Animals
Snx25 constitutive KO (Snx25+/-) mice (B6/N-Snx25tm1a/Nju, Nanjing BioMedical Research Institute of Nanjing University (NBRI); strain name, B6/N-Snx25tm1a/Nju, strain number T001400) were obtained from NBRI. Snx25 cKO mice were generated by first crossing our Snx25 LacZ/+ mice with CAG-Flpo mice (B6.Cg-Tg(CAG-FLPo)/1Osb), which were a gift from M. Ikawa (Osaka University), in order to excise the LacZ cassette framed by Frt sites and obtain an allele with floxed exon 4 (Snx25fl/fl mice) [22]. We crossed Cx3cr1CreERT2 mice (B6.129P2(C)-Cx3cr1tm2.1(Cre/ERT2)Jung/J) (Jackson Laboratory, Stock No. 020940) with Snx25fl/fl mice to obtain Cx3cr1CreERT2/WT; Snx25fl/fl mice (Cx3cr1CreER; Snx25fl/fl). We crossed Cx3cr1CreERT2/WT; Snx25fl/fl mice with reporter mice RCL-ChR2(H134R)/EYFP (Ai32 mice, Jackson Laboratory, Stock No. 012569) to obtain Cx3cr1CreERT2/WT; Snx25fl/fl; Ai32/+ mice (Cx3cr1CreER; Snx25fl/fl; Ai32). We crossed Advillin-cre mice (B6.Cg-Tg(Avil-Cre/ERT2)AJwo/J) (Jackson Laboratory, Stock No. 032027) with Snx25fl/fl mice to obtain AvilCreERT2/WT; Snx25fl/fl mice. All mice were housed in standard cages under a 12-h light/dark cycle and temperature-controlled conditions. All protocols for animal experiments were approved by the Animal Care Committee of Nara Medical University. All animal experiments are conducted in accordance with the policies established in the NIH Guide for the Care and Use of Laboratory Animals. This study was also carried out in compliance with the ARRIVE guidelines (https://arriveguidelines.org/). Euthanasia was performed by blood release under deep anesthesia (medetomidine, midazolam, and butorphanol), by perfusion fixation, or by cervical dislocation.
Behavioral test
To assess sensitivity to a weak tactile stimulus, mice were acclimatized for at least 15 min in individual clear acrylic cubicles (10 × 10 × 10 cm) placed on top of an elevated wire mesh. Calibrated von Frey’s filaments (Muromachi kikai, 0.008–1g) were used to stimulate the plantar surface of the hind paws [23, 24]. Withdrawal immediately after the 1 s stimulus was considered as a positive response. The plantar surface was stimulated 10 times with each filament and the number of positive responses was measured [23, 24]. For the tactile test after NGF (N-240, Alomone Labs) injection, 100 ng NGF (10 µl) was injected subcutaneously into the plantar surface of the right hind paw.
Reagents
For tamoxifen (TAM) treatment, we employed oral administration. TAM (T5648, Sigma-Aldrich) was mixed with powdered chow (0.5 mg/g normal chow). This oral administration method is convenient for continuous administration and results in efficient induction of recombination while minimizing stress on the mice [13]. For depletion of macrophages in hind paw skin, we used clodronate liposomes (MKV300, Cosmo Bio).
Clodronate liposome treatment
Twenty microliters of 10 mg/ml clodronate liposomes or control liposomes (MKV300) were subcutaneously injected into the right side of the hind paw skin on days 0 and 3. Three days after the second injection, a tactile test was performed.
4-OHT treatment
For depletion of SNX25 in dermal macrophages, we administered 4-OHT (40 ng/ml, 10 ml) by intradermal injection daily for seven days into Cx3cr1CreER; Snx25fl/fl mice or Cx3cr1CreER; Snx25fl/fl; Ai32 mice. Vehicle was injected into the contralateral side of the same animal. At 8 days after the last injection, a von Frey test was performed.
Immunohistochemistry
Mice were anesthetized and perfused transcardially with saline followed by 4% paraformaldehyde (PFA, 09154-85, Nacalai Tesque) in 0.1 M phosphate buffer (pH 7.4) (PB). Skin, DRG, sciatic nerve, and spinal cord were removed, postfixed overnight in the same fixative, and then immersed in 30% sucrose in PB overnight. Next, the tissues were frozen in powdered dry ice, embedded in Tissue-Tek OCT compound (4583, Sakura Finetek), and stored at -80°C prior to sectioning. Eighteen-micrometer-thick sections were immersed in PBS containing 5% bovine serum albumin and 0.3% Triton X-100 for 1 h. Antibodies against rabbit anti-TH (1:500, 657012, Calbiochem), rabbit anti-TrkA (1:150, ab76291, Abcam), rat anti-GFP (1:5000, 04404-84, Nacalai Tesque), and rabbit anti-GFP (1:5000, A6455, Thermo Fisher Scientific) were applied overnight at 4°C. Alexa Fluor 488- and 594-conjugated IgG (1:1000, Life Technologies) were used as secondary antibodies. Images were captured using a confocal laser scanning microscope (C2, Nikon).
qRT-PCR
Total RNA of cells or tissues was extracted using a NucleoSpin RNA Kit (740955, Takara Bio). Total RNA extracts were reverse-transcribed using random primers and a QuantiTect Reverse Transcription kit (205311, Qiagen), according to the manufacturer’s instructions. Real-time PCR was performed using a Thermal Cycler Dice Real Time System (Takara Bio), with THUNDERBIRD SYBR qPCR Mix (QPS-201, Toyobo). PCR primers used in this study were as follows (all 5¢®3¢): Asic3 sense primer, TAAGACCACCCTGGATGAGC, and Asic3 antisense primer, GTAGGCAGCATGTTCAGCAG; β-actin sense primer, AGCCATGTACGTAGCCATCC; β-actin antisense primer, CTCTCAGCTGTGGTGGTGAA; Ngf sense primer, 5’-TCAGCATTCCCTTGACACAG-3’; Ngf antisense primer, 5’-GTCTGAAGAGGTGGGTGGAG-3’; Piezo1 sense primer, CCCTGTTACGCTTCAATGCT; and Piezo1 antisense primer, GCTACCGTTTTGTCCCAGAA; Piezo2 sense primer, GAACCAACCAAAGCAACGAT; and Piezo2 antisense primer, AGGCACAAATACCCTGATGC; Scn9a sense primer, AAGGTCCCAAGCCCAGTAGT; Scn9a antisense primer, AGGACTGAAGGGAGACAGCA; Scn10a sense primer, GCCTCAGTTGGACTTGAAGG; Scn10a, antisense primer, AGGGACTGAAGAGCCACAGA; Scn11a sense primer, TGATCTTCCCAGACGAGAGG; and Scn11a antisense primer, ATAAGGTCAGGGGGAACGTC; Trpv1 sense primer, CCCTCCAGACAGAGACCCTA; and Trpv1 antisense primer, GACAACAGAGCTGACGGTGA; Th sense primer, ACGGTGTACTGGTTCACTGTGGAGT; and Th antisense primer, ATGGTGTGAGGACTGTCCAGT; Trpa1 sense primer, CATGGACTGCTCCAAGGAAT; and Trpa1 antisense primer, GCACTTCACACGAAGAACCA; Trpv2 sense primer, GCAGTGCTGAGGTGAACAAA; and Trpv2 antisense primer, CCACACTGAAGAGTCGGTCA; Trpc1 sense primer, ATGTGCGAGAGGTGAAGGAG; and Trpc1 antisense primer, ACAGCATTTCTCCCAAGCAC; Trek1 sense primer, GCTGCTCAGAACTCCAAACC; and Trek1 antisense primer, TGGGCTATGAAGGTCTGCTT. Gene expression was quantified by the ΔΔCt method. Briefly, the relative concentration of the target gene and the reference gene (b-actin) was measured, and the relative concentration of the unknown concentration sample with respect to the reference gene was comparatively quantified. The signal value was denoted as a fold change corrected by the signal value of control (Snx25+/+, vehicle).
Western blotting
Tissue samples were lysed with 10 mM Tris, pH 7.4, containing 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 1% deoxycholic acid, and 0.1% sodium dodecyl sulfate (SDS). The homogenate was centrifuged at 20,600 g for 5 min, and the supernatant was stored at -20°C. Protein concentration was measured using a bicinchoninic acid protein assay kit (23225, Thermo Fisher Scientific). Equal amounts (5 mg) of protein per lane were electrophoresed on SDS-polyacrylamide gels, and then transferred to a polyvinylidene difluoride membrane. The blots were probed with rabbit anti-SNX25 (1:100, 13294-1-AP, Proteintech), rabbit anti-TH (1:500, 657012, Calbiochem), and rabbit anti-GAPDH (1:2000, ABS16, Merck Millipore) antibodies. Immunoblot analysis was performed with horseradish peroxidase-conjugated anti-rabbit and anti-goat IgG using enhanced chemiluminescence Western blotting detection reagents (297-72403 or 290-69904, Wako). Data were acquired in arbitrary densitometric units using ImageJ software.
Mechanical stretch of BMDMs
For the mechanical stretch experiment, BMDMs were seeded in a stretch chamber (STB-CH-04, STREX, Osaka, Japan) coated with 0.05 mg/ml fibronectin (Millipore, #FC010) and exposed to stretch up to 12.5%. Unstretched control BMDMs were treated equally but without application of mechanical stretch.
Bone marrow (BM) transplantation
BM recipients were male 8-week-old Snx25fl/fl mice. Mice were intraperitoneally injected with the chemotherapeutic agent busulfan (30 μg/g body weight; B2635, Sigma-Aldrich) in a 1:4 solution of dimethyl sulfoxide and PBS at 7, 5, and 3 days prior to BM transfer. All mice were treated with antibiotics (trimethoprim (35039, Nacalai Tesque) and sulfamethoxazole (S7507, Sigma)) for 14 days after busulfan treatment. BM-derived cells were obtained from the femur and tibia of 5-week-old Cx3cr1CreER; Snx25fl/fl mice and resuspended in PBS with 2% FBS. BM-derived cells (1 × 106) were transferred to recipient mice by tail vein injection.
Fluorescence-activated cell sorting (FACS)
For the analysis of the myeloid population in the skin, cells were obtained from hind paw skin from three mice using a Multi Tissue Dissociation Kit 1 (130-110-201, Miltenyi Biotec) with a gentleMACS dissociator (Miltenyi Biotec) according to the manufacturer’s instruction. The hind paw skin was minced by razor blade, and then subjected to enzymatic digestion at 37°C, for 2 h with rotation. During the enzymatic digestion, cells were dispersed by the programs (h_tumor_01, h_tumor_02, and h_tumor_03) of gentleMACS. Debris was removed by a 70-mm cell strainer. The cells were stained with various combinations of the following mAbs: Biotin-anti-CD19 (115504, BioLegend), Biotin-anti-NK1.1 (108704, BioLegend), APC anti-MHC-II (107613, BioLegend), FITC–anti-CD11c (107305, BioLegend), PE-anti-CD11b (101207, BioLegend), APC/Cyanine7 anti-Ly6C (128025, BioLegend), Brilliant violet 421 anti-CD45 (103134, BioLegend), Biotin anti-CD3 (100243, BioLegend), Biotin anti-TER119 (116203, BioLegend), Biotin anti-Ly6G (127603, BioLegend), and PerCP-Cyanine5.5 streptavidin (405214, BioLegend). To exclude dead cells from analysis, cells were stained with Fixable Viability Stain 700 (564997, BD Biosciences). Cells were analyzed and sorted using a Cell Sorter SH800S (Sony). Data were processed with FlowJo (v10) (Tree Star).
Extracellular recordings in vivo
Mice were anesthetized with urethane (1.2 mg/kg). The lumbar spinal cord was exposed at the lumber segments after laminectomy, and the mouse was fixed with a spinal cord clamp (STS-A-S, Narishige), and provided with a continuous supply of 100% oxygen during the course of the experiment. A tungsten electrode (impedance, 1 MΩ, FHC) was placed into the L4 dorsal funiculus at a depth of 100–400 µm from the dorsal surface of the spinal cord to record extracellular multi-unit activity. Innocuous mechanical stimuli were performed using an artist’s brush. Multi-unit activities were acquired with an AC differential amplifier (DAM80; World Precision Instruments). The data were digitized with an analog-to-digital converter (powerLab2/20; AD Instruments) and stored on a personal computer with a data acquisition program (LabChart software, AD Instruments). Firing frequency was analyzed with LabChart software (AD Instruments).
Electrical stimulation-induced paw withdrawal test
The electrical stimulation-induced paw withdrawal test was performed as previously described 25. Briefly, mice were placed in a polypropylene chamber without anesthesia and the left hind paw of each mouse was drawn thorough a hole in the chamber. After 5 min, electrodes (3 mm in diameter) were fastened to the left plantar surface and instep of the hind paw of each mouse. Transcutaneous nerve stimuli using each of three sine wave currents (5, 250, and 2000 Hz) were applied for 3 s through the electrodes. The current intensity was increased gradually, and the minimum current intensity of the paw withdrawal response was defined as the current stimulus threshold. Transcutaneous nerve stimuli using each sine wave current were applied at 5-min intervals. The same measurements were repeated 3–4 times for the same mouse on the experiment day and the next day (at 4-h intervals within a day). The paw withdrawal threshold was averaged from 3–4 measurements per paw. The experimenter was blinded to the genotype of the mice.
Quantification and statistical analysis
Quantifications were performed from at least three independent experimental groups. Data are presented as mean ± SEM. Statistical analyses were performed using Student’s t-test or Welch’s t-test for two groups, or one-way ANOVA for multiple groups, and significant differences between group means were identified with the Tukey–Kramer test. All statistical tests were two-tailed and p < 0.05 was considered significant. Statistical significance is indicated as asterisks: *p < 0.05, **p < 0.01. All n values are indicated in figure legends.Sample size was determined to be adequate based on the magnitude and consistency of measurable differences between groups. We confirmed that replicate experiments were successful by repeating at least three times for all experiments.