Antibodies and reagents
anti-p62 (18420-1-AP), anti-GAPDH (10494-1-AP), anti-Tubulin (66031-1-IG), anti-Beclin (81115-1-RR), anti-TGF-β (21898-1-AP) were purchased from proteintech (Wuhan, Hubei, China); anti-ATG5(12994T), anti-LC3B(83506s)were purchased from Cell Signaling Technology (Danvers, MA, USA); anti-phosphorylated smad2/3 (K009346P), anti-smad2 (K005398P), anti-smad3 (K000497P) were purchased from Solarbio༈Beijing, China༉; anti-α sma (WL02510) was purchased from Wanleibio (Shenyang, Liaoning, China) ; anti-LC3(ab192890) was purchased from abcam (Cambridge, UK). Doxorubicin and dehydroergosterol (DHE) were purchased from Sigma-Aldrich (Santa Clara, CA, USA); Bafilomycin A1 was purchased from meilunbio (Dalian, Liaoning, China); Hematoxylin and eosin/HE assay and Masson’s trichrome assay kit were obtained from Solarbio (Beijing, China).
Animal and Treatment
8–10 Weeks old male C57BL/6 mice were purchased form Vital River Laboratory Animal Technology (Beijing, China). Mice were individually housed in cages at well-ventilated and pathogen-free environment of 22–24°C with a 12-hour light/dark cycle per day, measured basal atrial systolic and diastolic diameter in the first week. The mice were injected with recombinant adeno-associated virus 9 expressing Control, shRNA-ATG5 or ATG5 (4×10^11 µg/mg, Shandong Weizhen Biotechnology) through tail vein for 3 weeks. Then mice were intraperitoneally injected with doxorubicin (Cat# D1515, Sigma- Aldrich, USA) at a dosage of 5 mg/kg/week or vehicle for 4 weeks. All animal experiments performed in this study were approved by the Animal Experimentation Ethics Committee of Binzhou Medical University and in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals.
Echocardiography
Mice were placed in an anesthesia induction box and anesthetized with 11 − 1.5% isoflurane and 98.5–99% O2 and maintain the heart rate at 450–500 beats/Min. The transthoracic echocardiography was performed on mice using high resolution micro-imaging systems (Vevo 1100, VisualSonics, Canada) with a 30 MHz transducer. A two-dimensional guided M-mode trace from parasternal long axis crossing the papillary muscle was recorded. Left atrium dimension (LAD) at end-diastole was analyzed. All measures were averaged from at least three cardiac cycles under stable conditions.
AF Stimulation
Mice were anesthetized by administration of 2.5% tribromoethanol (0.02 mL/g; Sigma-Aldrich, St. Louis, MO, USA), then a Millar 1.1F octapolar EP catheter (Scisense) was inserted into the right atrium via the right jugular vein, as others previously described20. The stimulation voltages were delivered at a voltage magnitude 3.5v, 5v, and 8v, and the frequencies were decreased from 40Hz to 20Hz at a frequency space of 2Hz. A total of 33 pacing bursts were performed per mice, and each pacing bursts lasted 5 seconds. Atrial fibrillation induction is defined as reproducible episodes of the wave of AF lasting more than 1 second. The duration of AF was defined as the sum of all AF occurrence times during pacing bursts.
Histopathology
Fresh atria were fixed in 4% paraformaldehyde (Servicebio, Wuhan China) for 48 hours, embedded in paraffin, then cut into 5 µm sections as we previously described21. Then Masson’s trichrome staining was performed according to the instructions provided by the reagent supplier (Solarbio, Beijing, China). The digital images were taken by fluorescence microscope (BX51, OLYMPUS, Japan).
DHE staining
Fresh atrial tissue was embedded in Tissue-Tek OCT (SAKURA, Japan), quickly frozen at -20°C, and then immediately cut into 10µm sections. The sections were stained with 10 µM DHE (Sigma-Aldrich, Santa Clara, CA, USA) in a dark wet chamber at room temperature for 30 min, then washed by PBS buffer for 5 min 3 times. Images of each heart section were obtained in 10–20 random fields and the red fluorescence intensity reflects the reactive oxygen species (ROS) level, the fluorescence intensity be measure by Image Pro Plus 3.0 (Nikon, Tokyo, Japan).
Immunofluorescent staining
Atrial tissue was fixed in 4% paraformaldehyde and dehydrated in 30% sucrose overnight, then embedded in Tissue-Tek OCT (SAKURA, Japan) and quickly frozen at -20°C. The samples were cut into 10µm sections, and the sections were permeabilize in a PBS buffer containing 1% BSA and 1‰ TritonX-100 for 15 min, then blocked with goat serum (1:200, meilunbio, Dalian, China) for 1h at room temperature. The sections were incubated with anti-actinin (1:500, Sigma-Aldrich) and anti-LC3B (1:100, Proteintech) at 4°C overnight, and proper secondary antibody for 1h. Images were obtained by laser scanning confocal microscope (TCS SP8, Leica Microsystems).
Cell Culture and Treatment
HL-1 cells were purchased from Procell Life Science&Technology (Wuhan, China). HL-1 cells were maintained in Claycomb medium completed with 10% fetal bovine serum (Gibco,USA), 2 mM l-glutamine, 0.1 mM norepirephrine, and 100 µg/mL penicillin/streptomycin at 37°C in humidified atmosphere of 5% CO2.
HL-1 cells were incubated with Saline or DOX (1µM) for 12h, 24h and 48h, then subjected to Western blots and qPCR assay.
Autophagic flux detection
HL-1 cells were transfected with RFP-GFP-LC3 lentivirus (0.1*10^8/ml MOI = 10, Hanheng Bio, Shanghai) for 24 hours. Then cells were treated with DOX (1µM) for 12h in the presence or absence of lysosome inhibitor Bafilomycin A1(Baf A1, 50 nM) at 2h before the images were captured. After the cells were stained with DAPI for 5min, the autophagic flux were detected by laser scanning confocal microscope (TCS SP8, Leica Microsystems). The red dots represent
autophagolysosomes, and the green dots represents autophagosome
.
Western blots
The atrial tissue or HL-1 cells were lysed with ice-cold RIPA buffer containing 1% protease inhibitor cocktail for 30 min, then the samples were centrifuged at 4℃ for 15 min. The protein concentration was determined with BCA assay kit (ThermoScience). 20-50mg of protein was separated using 10–12% SDS-PAGE gel, and then transferred to PVDF membrane via electrotransfer on ice and 300 mA for 2h (Merck, USA). After blocking with 5% skim milk resolved in TBST (Solarbio, D8340) for 1 h at room temperature, the membrane was probed with the primary antibodies at 4°C overnight. After washing by TBST, the membrane was incubated with horseradish peroxidase-conjugated secondary antibody (1:2500, proteintech) at room temperature for 1 h. After washing by TBST for 5 min 3 times, the protein expression was determined using enhanced chemiluminescence with the Pierce® Western Blotting Substrate (Thermo Fisher Scientifc) and Gel-Pro 4.5 Analyzer.
Quantitative polymerase chain reaction (qRT-PCR)
Total RNA was extracted from atrial tissues using TRIzol (Invitrogen, Carlsbad, CA) and then reversed into double-stranded cDNA by TaKaRa cDNA Synthesis Kit. RT-qPCR was conducted by the SYBR PremixEx Taq II kit (DRR081, Takara) on an ABI 7500 instrument (ABI, USA) and the Thermo Fisher QuantStudio3 system. β-actin was used as an internal control for mRNA and the 2−ΔΔCt method was used to analyze the relative levels of gene expression. The primers be used are as follows: β-actin (forward: CATTGCTGACAGGATGCAGAAGG; reverse: TGCTGGAAGGTGGACAGTGAGG), ATG5(forward: CTTGC ATCAAGTTCAGCTCTTCC; reverse: AAGTGAGCCTCAACCGCATCCT), Beclin (forward: CAGCCTCTGAAACTGGACACGA; reverse: CTCTC CTGAGTTAGCCTCTTCC), ATG7 (forward: CCTGTGAGCTTGG ATCAAAGGC; reverse: (GAGCAAGGAGACCAGAACAGTG), ATG12 (forward: GAAGGCTGTAGGAGACACTCCT; reverse: GGAAGGGGCAA AGGACTGATTC), LC3B (forward: GTCCTGGACAAGACCAAGTTCC; reverse: CCATTCACCAGG AGGAAGAAGG).
Measurement of intracellular ROS
DCF-DA was employed to detect the ROS generation in HL-1 cells. After drug treatment, HL-1 cells were wash 3 times with PBS and then incubated with 1 ml DMEM culture medium containing 10µM DCF-DA for 20 min at 37℃ in dark. After the cells were washed with PBS for 3 times, the photographs were captured by a fluorescence microscope (BX51, OLYMPUS, Japan), and the fluorescence intensitywas analyzed by Image Pro Plus 3.0 (Nikon, Tokyo, Japan).
Measurements of GSH, MDA level and CAT activity
According to the manufacturer’s instructions, after drug treatment, the activities of these enzymes in supernatants from HL-1 cells were measured in a microplate reader. The kits for measuring the activities of MDA and CAT were purchased from Solarbio (Beijing, China). The GSH assay kit was purchased from Beyotime Institute of Biotechnology (Shanghai, China).
Statistical Analyses
Data are expressed as mean ± SEM. The one-way ANOVA with a Bonferroni post hoc test was employed for the comparison of multiple groups. Data with p < 0.05 were considered statistically significant. All data were analyzed by GraphPad Prism 6.07 (GraphPad Software Inc.).