Materials
Polyclonal rabbit antibody against LUZP1 (#HPA028542, 1:50 dilution for IF analysis; 1:500 dilution for WB), monoclonal mouse antibody (#V9131) against full-length human vinculin, (1:400 IF), mouse monoclonal (M4401) against NMIIA-RLC (1:100 IF), mouse monoclonal antibody against α-tubulin C-terminus (#T5168, 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19) RLC (#3674, 1:1000 dilution for WB) was purchased from Cell Signaling Technology. Rabbit polyclonal antibody (#PAB1195) recognizing the full-length GAPDH (1:10,000 WB) was purchased from Abcam. Polyclonal NMHC-IIA antibody (#909801) binding to the C-terminal tail residues 1948–1960 (1:1,000 IF and WB) and NMHC-IIB antibody (#909901) binding to residues 1965–1976 in the C terminus (1:100 IF, 1:400 WB) were purchased from BioLegend. Rabbit polyclonal antibody against GFP tag (#50430-2-AP, 1:4,000 WB) was purchased from Proteintech. DAPI (#D1306; 1:10,000 IF). Alexa fluor phalloidin 568 (#A12380, 1:100 IF) and 647 (#A22287, 1:100 IF), Alexa Fluor goat anti-mouse 488 (#A11001), 568 (#A11004), and 647 (#A31571), Alexa Fluor goat anti-rabbit 488 (#A11034, 1:200 IF) and 647 (#A21245, 1:200 IF), and both HRP-conjugated goat anti-rabbit (#G-21234, 1:20, 000) and HRP-conjugated goat anti-mouse (G-21040; 1:10,000) antibodies were purchased from Jackson ImmunoResearch.
CRISPR construct design
A guide sequence targeting exon 1 of the human LUZP1 gene was selected based on the CRISPR Design Tool (Ran et al., 2013). Oligonucleotides for cloning guide RNA into the pSpCas9 (BB)-2A-GFP vector (48138; a gift from F. Zhang, Addgene, Cambridge, MA) were designed as described previously (Ran et al., 2013). Transfected cells were detached 24 hours after transfection and suspended in complete DMEM supplemented with 10 mM Hepes. Cells were subsequently sorted with FACSAria II (BD), using low-intensity GFP-positive pass gating. A GFP-positive single cell was sorted into one well of a 96-well plate containing 200 µL of DMEM containing 20% FBS and 10 mM Hepes. CRISPR clones were cultivated for approximately 2 weeks before selecting clones with no discernible LUZP1 protein expression. Five clones exhibiting identical phenotypes with no detectable LUZP1 protein expression survived. One clone was selected for use in this study, and the LUZP1 knockout was validated with sequencing. In order to confirm the CRISPR knockout, several primers were designed around the guide RNA binding site. Only primers that were more than 2 kbp away from the site gave the PCR product, indicating that there is a big deletion. The PCR products were confirmed by Sanger sequencing. The region for sequencing was amplified using primers: forward primer (LUZP1_NGS_F):
ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGATGATGGTCTCCAGCT GT; Reverse primer (LUZP1_NGS_R4): AGGCATTCCGCACAGTAACA. The obtained PCR products were sanger-sequenced with LUZP1_NGS_F primer.
Plasmids
The Full-length human LUZP1 coding sequence in the pENTR221 vector (ORFeome Library, Genome Biology Unit supported by HiLIFE and the Faculty of Medicine, University of Helsinki, and Biocenter Finland) was cloned into the pEGFP-N1 backbone (Takara Bio Inc.) with XhoI and Kpn1 restriction sites. Two missense mutations were corrected by cloning. The truncated mutants were cloned from full-length LUZP1-GFP using the same restriction sites. mEmerald-MyosinIIA-N-14 (Addgene plasmid #54191) and mApple-LC-myosin-C-10 (Addgene plasmid #54919) were gifts from Michael Davidson. The human GFP-β-actin plasmid was a gift from M. Bahler (Westfalian Wilhelms-University, Münster, Germany). Full-length human ROCK1 coding sequence in pDONR221 (ORFeome Library, Genome Biology Unit supported by HiLIFE and the Faculty of Medicine, University of Helsinki, and Biocenter Finland) was cloned into a destination vector tagged with EGFP.
Cell Culture
Human osteosarcoma (U2OS) cells and human ovarian cancer cell line A2780 were maintained in high-glucose (4.5 g/L) DMEM, supplemented with 10% FBS (Gibco), 10 U/ml penicillin, 10 µg/ml streptomycin, and 20 mM l-glutamine (10378-016; Gibco). Human breast cancer cell line MDA-MB-231 was maintained in RPMI-1640, supplemented with 10% FBS (Gibco), 10 U/ml penicillin, 10 µg/ml streptomycin, and 20 mM l-glutamine (10378-016; Gibco). All cells were regularly tested negative for mycoplasma with MycoAlert Plus (Lonza) and maintained at 37°C in a humidified atmosphere with 5% CO2 flow. Transient transfections were performed with Fugene HD (#E2311, Promega), according to the manufacturer’s instructions using a 3.5:1 Fugene/DNA ratio and 48 hours of incubation before fixation with 4% PFA in PBS. For live cell and SIM imaging, cells were detached 24 h after transfection with Trypsin-EDTA (0.25% wt/vol) and re-plated onto 10 µg/ml fibronectin (Roche) pre-coated MatTek dishes with glass bottoms. siRNA was transfected with lipofectamine RNAiMAX (#13778-075, ThermoFisher), according to the manufacturer’s instructions, using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN). A 72-hour incubation period was used to deplete the target protein.
Western blotting
U2OS cells were lysed for 10 min at 4°C with radioimmunoprecipitation assay (RIPA) lysis buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 1 mM PMSF, 10 mM DTT, 40 µg/ml DNaseI mM, 1 mM Na3VO4 and 1 µg/ml aprotinin, leupeptin). The lysates were briefly sonicated before centrifugation at 13,000 rpm for 10 min at 4°C. Protein concentrations were determined with Bradford reagent (500-0006; Bio-Rad Laboratories) and equal amounts of protein were loaded and run on 4–20% gradient SDS-PAGE gels (4561096; Bio-Rad Laboratories). Proteins were transferred from SDS-PAGE gels to nitrocellulose membranes using Trans-Blot Turbo (Bio-Rad Laboratories). Membrane was blocked in 5% milk or 5% BSA in TBS and incubated overnight at 4°C and for 1 hour at RT with primary and secondary HRP-conjugated antibodies, respectively. Proteins were detected with Western Lightning ECL Pro substrate (PerkinElmer).
Real-time quantitative PCR
Total mRNA was extracted with the GeneJET RNA purification kit (K0731; Thermo Fisher Scientific) and single-stranded cDNA was synthesized (K1671; Thermo Fisher Scientific) from 500 ng of the extracted mRNA. Primers amplifying around 200-bp region from the isoforms of human LUZP1 (LUZP1-1076aa and LUZP1-1026aa), and human GAPDH were designed with the Primer-BLAST tool (Ye et al., 2012). Real-time quantitative PCR (RT-qPCR) reactions were performed with Maxima SYBR Green/ROX (K0221; Thermo Fisher Scientific) in Bio-Rad Laboratories CFX96. mRNA levels were calculated with the 2−ΔΔCt method, normalized to GAPDH (ΔCt) and WT expression levels, respectively.
Primers used in this study
Both forward (F) and reverse (R) primers used in this study are presented. Complementary sequences to the target cDNAs are underlined.
Guide RNA oligonucleotides for CRISPR, targeting exon 1 of human LUZP1. e1-hsLUZP1-F: 5′- CACCGGTAGCTTAAACCGCAAGTGG-3′, e1-hsLUZP1-R: 5′-AAACCCACTTGCGGTTTAA GCTACC-3′.
Cloning primers for LUZP1-1076aa-GFP (LUZP1-GFP) and truncated GFP tagged LUZP1-1076aa proteins: LUZP1-GFP-F: 5′-CGCGCTCGAGATGGCCGAATTTACAAGCTACAAG-3′, LUZP1-GFP-R: 5′-CGCGGGTACCACGTTCTCCTCAGCACAGGGCCTGGT-3′; LUZP1_1-252-F: 5′-CA CTGCCGTCCACGGTACCGCGGGCCCG-3′, LUZP1_1-252-R: 5′-GGTACCGTGGACG GCAGTGTGGAAGAGATGCC-3′; LUZP1_1-550-F: 5′-GGCAACGGAAGTACGGTAC CGCGGGCCCG-3′, LUZP1_1-550-R: 5′-GGTACCGTACTTCCGTTGCCAAGCACGTG TC-3′; LUZP1_550-1076-F: 5′-GATCTCGAGATGAGTCAAGTAACTCAGGCTGCAAA C-3′, LUZP1_ 550-1076-R: 5′-TACTTGACTCATCTCGAGATCTGAGTCCGGTAGC-3′; LUZP1_252-550-F: 5′-CGCGCTCGAGATGAAAGAATCAAGAAGGAAGGGTGG-3′, LUZP1_252-550-R: 5′-CGCGGGTACCGTACTTCCGTTGCCAAGCACGTG-3′.
Quantitative PCR oligonucleotides for LUZP1_1076aa, LUZP1_1026aa and human GAPDH. LUZP1 _1076aa-F: 5′-CTCAGCAAGCATGGAGGAAG-3′, LUZP1_1076aa-R: 5′-AGGCAGTTCAGACG GATCCA-3′; LUZP1_1026aa-F: 5′-CTCACTGTGTCAGAGGTGCT-3′, LUZP1_1026aa-R: 5′-GC TGCTCATGCTTGCTGAGT-3′; GAPDH-F: 5′-TGCACCACCAACTGCTTAGC-3′, GAPDH -R: 5′-GGCATGGACTGTGGTCATGAG-3′.
Immunofluorescence microscopy
U2OS cells were fixed with 4% PFA for 20 min at RT, followed by three washings with PBS, and permeabilized with 0.1% Triton X-100 in PBS for 8 min. The permeabilized cells were subsequently blocked with 0.2% BSA in Dulbecco’s PBS. Primary and secondary antibodies diluted with Dulbecco’s PBS were incubated with cells overnight at 4°C and 1 h at RT in a dark, humidified chamber, respectively. Alexa-conjugated phalloidin was added along with primary antibodies. For normal immunofluorescence (IF) imaging, samples were directly mounted in Mowiol, containing 2.5% wt/vol 1,4-diazabicyclo [2.2.2] octane (DABCO, D27802, Sigma-Aldrich). Samples for 3D-structured illumination microscopy (3D-SIM) were prepared according to a previous study (Kraus et al., 2017). Briefly, cells were further post-fixed with 4% PFA for 10 min at RT after the secondary antibody incubation. After washing three times with PBS, samples were mounted in Prolong™ Glass Antifade Mountant (P36980, Thermo Fisher Scientific). All IF data were obtained with a Leica TCS SP8 laser scanning confocal microscope with a 63 x 1.3 NA glycerol objective. The numbers and widths of actin filament bundles from cells plated on crossbow-shaped micro-patterns were analyzed using FilamentSensor software as described before (Eltzner et al., 2015). The lamella width, cell height, and nuclei position on crossbow-shaped micro-patterns were analyzed by Image J (version 1.53c).
3D-SIM
All 3D-SIM images were obtained at RT using Deltavision OMX Super Resolution (Cytiva) with a 60 x Plan-Apochromat N/1.42 NA oil objective, 1.516 RI immersion oil, a laser module with 488-, 568-, and 640 nm diode laser lines, and three sCMOS cameras, and operated through Acquire SR 4.4 acquisition software. SI reconstruction and image alignment were performed with SoftWoRx 7.0. Imaging arrays of 1024 x 1024 or 512 x 512 were used, both with pixel sizes of 0.08 µm, 0.08 µm, and 0.125 µm (x, y and z).
Live cell imaging
For measuring the flow rate of arc filaments, U2OS cells were trypsinized after being transiently transfected with GFP-actin for 24 h and re-plated prior to imaging on 10 µg/ml fibronectin-coated glass-bottomed dishes (MatTek Corporation). The time-lapse live cell images were acquired with a Zeiss LSM 880 confocal microscope combined with an Airyscan detector. ZEN software (Zeiss), a 63 x magnified plan-apochromat oil immersive objective with NA = 1.40 were used for the image acquisition. Culture dishes were placed in a 37°C sample chamber with a controlled 5% CO2 flow. The recording setting is every 5 seconds for at least 15 minutes. One focal plane was recorded for all the time-lapse videos. The flow rate of arc filaments was measured by manual blind quantification from the same frame of the time-lapse videos.
Migration and Invasion Assay
For random cell migration measurement, cells were plated on 10 µg/ml fibronectin-coated twelve-well plates (Greiner), and the plate lid was switched to Cell-Secure (CM Technologies) enabling the insertion of CO2 input and output valves. Cells were allowed to attach for two hours, washed once with PBS, and replaced with complete DMEM containing 10 mM HEPES prior to starting imaging. Phase contrast time-lapse imaging of migrating cells was conducted on the continuous cell culturing platform Cell-IQ (CM Technologies). The average migration velocity of wild-type and LUZP1 knockout cells was quantified by tracking the nucleus movement in between 20 min imaging cycles for 12 hours with a Cell-IQ analyzer (CM Technologies). Only cells that did not collide with one another were selected for measurements. Mean squared displacement (MSD) is calculated according to the following formulas:
MSD=\(\frac{1}{\text{N}}{\sum }_{i=1}^{N}{\left({x}^{i}\left(t\right)-{x}^{i}\left(0\right)\right)}^{2}+{\left({y}^{i}\left(t\right)-{y}^{i}\left(0\right)\right)}^{2}\)
For the scratch wound-healing assay, U2OS and LUZP1 knockout cell monolayers with 90–95% confluent were scratched with a 200-µL pipette tip, resulting in a cell-free gap between two adjoining areas. Cells were washed three times with PBS to remove cell debris, and complete DMEM supplemented with 10 mM HEPES was added. Cells that migrated into the wound area were recorded with every 2 h imaging cycle for 12 hours using the continuous cell culturing platform Cell-IQ (CM Technologies). The gap distance was measured using image J (version 1.53c).
For cell migration and invasion, 1–2×105 cells in 200 µl of serum-free medium were seeded into individual wells of an 8.0 mm, 24-well plate chamber insert (354578, Corning Life Sciences). Then, 500 ul of culture medium containing 10% FBS was added to the bottom of the insert, and the plate was incubated at 37 ◦C with 5% CO2 for 24 h. After removing the medium, the inserts were washed with PBS, and the cells on the upper surface of the insert were gently removed by scrubbing with a cotton swab. The cells on the bottom surface of the insert were then sequentially fixed with 4% PFA for 5 min, stained with 0.5% crystal violet blue for 5 min, washed three times with PBS, and rinsed with double-distilled water. The positively stained cells were observed using a fluorescence microscope. For the cell invasion assay, Matrigel-coated chambers (354483, Corning Life Sciences) were utilized instead of the chamber inserts used in the migration assay.
Traction force microscopy
To measure the actomyosin forces that cells exert on their underlying substrate, we used traction force imaging as previously described (Jiu et al., 2017). In brief, both wild-type and LUZP1 knockout cells were cultured for 3–8 hours on custom made 35 mm dishes (Matrigen) coated with fibronectin and displaying specific stiffness (Young’s modulus = 25 kPa). Cells and the underlying microspheres were imaged with a 3I Marianas imaging system containing a heated sample chamber (+ 37°C) with 5% CO2 flow (3I intelligent Imaging Innovations, Germany). 63x/1.2 W C-Apochromat Corr WD = 0.28 M27 objective was used. After the first set of images, cells were detached from the substrates with 2.5% Trypsin (Lonza) and a second set of microsphere images were taken to serve as reference images. Displacement maps were achieved by comparing the reference microsphere images to the first set of images, and by knowing the displacement field and substrate stiffness, cell-exerted traction fields were computed by Fourier-Transform Traction Cytometry. Root mean squared (RMS) magnitudes were computed from the traction fields. Analyses were performed blind, and cell borders were manually traced.
Density-gradient fractionation
NM-IIA fractionation was performed as previously described with slight modifications (Shutova et al., 2012). In brief, cells were scraped from 125-mm cell culture dishes into lysis buffer, and the supernatant was collected after centrifuging for 20 min at 20,000 g at 4°C. The amounts of proteins were measured with a Bradford assay, and equal amounts (900 µg) of proteins were applied on the top of a 16 ml 10–30% continuous sucrose density gradient and centrifuged at 74,400 g for 15 h at 4°C (SW 32.1 Ti; Beckman Coulter). 24 equal volume fractions were collected, precipitated, and resuspended into the Laemmli sample buffer. The samples were separated with SDS-PAGE, transferred to nitrocellulose membranes, and probed with NMHC-IIA and α-tubulin antibodies.
Statistical Analysis
Statistics were performed with Excel (Microsoft). Sample sizes and the number of replications are indicated in the figures. For data following a normal distribution, Student’s two-sample unpaired t test was used. If the data did not follow a normal distribution, Mann-Whitney u-test for two independent samples was conducted. For all normalizations to WT expression/protein levels, the mean value obtained from the WT sample was set to 1, and the individual intensity data was normalized to that value. For quantitative PCR, the relative gene expression was calculated by the 2−ΔΔCt method. Both WT and knockout/knockdown data were normalized to GAPDH before further normalization. Statistical differences in RMS traction between the WT and LUZP1 KO groups were assessed by using the non-parametric Mann-Whitney-Wilcoxon rank-sum (MWW) test. Geneious (Biomatters Limited) analysis tool was used for sequence alignments in supplemental Figure S3C.
The quantification of NM-IIA filament population distribution from the SIM data was conducted as described in (Fenix et al., 2016) with the following modifications: 5-µm-wide area of the lamellum was drawn with ImageJ (version 1.53c), starting from the most distal NM-IIA filament detected along the cell edge. The NM-IIA stack length in the stress fibers was manually measured using ImageJ.
For the quantification of focal adhesion, all images were manually and blindly quantified from control and LUZP1 depleted cells with ImageJ. Each individual adhesion size was measured with the ROI Manager and freehand line tools in ImageJ. Cells that adhered to several neighbors were discarded from the analysis. Adhesion was classified into seven size groups, and the percentual ratio of the focal adhesion in each class was obtained by dividing the focal adhesion number of individual size classes with the total number of focal adhesions.