC |
Rp49 Reverse | ATCTCGCCGCAGTAAACG |
Tep3 Forward | TCCAAGGGTCCATGTGATGC |
Tep3 Reverse | TAATCCCAACCCGTTCACCG |
NimB5 Forward | CGTAACGACAACGGTGACTG |
NimB5 Reverse | GTCTCGTCCAGCTTGTAGCC |